Protogenin as a novel surface marker for early cortical neural stem cells

Abstract

The present invention relates to a method for generating an enriched population of early cortical neural stem cells (NSCs) or a subpopulation thereof, the method comprising: isolating cells that are positive for the cell surface marker protogenin (PRTG) from an initial population of neural progenitor cells, wherein said isolating is conducted at a time point between about day 4 and about day 12, preferably on day 5, after initiation of neural induction, thereby obtaining an enriched population of early cortical neural stem cells (NSCs); and optionally re- culturing said enriched population of early cortical neural stem cells (NSCs) in a neural induction medium or other culture medium, wherein said re-culturing preferably produces progeny of said early cortical neural stem cells (NSCs).

Description

[0001]New PCT-Application Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Vossius Ref.: AJ1908 PCT Protogenin as a novel surface marker for early cortical neural stem cells The present invention relates to a method for generating an enriched population of early cortical neural stem cells (NSCs) or a subpopulation thereof, the method comprising: isolating cells that are positive for the cell surface marker protogenin (PRTG) from an initial population of neural progenitor cells, wherein said isolating is conducted at a time point between about day 4 and about day 12, preferably on day 5,after initiation of neural induction, thereby obtaining an enriched population of early cortical neural stemcells (NSCs); and optionally re-culturing said enriched population of early cortical neural stem cells (NSCs) in a neural induction medium or other culture medium, wherein said re-culturing preferably produces progeny of said early cortical neural stem cells (NSCs). In this specification, a number of documents including patent applications and manufacturer’s manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.During mammalian corticogenesis – i.e., the process during which the cerebral cortex of the brain isformed as part of the development of the mammalian nervous system – a wide diversity of neural stem cells (NSCs) orchestrates the development and organization of the cortex. Initially, there is the expansion of the NSC pool through proliferative symmetric divisions, whereas later, through differentiative asymmetric divisions, NSCs give rise to the diverse cell populations that reside within the cortical layers. Throughout this process, NSCs undergo extensive modifications in their transcriptomic profile and chromatin landscape contributing to the formation of heterogeneous progenitor populations. These NSCsubtypes are more restricted in their differentiation capacity, and thus more limited in the types ofneurons they can generate. Although in recent years much progress has been made towards understanding temporal cell-fate specification during human corticogenesis, the mechanisms responsible for the temporal lineage specification of NSCs remain largely unknown. Understanding the variability of these distinct NSCpopulations is key for developing an in vitro system that allows for the homogeneous and unlimitedculture of the desired NSC type which is crucial for cell replacement-based therapies.Stem cell-derived neural cultures hold great promise as a tool for functional studies to understand invivo cortical brain development. Even more importantly, the development of methods to reprogram adult somatic cells to generate pluripotent cells (Takahashi et al., 2007; Yu et al., 2007) makes possible togenerate patient-derived hiPSCs that provide the platform for in vitro disease modelling and drug discovery, as well as therapeutic advents to tackle a wide range of neurological diseases (Park et al., 2008, Lindvall et al., 2020. More recently, efforts to study the development and function of the human cerebral cortex in health and disease have promoted the establishment and optimization of multipleprotocols, especially involving 3D systems, for better mimicking in vivo development (Lancaster et al.,2014; Camp et al., 2015; Pasca et al., 2015; Quadrato et al., 2017; Eiraku et al., 2008; Velasco et al.,2019). Additionally, an improved in vitro model has been established relying on Triple-inhibition (dualSMAD-i and WNT-i) to promote cortical fates in a higher yield (Rosebrock et al., 2022). Given the vast array of diversity of neuronal cell types being generated during cortical development, one of the biggest challenges in neural differentiation is to reliably generate specific neuronal cell types which is a prerequisite for cell-based therapeutical approaches. Similarly, when utilizing stem cells as a startingmaterial for induction towards neural lineage differentiation in vitro, a heterogenic mixture of NSCs istypically obtained, impeding the study of individual subpopulations in isolation. In order to obtain a better understanding of this intricate process of cortical development, and to facilitatethe development of specific more targeted therapeutic approaches, it would be highly desirable to beingable to specifically generate and isolate early cortical NSC populations. This would allow a specific expansion of this NCS subtype and their derivatives and thereby pave the way for the identification of highly specific agents for manipulating these lineages in novel therapeutic and / or regenerative strategies. One particular objective would be to identify agents which maintain or even enhance the symmetric division status of early neural stem cells, which would allow a standardized production of these cells at higher quantities. However, as of to date, not at least due to the absence of any known specific cell surface marker, approaches allowing for a specific generation and / or isolation of early cortical neural stem cells (NSCs) and / or their subpopulation and / or progeny are still missing. The present invention addresses this need and provides related advantages as well. Hence, the present invention relates in a first aspect to a method for generating an enriched population of early cortical neural stem cells (NSCs) and / or a subpopulation thereof, the method comprising: isolating cells that are positive for the cell surface marker protogenin (PRTG) from an initial population of neural progenitor cells, wherein said isolating is conducted at a time point between about day 4 and about day 12, preferably on day 5, after initiation of neural induction, thereby obtaining an enriched population of early cortical neural stem cells (NSCs); and optionally re-culturing said enriched population of early cortical neural stem cells (NSCs) in a neuralinduction medium or other culture medium, wherein said re-culturing preferably produces progeny ofsaid early cortical neural stem cells (NSCs). The term “neural stem cells (NSCs)”, as used herein, refers to are self-renewing, multipotent cells that firstly generate the radial glial progenitor cells that generate the neurons and glia of the central nervoussystem of all animals. NSCs are capable of self-maintenance (self-renewal), meaning that with each celldivision, one daughter cell will also be a stem cell. The non-stem cell progeny of NSCs are termed “neural progenitor cells”. Neural progenitor cells generated from a single multipotent NSC are capable of differentiating into neurons, astrocytes, and oligodendrocytes. Hence, NSCs are “multipotent” because their progeny have multiple neural cell fates. Thus, NSCs can be functionally defined as a cell with the ability to: 1) proliferate, 2) self-renew, and 3) produce functional progeny that can differentiate into the three main cell types found in the central nervous system: neurons, astrocytes, and oligodendrocytes. The term “cortical neural stem cells”, as used herein, refers to neural stem cells (NSCs) that are commonly found in, or isolated from, the cerebral cortex (i.e., the outermost layer of the brain (the cerebrum)). The designation term “early” with reference to “cortical neural stem cells” refers to a early differentiation state of “cortical neural stem cells”, preferably a state where the “cortical neural stem cells” are capable of symmetric division. The term “subpopulation” of cells, as used herein, refers to a (more specific) subset of the referred (more generic) cell population. “Protogenin”, also known as “PRTG”, “protein Shen-Dan”, “protogenin homolog” or “IGDCC5” (immunoglobulin superfamily, DCC subclass, member 5), is a single-pass transmembrane protein that belongs to the immunoglobulin superfamily (IgSF). It contains four extracellular immunoglobulin domains and five fibronectin III domains, making it structurally related to deleted in colorectal cancer (DCC) and Neogenin, which are receptors for Netrin1 and RGMa, respectively, as well as to cell adhesion molecules such as L1 and neural cell adhesion molecule (NCAM). As used herein, the term PRTG also refers to any known isoforms thereof. The nucleotide sequences of the PRTG-encoding genes and mRNAs from different species and the amino acid sequences of the respectively encoded proteins are known in the art and can be retrieved from publicly available databases such as the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) or UniProt (https: / / www.uniprot.org / ). For example, the mRNA (more specifically cDNA) and corresponding amino acid sequence of the human PRTG-encoding gene is defined by NCBI Reference Sequence: NM_173814.6; see also UniProt accession code Q2VWP7. The “isolating” cells that are positive for a cell surface marker may be established by any method known in the art that can be suitably employed for that purpose, such as in particular cell sorting (e.g., fluorescence-activated cell sorting (FACS)). As used herein, the term “isolating” may be an “enriching”, meaning that the isolated population may not be entirely pure with respect to the targeted population but also comprise certain amounts of the unwanted species as impurity. In preferred embodiment, the isolation yields a target cell population (i.e., PRTG-positive cells) which make up at least, with increasingpreference, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% of the total amounts of cellscomprised in the isolated population. As used herein, the term “initiation of neural induction” refers to the provision of culture conditions by which the differentiation of the stem cells towards neural cell linages is effected. In particular preferredembodiments, said neural induction is initiated as described in the herein disclosed examples. However,alternative approaches may also be suitable. In connection with all times described herein (e.g., “between about day 4 and about day 12”), the term “about” means, with increasing preference, ±18h, ±12h, ±10h, ± 8h, ±6h, ±4h, ±2h, ±1h of the referred times. In preferred embodiments of the method according to the first aspect of the invention, said initial population of neural progenitor cells has been obtained from, or is obtained by: (i) culturing primate stem cells in a primate stem cell medium until the formation of embryonic bodies (EBs); and (ii) culturing the EBs as obtained in step (i) in a neural induction medium comprising an inhibitor of WNT, an inhibitor of TGF-β, and an inhibitor of BMP, thereby initiating neural induction, whereby the EBs differentiate into neural progenitor cells. The nature of the primate stem cells to be used herein is not particularly limited as long as they display the capability of differentiating into embryonic bodies (EBs) when subjected to the method of the presentinvention. In preferred embodiments, the primate stem cells are human primate stem cells.The composition of the primate stem cell medium is not particularly limited as long as the culturing of primate stem cells in the medium under suitable conditions results in the formation of embryonic bodies (typically with 1, 2, 3, 4, 5 or 6 days, i.e., less than one week). Embryonic bodies (EBs) are three-dimensional aggregates of pluripotent stem cells. They compromise the three embryonic germ layers. EBs are formed by the homophilic binding of the Ca2+dependent adhesion molecule E-cadherin, which is highly expressed on undifferentiated primate stem cells. When cultured as single cells in the absence of anti-differentiation factors, primate stem cells spontaneously aggregate to form EBs.Similarly, the composition of the “neural induction medium” is not particularly limited as long as theculturing of EBs in the medium under suitable conditions results in the differentiation of EBs into neural progenitor cells. WNT signalling is an important pathway for neural induction as well as for the axis patterning process. It has roles in both cell proliferation and fate specification. Inhibition of WNT pathway establishes anterior fates. Studies in mice mutants of the WNT co-receptors Lrp5 and Lrp6 show the expansion of the anterior neuroectoderm. Loss of the WNT inhibitor Dickkopf 1 (Dkk1) in mouse prevents the formationof forebrain. Wnt1 is expressed in caudal midbrain-hindbrain regions, and in accordance therewith, lossof Wnt1 in mouse embryos leads to defects in midbrain and anterior hindbrain formation, while Wnt8c overexpression causes the expansion of midbrain fates on the expanse of anterior forebrain fates. Transforming growth factor beta (TGF-β) is a multifunctional cytokine belonging to the transforminggrowth factor superfamily that includes three different mammalian isoforms (TGF-β 1 to 3, HGNCsymbols TGFB1, TGFB2, TGFB3) and many other signalling proteins. Signalling by the transforming growth factor β (TGF-β) family is necessary for proper neural development and function throughout life. Sequential waves of activation, inhibition, and reactivation of TGF-β family members regulate numerous elements of the nervous system from the earliest stages of embryogenesis through adulthood (Meyer and Kessler (2017), Cold Spring Harb Perspect Biol.2017 Aug; 9(8): a022244.). Bone morphogenetic proteins (BMPs) are a group of growth factors also known as cytokines and as metabologens. Originally discovered by their ability to induce the formation of bone and cartilage, BMPs are now considered to constitute a group of pivotal morphogenetic signals, orchestrating tissue architecture throughout the body. Inhibition of BMP signalling is a prerequisite for the induction of neural plate from ectoderm. Studies identified that the ability of the Spemann organizer or the notochord in neutralizing the overlying ectoderm is due to the expression of BMP antagonist proteins like Noggin, Follistatin and Chordin. They prevent the binding of BMPs. especially BMP-4 to its receptor, thereby inhibiting the BMP pathway. The inhibitors of TGFβ, BMP and / or WNT signalling may either inhibit the nucleic acid encoding TGFβ,BMP and / or a member of the WNT signalling and / or inhibit the protein TGFβ, BMP or a protein being amember of the WNT signalling pathway. The inhibitor of the nucleic acid molecule is preferably selected from a small molecule, an aptamer, a siRNA, a shRNA, a miRNA, a ribozyme, an antisense nucleic acid molecule, a CRISPR-Cas9-based construct, a CRISPR-Cpf1-based construct, a meganuclease, a zinc finger nuclease, and a transcription activator-like (TAL) effector (TALE) nuclease. The inhibitor of the protein is preferably selected from a small molecule, an antibody or antibody mimetic, and an aptamer, wherein the antibody mimetic is preferably selected from affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and probodies. The "small molecule" as used herein is preferably an organic molecule. Organic molecules relate or belong to the class of chemical compounds having a carbon basis, the carbon atoms linked together by carbon-carbon bonds. The original definition of the term organic related to the source of chemical compounds, with organic compounds being those carbon-containing compounds obtained from plant or animal or microbial sources, whereas inorganic compounds were obtained from mineral sources. Organic compounds can be natural or synthetic. The organic molecule is preferably an aromatic molecule and more preferably a heteroaromatic molecule. In organic chemistry, the term aromaticity is used to describe a cyclic (ring-shaped), planar (flat) molecule with a ring of resonance bonds that exhibits more stability than other geometric or connective arrangements with the same set of atoms. Aromatic molecules are very stable, and do not break apart easily to react with other substances. In aheteroaromatic molecule at least one of the atoms in the aromatic ring is an atom other than carbon,e.g. N, S, or O. For all above-described organic molecules the molecular weight is preferably in the range of 200 Da to 1500 Da and more preferably in the range of 300 Da to 1000 Da. Alternatively, the "small molecule" in accordance with the present invention may be an inorganiccompound. Inorganic compounds are derived from mineral sources and include all compounds withoutcarbon atoms (except carbon dioxide, carbon monoxide and carbonates). Preferably, the small molecule has a molecular weight of less than about 2000 Da, or less than about 1000 Da such as less than about 500 Da, and even more preferably less than about Da amu. The size of a small molecule can be determined by methods well-known in the art, e.g., mass spectrometry. The small molecules may be designed, for example, based on the crystal structure of the target molecule, where sites presumably responsible for the biological activity can be identified and verified in in vivo assays such as in vivo high- throughput screening (HTS) assays. The term “antibody” as used in accordance with the present invention comprises, for example, polyclonal or monoclonal antibodies. Furthermore, also derivatives or fragments thereof, which still retain the binding specificity to the target, e.g. TGFβ, are comprised in the term "antibody". Antibody fragments or derivatives comprise, inter alia, Fab or Fab’ fragments, Fd, F(ab')2, Fv or scFv fragments, single domain VH or V-like domains, such as VhH or V-NAR-domains, as well as multimeric formats such as minibodies, diabodies, tribodies or triplebodies, tetrabodies or chemically conjugated Fab’-multimers (see, for example, Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 198; Harlow and Lane “Using Antibodies: A Laboratory Manual” Cold Spring Harbor LaboratoryPress, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75(13),1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 1126). The multimeric formats in particular comprise bispecific antibodies that can simultaneously bind to two different types of antigen. The first antigen can be found on the protein of the invention. The second antigen may, for example, be a tumor marker that is specifically expressed on cancer cells or a certain type of cancer cells. Non- limting examples of bispecific antibodies formats are Biclonics (bispecific, full length human IgG antibodies), DART (Dual-affinity Re-targeting Antibody) and BiTE (consisting of two single-chain variable fragments (scFvs) of different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20(7):838-847). The term "antibody" also includes embodiments such as chimeric (human constant domain, non-human variable domain), single chain and humanised (human antibody with the exception of non-human CDRs) antibodies. Various techniques for the production of antibodies are well known in the art and described, e.g. in Harlow and Lane (1988) and (1999) and Altshuler et al., 2010, loc. cit. Thus, polyclonal antibodies can be obtained from the blood of an animal following immunisation with an antigen in mixture with additives and adjuvants and monoclonal antibodies can be produced by any technique which provides antibodies produced by continuous cell line cultures. Examples for such techniques are described, e.g. in Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: ALaboratory Manual, Cold Spring Harbor Laboratory Press, 1999 and include the hybridoma techniqueoriginally described by Köhler and Milstein, 1975, the trioma technique, the human B-cell hybridoma technique (see e.g. Kozbor D, 1983, Immunology Today, vol.4, 7; Li J, et al.2006, PNAS, vol.103(10), 3557) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, Alan R. Liss, Inc, 77-96). Furthermore, recombinant antibodies may be obtained from monoclonalantibodies or can be prepared de novo using various display methods such as phage, ribosomal, mRNA,or cell display. A suitable system for the expression of the recombinant (humanised) antibodies may be selected from, for example, bacteria, yeast, insects, mammalian cell lines or transgenic animals or plants (see, e.g., US patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23(9), 11265). Further, techniques described for the production of single chain antibodies (see, inter alia, US Patent 4,946,778) can be adapted to produce single chain antibodies specific for a desired epitope, e.g. of TGFβ. Surface plasmon resonance as employed in the BIAcore system can be used to increase the efficiency of phage antibodies. As used herein, the term “antibody mimetics” refers to compounds which, like antibodies, can specifically bind antigens, such as for example, TGFβ in the present case, but which are not structurally related to antibodies. Antibody mimetics are usually artificial peptides or proteins with a molar mass of about 3 to 20 kDa. For example, an antibody mimetic may be selected from the group consisting of affibodies, adnectins, anticalins, DARPins, avimers, nanofitins, affilins, Kunitz domain peptides, Fynomers®, trispecific binding molecules and prododies. These polypeptides are well known in the art and are described in further detail herein below.The term “affibody”, as used herein, refers to a family of antibody mimetics which is derived from the Z-domain of staphylococcal protein A. Structurally, affibody molecules are based on a three-helix bundle domain which can also be incorporated into fusion proteins. In itself, an affibody has a molecular mass of around 6kDa and is stable at high temperatures and under acidic or alkaline conditions. Target specificity is obtained by randomisation of 13 amino acids located in two alpha-helices involved in the binding activity of the parent protein domain (Feldwisch J, Tolmachev V.; (2012) Methods Mol Biol. 899:103-26). The term "adnectin" (also referred to as “monobody”), as used herein, relates to a molecule based on the 10th extracellular domain of human fibronectin III (10Fn3), which adopts an Ig-like β-sandwich fold of 94 residues with 2 to 3 exposed loops, but lacks the central disulphide bridge (Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Adnectins with the desired target specificity, i.e., for example, against TGFβ, can be genetically engineered by introducing modifications in specific loops of the protein. The term "anticalin", as used herein, refers to an engineered protein derived from a lipocalin (Beste G, Schmidt FS, Stibora T, Skerra A. (1999) Proc Natl Acad Sci U S A.96(5):1898-903; Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255). Anticalins possess an eight-stranded β-barrel which forms a highly conserved core unit among the lipocalins and naturally forms binding sites for ligands by means of four structurally variable loops at the open end. Anticalins, although not homologousto the IgG superfamily, show features that so far have been considered typical for the binding sites ofantibodies: (i) high structural plasticity as a consequence of sequence variation and (ii) elevated conformational flexibility, allowing induced fit to targets with differing shape. As used herein, the term "DARPin" refers to a designed ankyrin repeat domain (166 residues), whichprovides a rigid interface arising from typically three repeated β-turns. DARPins usually carry threerepeats corresponding to an artificial consensus sequence, wherein six positions per repeat are randomised. Consequently, DARPins lack structural flexibility (Gebauer and Skerra, 2009). The term “avimer”, as used herein, refers to a class of antibody mimetics which consist of two or more peptide sequences of 30 to 35 amino acids each, which are derived from A-domains of various membrane receptors and which are connected by linker peptides. Binding of target molecules occurs via the A-domain and domains with the desired binding specificity, e.g. for TGFβ, can be selected, for example, by phage display techniques. The binding specificity of the different A-domains contained in an avimer may but does not have to be identical (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). A “nanofitin” (also known as affitin) is an antibody mimetic protein that is derived from the DNA binding protein Sac7d of Sulfolobus acidocaldarius. Nanofitins usually have a molecular weight of around 7kDa and are designed to specifically bind a target molecule, such as e.g. TGFβ, by randomising the amino acids on the binding surface (Mouratou B, Béhar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31).The term “affilin”, as used herein, refers to antibody mimetics that are developed by using either gamma-B crystalline or ubiquitin as a scaffold and modifying amino-acids on the surface of these proteins by random mutagenesis. Selection of affilins with the desired target specificity, i.e., for example, against TGFβ, is effected, for example, by phage display or ribosome display techniques. Depending on the scaffold, affilins have a molecular weight of approximately 10 or 20kDa. As used herein, the term affilin also refers to di- or multimerised forms of affilins (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). A “Kunitz domain peptide” is derived from the Kunitz domain of a Kunitz-type protease inhibitor such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP) or tissue factor pathway inhibitor (TFPI). Kunitz domains have a molecular weight of approximately 6kDA and domains with the required target specificity, i.e., for example, against TGFβ, can be selected by display techniques such as phage display (Weidle et al., (2013), Cancer Genomics Proteomics; 10(4):155-68). As used herein, the term "Fynomer®" refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well-known in the art and have been described e.g. in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al (2007) Protein Eng Des Sel 20(2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12).The term “trispecific binding molecule” as used herein refers to a polypeptide molecule that possessesthree binding domains and is thus capable of binding, preferably specifically binding to three different epitopes. At least one of these three epitopes is an epitope of the protein of the fourth aspect of the invention. The two other epitopes may also be epitopes of the protein of the fourth aspect of the invention or may be epitopes of one or two different antigens. The trispecific binding molecule is preferably aTriTac. A TriTac is a T-cell engager for solid tumors which comprised of three binding domains beingdesigned to have an extended serum half-life and be about one-third the size of a monoclonal antibody. As used herein, the term "probody" refers to a protease-activatable antibody prodrug. A probody consists of an authentic IgG heavy chain and a modified light chain. A masking peptide is fused to the light chain through a peptide linker that is cleavable by tumor-specific proteases. The masking peptide prevents the probody binding to healthy tissues, thereby minimizing toxic side effects. Aptamers are nucleic acid molecules or peptide molecules that bind a specific target molecule. Aptamers are usually created by selecting them from a large random sequence pool, but natural aptamers also exist in riboswitches. Aptamers can be used for both basic research and clinical purposes as macromolecular drugs. Aptamers can be combined with ribozymes to self-cleave in the presence of their target molecule. These compound molecules have additional research, industrial and clinical applications (Osborne et. al. (1997), Current Opinion in Chemical Biology, 1:5-9; Stull & Szoka (1995), Pharmaceutical Research, 12, 4:465-483). Nucleic acid aptamers are nucleic acid species that normally consist of (usually short) strands ofoligonucleotides. Typically, they have been engineered through repeated rounds of in vitro selection orequivalently, SELEX (systematic evolution of ligands by exponential enrichment) to bind to various molecular targets such as small molecules, proteins, nucleic acids, and even cells, tissues and organisms. Peptide aptamers are usually peptides or proteins that are designed to interfere with other protein interactions inside cells. They consist of a variable peptide loop attached at both ends to a protein scaffold. This double structural constraint greatly increases the binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range). The variable peptide loop typically comprises 10 to 20 amino acids, and the scaffold may be any protein having good solubility properties. Currently, the bacterial protein Thioredoxin-A is the most commonly used scaffold protein, the variable peptide loop being inserted within the redox-active site, which is a -Cys-Gly-Pro-Cys-loop (SEQ ID NO: 1) in the wild protein, the two cysteins lateral chains being able to form a disulfide bridge. Peptide aptamer selection can be made using different systems, but the most widely used is currently the yeast two- hybrid system. Aptamers offer the utility for biotechnological and therapeutic applications as they offer molecular recognition properties that rival those of the commonly used biomolecules, in particular antibodies. In addition to their discriminatory recognition, aptamers offer advantages over antibodies as they can be engineered completely in a test tube, are readily produced by chemical synthesis, possess desirablestorage properties, and elicit little or no immunogenicity in therapeutic applications. Non-modifiedaptamers are cleared rapidly from the bloodstream, with a half-life of minutes to hours, mainly due to nuclease degradation and clearance from the body by the kidneys, a result of the aptamers' inherently low molecular weight. Unmodified aptamer applications currently focus on treating transient conditions such as blood clotting or treating organs such as the eye where local delivery is possible. This rapidclearance can be an advantage in applications such as in vivo diagnostic imaging. Several modifications,such as 2'-fluorine-substituted pyrimidines, polyethylene glycol (PEG) linkage, fusion to albumin or other half-life extending proteins etc. are available to scientists such that the half-life of aptamers can be increased for several days or even weeks. In accordance with the present invention, the term "small interfering RNA (siRNA)", also known as short interfering RNA or silencing RNA, refers to a class of 18 to 30, preferably 19 to 25, most preferred 21 to 23 or even more preferably 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome. siRNAs naturally found in nature have a well-defined structure: a short double-strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells tobring about the specific knockdown of a gene of interest. Essentially any gene for which the sequenceis known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. The double-stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and / or DNA methylation. Exogenously introduced siRNAs may be devoid of overhangs at their 3' and 5' ends, however, it is preferred that at least one RNA strand has a 5'- and / or 3'-overhang. Preferably, one end of the double-strand has a 3'-overhang from 1 to 5 nucleotides, more preferably from 1 to 3 nucleotides and most preferably 2 nucleotides. The other end may be blunt-ended or has up to 6 nucleotides 3'- overhang. In general, any RNA molecule suitable to act as siRNA is envisioned in the present invention. The most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21- nt antisense strands, paired in a manner to have a 2-nt 3'- overhang. The sequence of the 2-nt 3' overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair. 2'-deoxynucleotides in the 3' overhangs are as efficient as ribonucleotides but are often cheaper to synthesize and probably more nuclease resistant. Delivery of siRNA may be accomplished using any of the methods known in the art, for example by combining the siRNA with saline and administering the combination intravenously or intranasally or by formulating siRNA in glucose (such as for example 5% glucose) or cationic lipids and polymers can be used for siRNA delivery in vivo through systemic routes either intravenously (IV) or intraperitoneally (IP) (Fougerolles et al. (2008), Current Opinion in Pharmacology, 8:280-285; Lu et al. (2008), Methods in Molecular Biology, vol.437: Drug Delivery Systems – Chapter 3: Delivering Small Interfering RNA forNovel Therapeutics).A short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on todaughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved bythe cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it. si / shRNAs to be used in the present invention are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. Suppliers of RNA synthesis reagents are Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). Most conveniently, siRNAs or shRNAs are obtained from commercial RNA oligo synthesis suppliers, which sell RNA-synthesis products of different quality and costs. In general, the RNAs applicable in the present invention are conventionally synthesized and are readily provided in a quality suitable for RNAi. Further molecules effecting RNAi include, for example, microRNAs (miRNA). Said RNA species are single-stranded RNA molecules. Endogenously present miRNA molecules regulate gene expression by binding to a complementary mRNA transcript and triggering of the degradation of said mRNA transcript through a process similar to RNA interference. Accordingly, exogenous miRNA may be employed as an inhibitor of, for example, TGFβ after introduction into the respective cells. A ribozyme (from ribonucleic acid enzyme, also called RNA enzyme or catalytic RNA) is an RNA molecule that catalyses a chemical reaction. Many natural ribozymes catalyse either their own cleavage or the cleavage of other RNAs, but they have also been found to catalyse the aminotransferase activity of the ribosome. Non-limiting examples of well-characterised small self-cleaving RNAs are the hammerhead, hairpin, hepatitis delta virus, and in vitro-selected lead-dependent ribozymes, whereas the group I intron is an example for larger ribozymes. The principle of catalytic self-cleavage has become well established in recent years. The hammerhead ribozymes are characterised best among the RNA molecules with ribozyme activity. Since it was shown that hammerhead structures can be integrated into heterologous RNA sequences and that ribozyme activity can thereby be transferred to these molecules, it appears that catalytic antisense sequences for almost any target sequence can be created, provided the target sequence contains a potential matching cleavage site. The basic principle of constructing hammerhead ribozymes is as follows: A region of interest of the RNA, which contains the GUC (or CUC) triplet, is selected. Two oligonucleotide strands, each usually with 6 to 8 nucleotides, are taken and the catalytic hammerhead sequence is inserted between them. The best results are usually obtained with short ribozymes and target sequences. A recent development, also useful in accordance with the present invention, is the combination of an aptamer, recognizing a small compound, with a hammerhead ribozyme. The conformational change induced in the aptamer upon binding the target molecule can regulate the catalytic function of theribozyme.The term “antisense nucleic acid molecule”, as used herein, refers to a nucleic acid which is complementary to a target nucleic acid. An antisense molecule in accordance with the invention is capable of interacting with the target nucleic acid, more specifically it is capable of hybridizing with thetarget nucleic acid. Due to the formation of the hybrid, transcription of the target gene(s) and / ortranslation of the target mRNA is reduced or blocked. Standard methods relating to antisense technology have been described (see, e.g., Melani et al., Cancer Res. (1991) 51:2897-2901). CRISPR / Cas9, as well as CRISPR-Cpf1, technologies are applicable in nearly all cells / model organisms and can be used for knock out mutations, chromosomal deletions, editing of DNA sequences and regulation of gene expression. The regulation of the gene expression can be manipulated by the use of a catalytically dead Cas9 enzyme (dCas9) that is conjugated with a transcriptional repressor to repress transcription a specific gene, here, for example, the TGFβ gene. Similarly, catalytically inactive, "dead" Cpf1 nuclease (CRISPR from Prevotella and Francisella-1) can be fused to synthetic transcriptional repressors or activators to downregulate endogenous promoters, e.g., the promoter which controls TGFβ expression. Alternatively, the DNA-binding domain of zincfinger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can be designed to specifically recognize the TGFβ gene or its promoter region or its 5`-UTR thereby inhibiting the expression of the TGFβ gene. Inhibitors provided as inhibiting nucleic acid molecules that target the gene of interest, e.g., the TGFβ gene or a regulatory molecule involved in target gene expression are also envisaged herein. Such molecules, which reduce or abolish the expression of the target gene or a regulatory molecule include,without being limiting, meganucleases, zinc finger nucleases and transcription activator-like (TAL)effector (TALE) nucleases. Such methods are described in Silva et al., Curr Gene Ther.2011;11(1):11- 27; Miller et al., Nature biotechnology.2011;29(2):143-148, and Klug, Annual review of biochemistry. 2010; 79:213-231. In a second aspect, the present invention relates to a method of determining whether a test agent is an inhibitor or activator of the generation of early cortical neural stem cells (NSCs), the method comprising: (i) culturing primate stem cells in a primate stem cell medium until the formation of embryonic bodies (EBs); (ii) culturing the EBs as obtained in step (i) in a neural induction medium comprising an inhibitor of WNT, an inhibitor of TGF-β, and an inhibitor of BMP in the presence of the test agent; (iii) quantifying the cells that are positive for the cell surface marker protogenin (PRTG); and (iv) determining the test agent as an inhibitor if the number of PRTG-positive cells is reduced as compared to the absence of the test compound, or identifying the test agent as an activator if the number of PRTG-positive cells is increased as compared to the absence of the test compound. The “test agent” or “test compound”, as interchangeably referred to herein, is an “inhibitor” of the generation of early cortical neural stem cells (NSCs) if the number of cells that are positive for the cell surface marker protogenin (PRTG) is reduced by, with increasing preference, at least 10%, at least 20%,at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, and at least 90% ascompared to the absence of the test agent. Similarly, the “test agent” or “test compound”, as interchangeably referred to herein, is an activator of the generation of early cortical neural stem cells (NSCs) if the number of cells that are positive for thecell surface marker protogenin (PRTG) is increased by, with increasing preference, at least 10%, at least20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, and at least 90% as compared to the absence of the test agent. The method of the second aspect may also be conducted as a high-throughput assays, wherein several test agents are tested in parallel. This is generally performed in wells of microtiter plates. Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact the test agents with the assay mixture is preferably effected by one or more computer-controlled robotic systems including pipetting devices. In case large libraries of test agents are to be screened and / or screening is to be effected within a short time, mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well. In case a well exhibits the expected activity, said mixture of test compounds may be de-convoluted to identify the one or more test agents in said mixture giving rise to said activity. The nature of the test agent / compound is not particularly limited. The test agent is preferably a small molecule as defined in connection with the first aspect. It is understood that the term “activator”, as used in the context of the test agent also encompasses, andpreferably refers to an “accellerator”, i.e., an agent which enhances the cell divison rate per time by,with increasing preference, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least60%, at least 70%, at least 80%, and at least 90% as compared to the absence of the test agent.In preferred embodiments of the first and second aspect of the invention, said primate stem cells are: (i) primate embryonic stem cells (ESCs); or (ii) primate induced pluripotent stem cells (iPSCs). In even more preferred embodiments, the primate embryonic stem cells are human embryonic stem cells, and / or the primate induced pluripotent stem cells (iPSCs) are human induced pluripotent stem cells (iPSCs). In other or even more preferred embodiments of the first aspect of the invention, said isolating is conducted by cell sorting, preferably by fluorescence-activated cell sorting (FACS) or magnetic cell separation (e.g., Magnetic-activated cell sorting (MACS)), using an PRTG-binding agent, preferably a PRTG-binding antibody. As used herein, the term “cell sorting” refers to a method by which cells are mixed with a detectable binding partner (e.g., a fluorescently detectable anti-PRTG antibody or other binding agent specifically binding to PRTG) in solution. Alternatively, as described in the herein disclosed examples, the cells may be first contacted with a primary antibody specifically binding to PRTG (i.e., an anti-PRTG antibody), followed by a fluorescently detectable secondary antibody which specifically binds the primary antibody.Any conventional cell sorting method may be used. Fluorescence-activated cell sorting (FACS) is anexample of a cell sorting method. As used herein, the term “fluorescence activated cell sorting” or “FACS” refers to a method by which the individual cells of a sample are analyzed and sorted according to their optical properties (e.g., light absorbance, light scattering and fluorescence properties, etc.) as they pass in a narrow stream in single file through a laser beam. Fluorescence-activated cell sorting isa specialized type of flow cytometry. It provides a method for sorting a heterogeneous mixture ofbiological cells into two or more containers, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell. In other or even more preferred embodiments of the first aspect of the invention, said isolating isconducted at a time point between about day 4 and about day 12, preferably between about day 4 andabout day 6, more preferably on day 5, after initiation of neural induction, and whereby the cells of the enriched population of early cortical neural stem cells (NSCs) are characterized by: (i) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for one or more telencephalic-specific markers as compared to that in: (i-a) the initial population of neural progenitor cells prior to said isolating; and / or (i-b) the PRTG negative cells, as determinable, for example, by immunostaining; wherein preferably said telencephalic- specific marker(s) is / are selected from OTX2, NES, GLI3, CDH2 (N-cadherin), VIM, PAX6, FEZF1, LRP1, and RSPO2; (ii) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of OTX2-postive cells as compared to that in:(ii-a) the initial population of neural progenitor cells prior to said isolating; and / or (ii-b) the PRTG negative cells, as determinable, for example, by immunostaining; (iii) having a lower proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% lower proportion of GBX2-positive cells as compared to that in: (iii-a) the initial population of neural progenitor cells prior to said isolating; and / or (iii-b) the PRTG negative cells, as determinable, for example, by immunostaining; (iv) having a proportion of SOX2-positive cells and / or PAX6-positive cells that is between 80% and 100% of the total amount of cells; and / or having a proportion of TFAP2A-positive cells that is at most 20%, preferably at most 10% as compared to that in: (iv-a) the initial population of neural progenitor cells prior to said isolating; or (iv-b) the PRTG negative cells; as determinable, for example, by immunostaining; (v) having an increased ability for neural rosette formation, preferably evaluated after re- culturing for a duration of between about 8-12 days in neural induction medium as compared to of: (v-a) the initial population of neural progenitor cells prior to said isolating; and / or (v-b) the PRTG negative cells,as determinable, for example, by immunostaining; and / or (vi) in that at most, with increasing preference, 10%, 9%, 8%, 7%, 6% or less than 6% of the total amount of cells are PSCs (characterized, e.g., by expression of POU5F1 (OCT4) andIRX2) and / or neurons (characterized, e.g., by expression of STMN2 and DCX). In other or even more preferred embodiments of the first aspect of the invention, said optional re- culturing said enriched population of early cortical neural stem cells (NSCs) in a neural induction medium is conducted for a duration of between about 8 days to about 12 days, preferably for about 10 days,thereby obtaining cells that are characterized by:(i) having a higher, preferably an at least 10% higher proportion of PAX6-positive and / or FOXG1-positive cells as compared to that in: (i-a) the initial population of neural progenitor cells prior to said isolating; and / or (i-b) correspondingly re-cultured PRTG negative cells; as determinable, for example, by immunostaining; (ii) having an increased ability for neural rosette formation as compared to: (ii-a) the initial population of neural progenitor cells prior to said isolating; and / or (ii-b) correspondingly re-cultured PRTG negative; (iii) having a detectable expression of one or more of NR2F1, EMX2, VIM and / or PAX6; (iv) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for NR2F1,EMX2, VIM and / or PAX6, as compared to that in: (iv-a) the initial population of neural progenitor cells prior to said isolating; and / or (iv-b) correspondingly re-cultured PRTG negative; (v) in that at least, with increasing preference, 50%, 60%, 70%, 80%, 90%, or at least 95% or more of the cells express CDH2 (N-cadherin) and / or lack detectable expression of CDH1 (E-cadherin); and / or (vi) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for FEZF1, LRP2, RSPO2 and / or SOX5, and additionally positive for WNT5B and / or SEMA3A, as compared to that in: (vi-a) the initial population of neural progenitor cells prior to said isolating; and / or (vi-b) correspondingly re-cultured PRTG negative; wherein said cells are preferably a subpopulation or progeny of the enriched population of early cortical neural stem cells (NSCs). The above-referred markers are well known in the art, also under the herein referred abbreviations, and a vareity of methods suitable for assessing the expression of these markers by / on cells on the gene expression (mRNA) and / or protein expression level are also well known to the skilled person and can be readily employed for the herein envisaged purposes. In a third aspect, the present invention relates to an early cortical neural stem cell (NSC) or an enriched population of early cortical neural stem cells (NSCs) or a subpopulation or progeny thereof obtained or obtainable by the method according to the first aspect of the invention.In a fourth aspect, the present invention relates to composition comprising the early cortical neural stemcell (NSC) or enriched population of early cortical neural stem cells (NSCs) according to the third aspect of the invention. In a fifth aspect, the present invention relates to a composition according to the fourth aspect for use as a medicament. In a sixth aspect, the present invention relates to a composition according to the fourth or fifth aspect for use: (i) in treating, preventing, ameliorating at least one symptom, or slowing the progression of a disease that would benefit from an administration of said composition; and / or (ii) in cell replacement therapy, preferably in the treatment of a primate CNS disorder. In preferred embodiments of the sixth aspect of the invention, the disease that would benefit from an administration of said composition is selected from: - a disease of the CNS, preferably a neurodegenerative disease of the CNS, more preferably selected from Alzheimer's disease, Parkinson's disease (PD) and multiple sclerosis (MS); - a neuroinflammatory disease;- a neurodevelopmental disease, preferably a zikka- or mutated gene-induced microcephaly;- an acute brain disease (e.g., stroke) or brain injury, preferably a stroke occurring during a perinatal stage (i.e., in a prenatal embryo, preferably at a time point on or after week 20 of gestation) or an early post-birth stage (preferably until week 4 after birth); - a brain disease characterized by a shortage of cortical cells, malignant cortical cells (e.g., a brain disease characterized by a malignant conversion of cortical cells to a stem-cell like state, such as cancer stem cells) and / or a defective cortical cell formation; and / or - glioma, medulloblastoma, neuroblastoma and / or glioblastoma multiforme (GBM).In a seventh aspect, the present invention relates to an in-vitro or ex-vivo use of an PRTG-binding agentfor detection or imaging of early cortical NSCs. In an eighth aspect, the present invention relates to a use of PRTG as a cell surface marker for(i) in vitro, in vivo, in situ, or ex vivo detection and / or localization of early cortical NSCs;(ii) isolation of early cortical NSCs; (iii) enriching for early cortical NSCs; and / or (iv) maintaining, and optionally expanding, symmetrically dividing early cortical NSCs. In a nineth aspect, the present invention relates to a use of PRTG as a cell surface marker for enriching outer radial glial (oRG) cells. Outer radial glial (oRG) cells are a population of neural stem cells prevalent in the developing primate (including human) cortex that contribute to its cellular diversity and evolutionary expansion (Andrews et al. (2020), eLife; 9:e58737). Evolutionary expansion of the human neocortex is partially attributed to a relative abundance of oRG cells. oRG cells display a characteristic division mode, mitotic somaltranslocation (MST), in which the soma rapidly translocates toward the cortical plate immediately priorto cytokinesis. oRG cells are derived from ventricular radial glia (vRG), the primary neural stem cells present in all mammals. oRG cells reside primarily within the outer subventricular zone (oSVZ), closer to the cortical plate than vRG cells, and lack the apical ventricular contact characteristic of vRG cell (Ostrem et al (2014), 8(3):656-664). Without wishing to be bound by any theory, it is expected by the inventors that the cell generated by the herein disclosed method according to the first aspect of the invention can be further differentiated (via further intermediate forms / differentiation stages) into oRG cells. In other words, oRG cells are thought to derive and thus to be obtainable (e.g., by further re- culturing) from the cells obtained as a product of the method according to the first aspect of the present invention.In an tenth aspect, the invention relates to a PRTG-binding agent for use in an in vivo method ofdiagnosing a disease in a subject, wherein said disease is a disease that is causatively linked with an aberrant expression of early cortical neural stem cells (NSCs), the method comprising: (i) administering to said subject a PRTG-binding agent, (ii) detecting and / or quantifying PRTG-positive cells by means of detecting the bound PRTG-binding agent;(iii) wherein the subject is diagnosed as being positive for the disease if the level of detected PRTG is,with increasing preference, at least 10%, at least 20%, at least 30%, at least 50%, at least 70%, at least 90% higher or lower as compared to the level detected in a healthy reference subject or mean level detected in a group of healthy references subjects, wherein preferably said disease is said disease is selected from: - a disease of the CNS, preferably a neurodegenerative disease of the CNS, more preferably selected from Alzheimer's disease, Parkinson's disease (PD) and multiple sclerosis (MS); - a neuroinflammatory disease; - a neurodevelopmental disease, preferably a zikka- or mutated gene-induced microcephaly; - an acute brain disease (e.g., stroke) or brain injury, preferably a stroke occurring during a perinatal stage (i.e., in a prenatal embryo, preferably at a time point on or after week 20 of gestation) or an early post-birth stage (preferably until week 4 after birth); - a brain disease characterized by a shortage of cortical cells, malignant cortical cells (e.g., a brain disease characterized by a malignant conversion of cortical cells to a stem-cell like state, such as cancer stem cells) and / or a defective cortical cell formation; and / or - glioma, medulloblastoma, neuroblastoma and / or glioblastoma multiforme (GBM). In an eleventh aspect, the present invention relates to the use of a compound (or a gene expression of a certain group of genes) capable of (i) maintaining early cortical neural stem cells (NSCs) in a symmetrically dividing state; and / or (ii) inhibiting asymmetric division of early cortical neural stem cells(NSCs), to expand early cortical neural stem cells (NSCs).* * * * *The invention is herein described, by way of example only, with reference to the accompanying drawingsfor purposes of illustrative discussion of the preferred embodiments of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the patent specification including definitions, will prevail. Regarding the embodiments characterized in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.Similarly, and also in those cases where independent and / or dependent claims do not recite alternatives,it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1, a dependent claim 2 referring back to claim 1, and a dependent claim 3 referring back to both claims 2 and 1, it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1. In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1, of claims 4, 2 and 1, of claims 4, 3 and 1, as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed. The Figures show:Figure 1: Schematic overview of the neural induction protocol. Differentiation of hiPSCs starts withthe generation of EBs by short aggregation (day 1). On day 2 we start neural induction by adding the small molecule inhibitors (SBNX) and it continues until day 9. From that day media is supplemented with additional factors to promote proliferation and survival of neural stem cells and derivates. Bright-field images of some key time points of neural induction. Scale bar= 100 µm. Figure 2: scRNA-seq analysis of day 12 hiPSC-derived neural progenitors. A heatmap representing day 12 clusters showing expression values for genes marking cell state as well as different brain regions (Neocortex, Medial pallium, Posterior). Note that there is a prevalence of forebrain NCSs which account for most part of the cell population: 96.15% (7,115 cells) forebrain, 3.14% (232 cells) mid / hindbrain, 0.53% (39 cells) neurons, and 0.19% (14 cells) PSCs. Bar plots above display the total number of cells within each cluster. The color scheme is based on the Z scores, with upregulation in red, downregulationin blue, and undetermined directionality in white.Figure 3: scRNA-seq analysis of day 35 hiPSC-derived neural progenitors. A heatmap representing day 35 clusters showing expression values for genes marking cell state such as pluripotent or neural stem cells as well as different brain regions (Neocortex, Medial pallium, Diencephalon and Mid / Hindbrain) and non-neural lineages. Bar plots above display the total number of cells within each cluster. The color scheme is based on the Z scores, with upregulation in red, downregulation in blue, and undetermined directionality in white. Figure 4: scRNA-seq analysis of day 50 hiPSC-derived neural progenitors. A heatmap representing day 50 clusters showing expression values for genes marking cell state such as pluripotent or neural stem cells as well as different brain regions (Neocortex, Medial pallium, Diencephalon and Mid / Hindbrain) and non-neural lineages. Bar plots above display the total number of cells within each cluster. The color scheme is based on the Z scores, with upregulation in red, downregulation in blue, and undetermined directionality in white. Figure 5: scRNA-seq merged data depicting main clusters and cell compositions of the different time point. A) Uniform Manifold Approximation and Projection (UMAP) plot of the merged scRNA-seqdatasets showing the clustering of the different days highlighted in different colors. B) UMAP plot of themerged scRNA-seq data with the distinct clusters based on cell types highlighted in different colors (right) and stacked plot of cell composition depicting the percentage of cell types within the different days (left). C) UMAP plots depicting expression of selected marker genes which were used to annotate the scRNA-seq clusters for cells states and brain regions. Figure 6: Stage-specific gene signature neural stem cells and derivates. Heatmap representing expression values for the top high variable genes categorized across clusters of various differentiation days. Note the specific transcriptional signatures from where we can extract potential markers genes. Here we used a different cluster than previously shown and grouped together cell states without showing regional identity to create an overview of the temporal-specific signatures of NSCs. Color-coded scale represents relative expression levels of each gene (row) across clusters and it is based on the Z scores, with upregulation in red, downregulation in blue, and undetermined directionality in white.Figure 7: Selected potential candidates for early cortical NSCs. A) scRNA-seq dot plot depictingthe expression profiles of the surface marker candidates. Each dot represents multiple features for each marker gene in each cell population. The size of each dot represents the percentage of cells expressing a given marker and the color represents the average scaled expression of a given marker. B) UMAP plots depicting expression of selected candidate surface markers on the merged scRNA-seq data.Figure 8: Expression of candidate surface markers through 2D differentiation. Undifferentiated(hiPSCs), ZIP13K2, were negative for most markers except for CEMIP2 and SDC1. After 12 days, all markers show low-to-high expression levels which remain in later days in the case of LGR5, CEMIP2 and SDC1, while MCAM and PRTG show a specific enrichment on day 12. Although IGDCC3 also follows the same pattern of unique early expression, its staining pattern follows a punctate type insteadof a membrane type, rendering this marker unsuitable for FACS. Scale bar= 100 µm.Figure 9: Expression of PRTG and MCAM throughout 3D differentiation. Immunostaining of PRTGand MCAM in cerebral organoids (vesicles areas were selected) show enrichment of surface markersin early days of neural induction. Scale bar= 50 µm. Figure 10: PRTG and MCAM expression during human corticogenesis. Cross reference with in vivo data shows enrichment of both marker genes in the early stages of human cortical development (Bhaduri et al., 2020). PRTG and MCAM expression along human cortical neurogenesis. Relative expression levels (A) and percentage of expressing cells (B) across primary clusters of scRNA-seq data of dissociated cells from cortical samples collected at 6–22 gestational weeks. Both PRTG and MCAM are highly enriched in early RG cells being co-expressed with other known early markers such as LIN28A and DLK1. Note that MCAM has a wider expression than PRTG being expressed also in late RG cells. Figure 11: Surface markers expression profiles of neural cell types. Representative FACS analysis of PRTG and MCAM expression in hiPSCs-derived neural stem cells at various stages of differentiation.Samples incubated with the secondary antibody were used as negative controls to set the appropriatenegative gates (<1%) (top). Scatter plots showing coimmunostaining of both cell surface markers and the frequency of each cell population (bottom). Figure 12: FACS analysis average cell frequencies of coimmunostaining of PRTG and MCAM. Since there is certain degree of variability with working with hiPSCs and their neural induction here we show a stacked bar plot showing percentage frequencies of each subpopulation across the various neural differentiation days (n= 3 per time point).Figure 13: Gating strategy followed to sort and collect samples for RNA-seq. FACS density plotsshowing PRTG and MCAM single or combined expression based on SSC-area versus secondary antibody staining (top) or surface marker staining (bottom). Control gates as indicated were set against the corresponding negative controls based on secondary antibody staining background (<1%). The frequency of cells within each selected gate is shown (percentage). Note that for sorting we collected only the high positive PRTG, MCAM, or double stained, and not the all the positive population.Figure 14: Correlation matrix of RNA-Seq datasets obtained from sorted cells. Pearson’scorrelation plot across log10 FPKM of top 2000 highly variable genes visualizing the correlation values between samples providing an overview of all the variation between samples. A hierarchical clustering with Euclidean distance metric used to generate dendrogram. Scale bar represents the range of thecorrelation coefficients displayed from 0 to 1 (color-coded).Figure 15: RNA-seq analysis identifies specific gene expression profiles based on PRTG sorting. Heatmap representing expression of marker genes for pluripotent, neural stem cells, and differentiated cells, as well as different brain regions (Subpallium, Neocortex, Medial pallium, Diencephalon andMid / Hindbrain). Color-coded scale represents relative expression levels of each gene (row) acrossclusters. Note the increased cortical cell identity in day 12 PRTG sorted cells. Surprisingly, at day 35 PRTG detection demarcates non-cortical stem cells, including diencephalic and mid / hindbrain NSCs, instead of cortical lineages. Figure 16: PRTG expression is enriched in rosettes co-expressing PAX6 and FOXG1 on day 12. Same neural induced culture on day 12 showing the expression of PRTG together with cortical markers PAX6 (A, B) or FOXG1 (C, D) in areas containing rosettes (B, D) and non-rosettes (A, C). Scale bar= 100 µm. The right images represent magnified rosette structures from (B) and (D) images (dashed square). Scale bar= 10 µm. Figure 17: PRTG sorting strategy and phenotype of replated cells at day 12 of neural induction. A) FACS density plots showing PRTG expression on day 12 based on SSC-area versus secondary antibody staining (top) or PRTG staining (bottom). Control gates as indicated were set against the corresponding negative controls based on secondary antibody staining background (<1%). The frequency of cells sorted and collected for downstream analysis within each selected gate is shown(percentage). B) Bright-field images of the replated cultures a few hours after sorting. Note the inabilityof most PRTG negative cells to attach to the culture plate, indicating a high cell death rate of this subpopulation. Scale bar= 200 µm.Figure 18: PRTG sorting enriches for NSCs populations at expenses of neurons. A)Immunostaining images of PRTG and PAX6 / DCX on day 18 monolayer neural progenitors derived from PRTG sorted populations at day 12. Scale bar= 50 µm. B) Mean PRTG fluorescence intensity used as a proxy for PRTG expression. C) Quantification of rosette structures per replated population. D) Cell counts of markers in relation to DAPI positive cells. Box and whisker depicting mean and SD, respectively; n=2.Figure 19: PRTG sorting enriches for cortical NSCs. A) Immunostaining images of PRTG and corticalmarker EMX1 in day 18 monolayer neural progenitors derived from PRTG sorted populations at day 12. Scale bar= 50 µm. B) Cell counts of EMX1 positive cells in relation to DAPI positive cells. C) Quantification of rosette structures. D) Mean PRTG fluorescence intensity used as a proxy for PRTG expression. E) Mean EMX1 fluorescence intensity used as a proxy for EMX1 expression in relation with PRTG positive and negative areas found in the PRTG positive sample. Note that areas that have higher PRTG intensity on day 18 have lower levels of EMX1 expression. Box and whisker depicting mean and SD, respectively; n=3.Figure 20: PRTG positive cells retain a higher neurogenic potential. A) Immunostaining images ofPRTG and FOXG1 / DCX in PRTG sorted populations induced towards neuronal differentiation. Note the comparable levels of FOXG1 irrespective of the PRTG sorting but higher DCX expression indicating a higher neurogenic potential of the PRTG positive subpopulation. Scale bar= 100 µm. B) Bright-field images showing clear morphological differences between both cultures. Scale bar= 200 µm. C) Cellcounts of markers in relation to DAPI positive cells. Box and whisker depicting mean and SD,respectively; n=2. Figure 21: Re-sorting of replated cells at day 35 confirms prospective isolation and enrichment of cortical lineages by means of PRTG sorting at day 12. A) Bright-field images of unsorted and PRTG positive cells (pre-sorted at day 12) before collecting for sorting at day 35. Scale bar= 200 µm. B) FACS density plots showing the PRTG expression pattern of the two cultures on day 35, based on SSC-area versus secondary antibody staining (top) or PRTG staining (bottom). The frequency of cells within the positive gates is shown (percentage). Note that for downstream RT-qPCR analysis we sorted and collected 15% of the negative population and 100% of the positive populations. C) Evaluation of expression levels of the re-sorted population compared to the unsorted cells on day 35 by means of RT- qPCR. Figure 22: PRTG expression analysis in early days of neural induction. Representative FACS analysis of PRTG expression in hiPSCs-derived neural stem cells at early stages of differentiation. Samples incubated with the secondary antibody were used as negative controls to set the appropriate negative gates (<1%) (top). Scatter plots showing coimmunostaining of both cell surface markers andthe frequency of each cell population (bottom).Figure 23: PRTG sorting strategy and phenotype of replated cells at day 5 of neural induction. A)FACS density plots showing PRTG expression on day 5 based on SSC-area versus secondary antibody staining (top) or PRTG staining (bottom). Control gates as indicated were set against the corresponding negative controls based on secondary antibody staining background (<1%). The frequency of cells sorted and collected for downstream analysis within each selected gate is shown (percentage). B) Bright-field images of the replated cultures, together with the unsorted control, a few hours after sorting. Note a high cell death rate of the PRTG negative subpopulation similar to what we see on day 12. Scale bar= 200 µm. Figure 24: Sorting for PRTG at day 5 enriches for anterior neural identity. A) Immunostaining images of sorted populations at day 5 for OTX2 and GBX2. Scale bar= 50 µm. B) Cell counts and co- localization analysis of markers are presented as a bar plot panel (n=1). Figure 25: Sorting for PRTG at day 5 enriches for anterior forebrain. A) Immunostaining images of sorted populations at day 5 for PAX6 and TFAP2A. Scale bar= 50 µm. B) Cell counts and co-localization analysis of markers are presented as a bar plot panel (n=1).Figure 26: PRTG sorting at day 5 enriches for rosette forming cells. Bright-field images of the day5 sorted replated cultures grown until day 10. At the bottom magnification of the top culture to betterappreciate the distinct cell morphology of PRTG positive sorted population compared to the unsorted control. Note that neural rosette structures are less frequently observed in the unsorted population compared to the PRTG positive sorted subpopulation. Scale bar= 100 µm.Figure 27: PRTG sorting at day 5 enriches for cortical identity. A) Immunostaining images of PRTGand PAX6 / FOXG1 on day 10 monolayer neural progenitors derived from PRTG sorted populations at day 5. Note the higher presence of rosette structures (examples marked by dashed circles) in the PRTG positive subpopulation compared to the unsorted. Scale bar= 100 µm. B) Quantification of rosette structures per replated population. C) Cell counts of markers in relation to DAPI positive cells. Box and whisker depicting mean and SD, respectively; n=2. Figure 28: Sorting strategy at day 5 for scRNA-seq analysis. A) FACS density plots showing the gating strategy used to collect the three subpopulations for scRNA-seq based on SSC-area versus secondary antibody staining (top) or PRTG staining (bottom). Control gates as indicated were set against the corresponding negative controls based on secondary antibody staining background (<1%). The frequency of cells sorted and collected for downstream analysis within each selected gate is shown (percentage). B) Bright-field images of the replated cultures a few hours after sorting. Scale bar= 100 µm. Figure 29: PRTG demarcates early specification of anterior neural identity. A) UMAP plot of the merged day 5 scRNA-seq datasets showing the clustering of the different subpopulations based onPRTG sorting. B) UMAP plot of the merged day 5 scRNA-seq data with the distinct clusters based oncell types highlighted in different colors (up) and stacked plot of cell composition depicting the percentage of cell types within the different subpopulations (left). C) UMAP plots depicting expression of selected marker genes which were used to annotate the scRNA-seq clusters. Figure 30: Differential gene expression analysis of day 5 PRTG sorted subpopulations. A)Volcano plot depicting the differential gene expression analysis comparing all NSCs found in the positivesubpopulation versus the middle population. B) Volcano plot depicting the differential gene expressionanalysis comparing all NSCs found in the positive subpopulation versus the negative population. C)Volcano plot depicting the differential gene expression analysis comparing all NSCs found in the middlesubpopulation versus the negative population. The log2-transformed fold-changes andadjusted P values from a t-test with overestimation of variance after Benjamini–Hochberg correction (-log10(Q-value)) are plotted on the x- and y-axis, respectively. Total number of significantly differentiallyexpressed genes are shown. Upregulated genes of interest are shown in red and the downregulatedones in blue. D) UMAP plots depicting expression of selected differentially expressed genes of interest. Figure 31: PRTG prospectively isolates distinct telencephalic subpopulations. A) UMAP plot of the merged day 10 scRNA-seq datasets showing the clustering of the different subpopulations based on PRTG sorting. B) UMAP plot of the merged day 10 scRNA-seq data with the distinct clusters based on cell types highlighted in different colors (up) and stacked plot of cell composition depicting thepercentage of cell types within the different subpopulations (left). C) UMAP plots depicting expressionof selected marker genes which were used to annotate the scRNA-seq clusters. Figure 32: Differential gene expression analysis of day 10 prospectively sorted subpopulations.A) Volcano plot depicting the differential gene expression analysis comparing all telencephalic NSCsfound in the positive subpopulation versus the middle population. B) Volcano plot depicting thedifferential gene expression analysis comparing all telencephalic NSCs found in the positivesubpopulation versus the negative population. C) Volcano plot depicting the differential gene expression analysis comparing all telencephalic NSCs found in the middle subpopulation versus the negativepopulation. The log2-transformed fold-changes and adjusted P values from a t-test with overestimationof variance after Benjamini–Hochberg correction (-log10(Q-value)) are plotted on the x- and y-axis,respectively. Total number of significantly differentially expressed genes are shown. Upregulated genesof interest are shown in red and the downregulated ones in blue. D) UMAP plots depicting expression of selected differentially expressed genes of interest.Figure 33. Experimental workflow of a screening strategy using PRTG as a readout. The mainapproach would be to transduce the early-stage cortical NSCs with a TF library and check the maintenance of PRTG positive cells along the progression of differentiation (until day 35 or day 50). This would indicate the maintenance of early NSCs on later stages of differentiation which would be sorted and analysed by bulk RNA and scRNA sequencing. By doing this, the hope would be to identify the TFs responsible for the reprogramming of the cells and simultaneously validate their early cortical NSC identity. The examples illustrate the invention: Example 1: 1. INTRODUCTION The formation of the vertebrate nervous system Neurulation -the process by which the early nervous system is established- starts directly after gastrulation once the three germ layers have been formed: the ectoderm, the endoderm, and the mesoderm. At the dorsal midline of the embryo, the ectodermal germ layer specializes into a thickened pseudostratified epithelium – the neural plate – instructed by the anterior endoderm and the notochord. The neural plate starts bending and neural folds form bilaterally creating the neural groove. Finally, epithelial fusion of the tips of the neural folds culminates in the closure and formation of the neural tube. Upon closure, the neural tube undergoes a series of expansions and constrictions to form the primary brain vesicles: the Prosencephalon (Forebrain), the Mesencephalon (Midbrain), and the Rhombencephalon (Hindbrain). These three primary brain vesicles further develop generating the five secondary brain vesicles: the Telencephalon and the Diencephalon (derived from the Prosencephalon); the Mesencephalon; and the Metencephalon and Myelencephalon (derived from the Rhombencephalon), which will give rise to the different structures of the adult central nervous system (CNS). Early neural induction: How is the CNS specified? First insights into embryonic neural induction: What makes the ectoderm decide to acquire a neural fate? Two models were developed in the mid 90´s to explain the early patterning and specification of the CNS which begins at neural induction. The first insight into how the neural plate is established came from the famous experiments of Mangold and Spemann which lead the discovery of the so-called Spemann- Mangold organizer. In 1924, Mangold and Spemann postulated a first model based on their intra-species transplantation experiments involving developing amphibian embryos. These were based on dissecting and transplanting the dorsal portion of the developing embryo that was thought to serve as an ‘organizing center’ into the ventral portion of another embryo. This resulted in the formation of a second set of dorsal axial structures on the ventral side of the host embryo, including a well-organized secondary neural plate. Such seminal finding introduced the concept of an organizer center as a specific population of cells capable of inducing and assembling the various tissues in the embryo along the three body axes: 1) the anterior (rostro)–posterior (caudal) (AP) axis; 2) the dorso–ventral (DV) axis; and 3) the left–right (LR) axis. At the time, the neural inducing factors generated by the Spemann-Mangold organizer responsible for inducing neural tissues were unknown. Eventually a key player named Noggin was identified as the protein which was secreted by the organizer and had the dorsalizing effect (Harland and Smith, 1992). Nevertheless, it was not until 1995 that the final piece of the puzzle was discovered. Wilson and Hemmati-Brivanlou showed that the bone morphogenetic protein 4 (BMP4) is secreted fromthe ventral side of the embryo, opposite to the organizer, and diffuses throughout the embryo inducingectodermal tissues. BMP4 activity is inhibited by Noggin thus inducing ectodermal cells in the area of the organizer to develop into neural fate instead of becoming skin cells (Wilson and Hemmati-Brivanlou, 1995). However, a few years later, a novel model challenging this view was postulated by Peter Nieuwkoop. He observed that ectoderm can differentiate into anterior neural structures (forebrain) in the absence of any external factors, while posterior fates need to be actively induced by caudalization factors. He concluded that the formation of the CNS is inherent and the default differentiation path (Nieuwkoop, P.D., 1992). Even though a large body of growing evidence collected from the last seventy years favors Nieuwkoop’s ‘default’ model, the postulation remains controversial. Currently, the most accepted and prevalent model is that in early development the dorsalizing Nieuwkoop signal (at that time unknown and later attributed to WNT signaling) produced in the dorsal cells of the embryo is required for establishing the Spemann–Mangold organizer. Similar structures to the Spemann–Mangold organizer have been identified in other vertebrates- namely the Hensen’s node in chick (Waddington, 1993) and in rabbit (Viebahn, C., 2001), the embryonic shield in zebrafish (Shih and Fraser, 1996) and the primitive node in most amniote embryo, discovered first in mouse (Camus and Tam, 1999)- proving that the organizer structure and its role is evolutionarily conserved. Modern insights: What are the major signaling pathways involved in embryonic neuralinduction?We have come a long way since the first description of the model and findings in the last years have emphasized the complexity of the process. After the discovery of Noggin as the first direct neural inducer, two other organizer-specific proteins, Chordin (Sasai Y et al, 1994) and Follistatin (Hemmatibrivanlou A et al, 1994), were identified as neural inducing. The further identification of thesetwo proteins provided more insight into the molecular mechanisms underlaying neural patterning. Thesethree proteins have in common that they are all antagonists of different branches of the Transforming Growth factor beta (TGFB) signaling pathway, binding with high affinity to the ligands and thus inhibiting the activation of the receptors. While the notion that BMP antagonists are the ones inducing neural patterning remains valid, more recent evidence suggests functional roles of Fibroblast Growth Factor (FGF) and Wingless / Integrated (WNT) signaling pathways. On one hand, FGF signaling was also identified as a main player inhibiting the TGFB / BMP signaling pathway in the early embryo (Streit et al, 2000), thus potentially having a synergistic effect with the organizer-secreted BMP antagonists. FGF signaling reduces directly the activity of BMP signaling by promoting phosphorylation of the linker domain and degradation of SMAD1 (Pera EM et al, 2003), and indirectly by inducing the transcription factor ZEB2, which in turn binds to and represses the transcriptional activity of SMADS (Sheng G et al, 2003). On the other hand, the canonical WNT pathway involvement in neural induction remains controversial. While in amphibian eggs WNT signaling has been shown to activate neural fates (Baker et al, 1999), in chick embryos it seems that WNT inhibition cooperates with FGF signaling in inducing early neuralpatterning (Wilson et al, 2001). Such disagreement can be explained to a certain extent whenaddressing the temporal component of such regulation. It appears that at very early stages WNT signaling is required to specify the dorsal fate and to promote the formation of the Spemann–Mangold organizer, becoming the main candidate for being the dorsalizing Nieuwkoop signal (Vonica and Gumbiner, 2007). However, at later stages WNT signaling seems to induce epidermis at expenses of neural fate by regulating the response of ectodermal cells to FGF signaling (Wilson et al, 2001). In summary, intricate spatiotemporal modulation and interplay of WNT, TGFB / BMP and FGF signaling pathways is required for early neural induction and patterning of the AP identity. Additionally, SHH plays a key role in stablishing the DV axis. In early development, SHH is secreted from the ventral regions of the neural tube- the notochord and floor plate- generating a signaling gradient that is essential for proper DV patterning of the CNS, specifically the development of the ventral forebrain, midbrain and hindbrain (Ruiz i Altaba et al, 2002). Vertebrate telencephalic development Once the neural plate is established, early in its development the most anterior primordial sheet of cells give rise to the prosencephalon, which is subsequently subdivided into the telencephalon and the diencephalon, as above mentioned. The telencephalon arises from the most anterior rostral end of the prosencephalon and it is further subdivided into two distinct regions across the DV axis: the pallium, the dorsal region that will primarilybecome the cerebral cortex; and the subpallium, the ventral region that, in turn, will primarily becomethe basal ganglia. In mammals, the pallium is further comprised by four major domains that form cortical structures: dorsal, medial, lateral and ventral pallium. The dorsal pallium will give rise to the neocortex (isocortex), while the medial pallium develops into the cortical hem that will give rise to the hippocampus (archicortex). In turn, the lateral pallium develops into the olfactory and some limbic areas (paleocortex),while the ventral pallium also gives rise olfactory areas (Medina et al, 2009). Telencephalic patterning: progressive molecular and cellular specification Early patterning of the developing telencephalon is orchestrated by an intricate interplay ofmorphogenetic gradients of growth factors working in concert with multiple components, including cell–cell interactions, to regulate regional identities. Mainly, SHH is produced ventrally, FGF8 is producedrostrally (most prominently in the cortex) and several BMP and WNT proteins are mainly producedcaudo-medially (Charron et al., 2005). These signaling molecules activate a spatially specific signalingcode that activates a pattern of transcription factors (TFs) that control many aspects of the subsequentdevelopment. In turn, these TFs can also modulate the secretion of morphogens creating regulatory loops to instruct lineage commitment, thus establishing specific telencephalic cell types from a common primordium (Lee et al., 2014). Patterning along the AP axisFOXG1 (also known as BF1) (Tao et al., 1992), PAX6 (Haubst et al., 2004; Holm et al.,2007) and GLI3(Wang et al., 2014; Aoto et al., 2022) are among the earliest TFs identified to be expressed in the neuralplate cells destined to become telencephalon.The telencephalic primordium is first characterized by the expression of FOXG1. At this stage the telencephalon is still a single-layered neuroepithelium, and subsequent to FOXG1 expression it becomes further subdivided into its several distinct regions (Hettige and Ernst, 2019). It has been shown that FOXG1 acts in concert with FGF signaling and that it is required for FGF8 expression. Conversely, studies also suggest that FGF8 induces and maintains FOXG1 expression in the anterior neural plate (Shimamura and Rubenstein, 1997). Moreover, FOXG1 then restricts expression of BMP4 to thetelencephalic midline (Ohkuboa et al., 2002). FOXG1 has also been shown to exert control overtelencephalic progenitors to induce proliferation by cell autonomous mechanisms that include the regulation of PAX6 (Manuel et al., 2011). Null mutation of FOXG1 have been reported to cause hypoplasia of the mouse telencephalon and loss of ventral telencephalic structures (Martynoga et al.,2005) Additionally, lack of PAX6 in mice leads to the caudalization of the cortex through loss of anteriorregions. And it has also been described that loss of both PAX6 and EMX2 in mice (another specific telencephalic dorsal marker) results in a drastic reduction of cortical structures in favor of subpallium structures (Muzio et al., 2002).Further anteriorization of the telencephalic neuroepithelium is characterized by the expression of SIX3and OTX2 (Acampora et al., 1999). On one hand, SIX3 shows a defined spatiotemporal expression pattern in the developing telencephalon, and together with PAX6 has a role in mediating the early regional subdivision of the prospective prosencephalon into the telencephalon and diencephalon(Appolloni et al., 2007; Ypsilanti et al., 2016). On the other hand, OTX2 together with GBX2 are amongthe earliest genes expressed in the neuroectoderm, and have been suggested to determine the midbrain-hindbrain boundary in vertebrates, dividing the anterior versus posterior domains (Crossley et al., 2001). OTX2 plays essential roles in rostral brain development being required for the development of the forebrain and midbrain, and is counteracted by the effects of GBX2 which is necessary for anteriorhindbrain development. Otx2-null mice lack forebrain and midbrain regions due to a defective anteriorneuroectoderm specification during gastrulation (Acampora et al., 1995). Conversely, mice lacking Gbx2 show developmental failure of the hindbrain development and display a caudal expansion of themidbrain (Inoue et al., 2012).Patterning along the DV axis DV patterning of the telencephalon is established early in forebrain development. The initial subdivision that defines regional identity is regulated by SHH signaling which is essential for ventral patterning and by the dorsalizing effects of GLI3 expression. GLI3 is initially expressed broadly throughout the telencephalic primordium and then is progressively downregulated in the ventral telencephalon (Gunhaga et al., 2003). In Gli3-deficient mice, they found that the development of the dorsal telencephalon is completely disrupted resulting in a compromised neocortex and the failed formation of the choroid plexus, the cortical hem and the hippocampus (Grove et al., 1998). In turn, SHH promotes ventral cell fates in the forebrain by antagonizing the dorsalizing effects of GLI3 (Hebert and Fishell, 2008).Another crucial gene for ventral specification is the TF NKX2-1, which defines and delineates MGE fromLGE progenitors (Butt et al., 2008). Mice lacking NKX2-1 display a ventral to dorsal change of fate withinthe basal telencephalon, with precursor cells generating LGE instead of MGE. In turn, GSX2 (Gsh2 inmouse) accompanies the emergence LGE with a lower expression level in MGE. It has beendemonstrated that GSX2 is a downstream target of SHH and that its function is required to repress pallial fates. Lack of GSX2 in mice results in profound defects in telencephalic development (Corbin etal., 2000). In the absence of GSX2, it has been observed a loss of DV regionalization in mice, shown bythe expansion of MGE (Sussel et al., 1999). In the dorsal telencephalon, PAX6 also plays an essential role in creating the sharp border between the pallium (dorsal) and subpallium (ventral), mainly being expressed in the prospective neocortex. In Pax6- null mouse embryos, there is a disruption of the pallium-subpallium boundary leading to patterning defects that include an expansion of the dorsal LGE at the expense of the ventral pallium. Cells normally restricted to the subpallial side might migrate across the boundary retaining their initial identity, thereby blurring and shifting the border. Dorsal expansion of subpallial markers such as GSX2 coinciding with a downregulation of pallial marker genes can also be observed (Georgala et al., 2011). Concomitantly to these roles, FOXG1 also plays a key role in inducing ventral subpallial identity as a reported downstream effector of SHH. It has been shown that FOXG1 inhibits WNT signaling through direct transcriptional repression of WNT ligands, thus restricting dorsal WNT signaling and delimiting pallial identities (Danesin et al., 2009). The cerebral cortex The cerebral cortex derives from the dorsal pallium of the telencephalon. The cerebral cortex is the outer-most layer of grey matter that completely covers the surface of the two cerebral hemispheres. It is the brain region responsible for many of the high-level cognitive functions in humans, includinglanguage, perception, reasoning, decision making and consciousness (Adesnik et al., 2018). Composition of the cortical layers Already in 1878, Bevan Lewis suggested a stratification plan for the cerebral cortex which remains accepted. Based on this structural plan, the cerebral cortex has been divided into: the isocortex and the allocortex. The isocortex or neocortex corresponds to the six stratified layers, while the allocortex, represented by the archicortex (hippocampus) and paleocortex (olfactory cortex), exhibit a laminar structure composed of 3 layers (Triarhou, L.C., 2021). It was at the beginning of the 20thcentury that many studies were undertaken to exclusively analyze the cytoarchitecture of the cortical areas, being Ramón y Cajal the one who described the intrinsic organization of the cerebral cortex in human and vertebrates. The six layers of neocortex are: layer I or plexiform layer -also known as molecular layer or marginal zone (MZ)- containing mainly nerve axons and a few scattered Cajal-Retzius cells; layer II or external granular layer composed of a varying density stellate (granular) cells and pyramidal cells; layer III or external pyramidal layer containing predominantly pyramidal cells of varying sizes; layer IV or internal granular layer consisting mostly of the stellate cells and a smaller portion of the pyramidal cells; layer Vor internal pyramidal layer containing mainly medium-sized to large pyramidal cells; and layer VI orfusiform / multiform layer composed by different types of neuron types, mostly fusiform cells with less dominant pyramidal cells and interneurons. The deep layers (layer V / VI) are the first ones to be generated and to achieve their stratification and functional maturation of their neurons. Neuronal maturation proceeds successively from the deeper layers to the upper layers (layers II / III / IV), from the oldest generated neurons to most superficial and recently born neurons. Neurons mature into two main subtypes: pyramidal or non-pyramidal neurons. Neurons that retain their original contact with layer I become pyramidal neurons (which represent 70% the of cortical neurons), while neurons that lose that contact become stellate cells, non-pyramidal neurons or interneurons (Cadwell et al, 2019). How can we study cortical development? Stem cell models of cortical development: derivation of neural rosettes Animal models have been the prevailing approach for studying developmental biology due to the high conservation of processes and the accessibility and manipulation ability. Nevertheless, it is well known that discrepancies in the nervous system development between species exist. For example, when comparing mouse and human development some differences can be identified (Copp et al, 2013), especially in regards of the cortical development and the diversity of neuronal cell types residing in the cortex (Cheung et al, 2007; Loomba et al, 2022). At the same time, efforts are also being made in orderto reduce and eventually abolish animal experimentation. Such need promoted the extraordinarydevelopment of stem cell-based techniques aimed at inducing and culturing neural lineages toreproduce human brain development in vitro. Current methods for human neural differentiation protocolsrange from more homogenous two-dimensional (2D) systems to more complex three-dimensional (3D) systems, each one tailored to specific needs. However, all these protocols follow the same approach inapplying the mechanisms revealed by classical embryological studies, and induce neural differentiationby means of multiple cytokines and growth factors. In 2001, the first derivation of human neural rosettes from ESCs was done by generating embryoid bodies (EBs) – 3D aggregates of cells- that could be directed to differentiate into neural lineages. This resulted in a cluster of NE cells that self-organize to form the so-called neural rosettes (Zhang et al., 2001). Rosettes structures are characterized by their unique cytoarchitecture where cells are radially organized and apically constrained. Thus, forming an apical lumen resembling the VZ seen during embryonic development of the neural tube. Compared to other 2D systems the generation of neuralrosettes better recapitulate the in vivo properties of cortical RG cells, as they generate intermediatepopulations and even a rough layering of progenitor zones similar to the in vivo counterparts, VZ andSVZ (Shi et al., 2012, Edri et al., 2015). Given that the formation of neural rosettes is a critical morphogenic event that reflects the induction of cortical lineages during development it is widely used areadout for proper generation of hiPSC-derived cortical RG cells in vitro.Furthermore, it was later shown that these neural rosette structures corresponding to early anterior NSCs can be induced by using the BMP antagonist Noggin. More importantly, they can be propagatedand expanded in culture under specific conditions thus allowing functional characterization of the NSCsand their progeny (Elkabetz et al., 2008). Additional to EB formation capacity, it was shown that PSCs in adherent monocultures are able to commit efficiently to a neural fate in the absence of serum or growth factors due to autocrine signaling (Ying et al., 2003). In 2005, pioneering work from Sasai’s group demonstrated that combining EBs culture and serum-free conditions (SFEB), with the addition of Nodal and WNT pathway antagonists, could generate broad telencephalic neural precursors from PSCs when plated on coated dishes (Wantanable et al, 2005). Later, this method was significantly improved by adding TGFB inhibition to BMP inhibition in feeder-free cultures of hPSCs which rapidly differentiated them into early neurectoderm- becoming the commonly used dual SMAD inhibition (Dual SMAD-i) protocol (Chambers et al., 2009). A plethora of studies aimed to the optimization of neural induction protocols followed this seminal work by trying different combinations of TFGB, BMP, WNT pathway inhibition, with or without further FGF and SHH pathway modulations (Gaspard et al., 2008, Maroof et al., 2013). Other studies combined WNT, FGF and NOTCH inhibition to induce rapid production of early cortical neurons (Qi et al., 2017). Altogether, different strategies were developed to optimize the generation of specific telencephalic precursors in order to generate specific cortical cell types of interest. More recently and concomitant with the latter 2D differentiation protocols, 3D systems for recapitulating corticogenesis were developed giving rise to the cerebral organoid models (Eiraku et al., 2008,Lancaster et al., 2014). Nevertheless, methods for generating cortical organoids are also highly variablewhich results in differential neural patterning trajectories and high heterogeneity. This lack of standardization in the field emphasizes the need to keep on optimizing differentiation protocols to achieve a starting pure population of NCSs (‘the founder’ NSC population) that would give rise to a more homogenous cortical population. To overcome such hindrance our lab has established a method to derive homogenous early cortical progenitors from PSCs. In the past years, our lab established a streamlined method known as Triple-i paradigm- combination of TFGB, BMP, WNT pathway inhibition- to derive homogenous starting cortical progenitors both in neural rosettes and cerebral organoids platforms (Rosebrock et al., 2022).Derivation and characterization of human cortical NSCs in vitroAlready in 2015, our lab was able to derive and dissect the human cortical differentiation process invitro, going from neuroepithelial cells towards distinct RG cell types, recapitulating in vivo development(Edri et al., 2015). This was achieved by prospectively isolating consecutively appearing PSC-derivedprogenitors based on their NOTCH activation state by using a reporter cell line tagging a downstream effector of the NOTCH signaling pathway (HES5::eGFP line). The stepwise isolation allowed for the dissection of the dynamic changes that lead to heterogeneity in cortical NSCs during long-term culture. Five distinct progenitor states were defined based on their cell morphology and NOTCH activation state: neuroepithelial (NE), early radial glial (E-RG), mid radial glial (M-RG), late radial glial (L-RG) cells, andlong-term cultured progenitors (LNP). Beyond being able to derive the in vivo counterparts of the diversecortical NSCs, this study provides evidence of the broad heterogeneity found in these progenitorpopulations highlighting variable proliferation capacity and differentiation potential. The NE stage corresponds to the first NSC population which begin diving symmetrically to expand the pool of progenitors and, consequently, become the E-RG population. E-RG rosettes contain highly proliferative NSCs exhibiting broad differentiation potential, and are able to divide asymmetrically to give rise to IP and deep layer neurons. As differentiation progresses, M-RG rosettes emerge becoming restricted from generating earlier fates, and will give rise to upper layer neurons. Generally, there is a decrease in stemness and an increase tendency to differentiate into neurons. As development progresses in culture, rosettes dismantle losing their characteristic cytoarchitecture, becoming L-RG which switch from neurogenic potential to astrogenic potential. Finally, the LNP stage is achieved where cells are no longer capable of forming rosette structures, reflecting loss of epithelial integrity due to accumulation of basal progenitors, neurons and cells with astroglial character. This indicates that LNP cells progress beyond RG fates towards adult-like progenitor identity.Global transcriptional analysis and epigenetic characterization of the PSC-derived progenitor statesrevealed stage-specific molecular signatures and coordinated epigenetic changes that seem to be responsible for driving the transition through the distinct NSC competences (Ziller et al., 2015). However, there is still the need to unravel the underlaying regulatory mechanisms driving the transition to betterunderstand how different types of NSCs emerge during cortical development. Furthermore, suchknowledge would allow us to manipulate these NSC stages. For example, it would allow to control theprogression of these NSC populations thus generating an unlimited in vitro culture of the desired NSCtype that could potentially be used for therapeutic approaches. The emergence of induced pluripotent stem cells In 2006, Yamanaka’s group reported for the first time that the introduction of four transcription factors-Oct4, Sox2, c-Myc, and Klf4- were sufficient to reprogram mouse fibroblasts into pluripotent stem cells,termed induced pluripotent stem cells (iPSCs). Only one year later, human iPSCs (hiPSCs) were already being developed by two independent research groups. Yamanaka's group successfully differentiated human fibroblasts into iPSCs through the transduction of the same 4 transcription factors previously used in mice cells (Oct4, Sox2, Klf4 and c-Myc) by means of a retroviral system (Takahashi et al., 2007). While, concomitantly, Thomson’s group used a different set of transcription factors- Oct4, Sox2, Nanog and Lin28- that were transduced by means of a lentiviral system (Yu et al., 2007). Since then, human iPSC technology has hold great promise for regenerative therapies because patient- specific iPSCs can be derived from patient-somatic cells, such as fibroblasts, providing unprecedented human models for studying neurodevelopmental diseases and for personalized therapy. On one hand, this opens the possibility to study disease pathology in different and patient-distinct genetic backgrounds and their response to drugs (Sabitha et al., 2021; Costamagna et al., 2021). On the other hand, combining advancements in cortical differentiation methods with the iPSCs technology to derive cortical neurons from patient-somatic cells could potentially provide a source for isogenic cortical cells that can be used for transplantation, thus avoiding immunogenicity responses. Even though this is not yet a possibility, efforts are being made to promote such avenues for neurodevelopmental disorders that arecaused by cortical abnormalities such as autism spectrum disorder (Nestor et al., 2016).Single-cell RNA sequencing technology: unprecedented insight into human embryonic development Recently, another great scientific advancement has been the development of the Single-cell RNA sequencing (scRNA-seq) technology. scRNA-seq has become the state-of-the-art approach forunfolding the heterogeneity and cellular complexity of human tissues at unprecedented single cellresolution. Since its first discovery in 2009 (Tang et al, 2009), studies based on scRNA-seq are extensively used due to their power of overcoming many drawbacks arising from other sequencing technologies such as bulk RNA-seq. Mainly, the ability to comprehensively identify novel cell types and rare cell subsets avoiding the averaging phenomenon inherent to bulk analysis. We have come a long way since the first studies that covered the analysis of 10 to 100 cells (Kumar et al., 2014; Shalek et al.,2013), and advances have enabled us to profile gene expression in individual cells on a large scale - upto tens of thousands of individual cells (Klein et al., 2015; Macosko et al., 2015)- and it continues togrow. scRNA-seq has become a well-established technique and various methods have been developed with different single cell isolation and library preparation strategies. Currently, droplet-based methods, such as Drop-seq or the more recently developed 10× Genomics platform (reference methods section for more details), are considered the gold standard because they generally yield higher throughput while reducing cost and workload.Since scRNA-seq enables the study of biological properties of individual cells allowing to unravel cellularcomplexity of thousands of cells at once, it seems logical to want to apply such technology to the study the intricate cellular complexity of the human brain. Hence, plenty of studies in the recent years have made use of the single cell technology to study both fetal and adult brain in order to capture and decipher their cellular complexity (Hedlund and Deng, 2018; Feng et al., 2021). Initial studies focused on exploring cell type identities in the developing brain by profiling between 100 to 500 cells, resulting in the identification of diverse neural cell types including RG, newborn and mature neurons, astrocytes and oligodendrocytes, among others (Pollen et al., 2014; Darmanis et al., 2015).More recent scRNA-seq studies are attempting to obtain a more comprehensive cell typing, especiallyin the cerebral cortex which comprises a vast diversity of neuronal cell types (Chang et al., 2020). Additionally, scRNA-seq is also used to profile hiPSC-derived cortical progenitors and cerebral organoids to study the viability of derivation protocols. Also allowing to shed light into the developmental process of neural differentiation and the molecular mechanisms governing cell fate specification by using a more controlled model system (Velasco et al., 2019; Bhaduri et al., 2020). MAIN AIM The motivation behind this project is to better understand the ontogeny of the cortical NSCs that sequentially appear during cortical development. This is of great importance since characterizing thesedistinct NSC populations is key for developing an in vitro system that allows for the homogeneous andunlimited culture of the desired NSC type, which is critical for potential cell replacement therapies. In order to address this question, the main aim of this project is to develop a strategy to isolate the earlycortical NSC population for its characterization and potential manipulation. To achieve this, theexperimental pipeline is focused on identifying a cell surface marker to enable a cell-sorting approachfor the isolation of these cells in vitro.Main objectives - Identification of a candidate surface marker for the isolation of early cortical NSCs - Validation of the candidate surface marker - Molecular and cellular characterization of the sorted populations 2. MATERIALS AND METHODS 2.1 Reagents ^ 2-Mercaptoethanol (GibcoTM, cat. no.: 31350010) ^ Accutase® solution (Sigma-Aldrich®, cat. no.: A6964) ^ Apo-transferin human (Sigma-Aldrich®, cat. no.: T1147) ^ B-27™ serum free (GibcoTM, cat. no.: 17504044) ^ B-27™ Supplement minus vitamin A (GibcoTM, cat. no.: 12587010) ^ Bovine Serum Albumin (Sigma-Aldrich®, cat. no.: A9418) ^ D-(+)-Glucose (Sigma-Aldrich®, cat. no.: G8270) ^ Dimethyl Sulphoxide (DMSO, Sigma-Aldrich®, cat. no.: D2650) ^ DMEM / F-12 (GibcoTM, cat. no.: 11320033) ^ DMEM / F-12 (powder, GibcoTM, cat. no.: 32500035) ^ DMEM / F-12, HEPES (GibcoTM, cat. no.: 31330038) ^ Dimethylsulfoxid, DMSO (Sigma-Aldrich®, cat. no.: D2650) ^ DNAse I (STEMCELL technologies, cat.no.: 07469) ^ DPBS, no calcium, no magnesium (GibcoTM, cat. no.: 14190169) ^ Fetal Bovine Serum, qualified, heat inactivated (FBS, GibcoTM, cat. no.: 16140071) ^ GlutaMAXTMSupplement (GibcoTM, cat. no.: 35050061) ^ Hank's Balanced Salt Solution (HBSS, GibcoTM, cat. no.: 14025092) ^ Insulin from bovine pancreas (Sigma-Aldrich®, cat. no.: I6634) ^ KnockoutTMDMEM (GibcoTM, cat. no.: 10829018) ^ KnockOutTMSerum Replacement (GibcoTM, cat. no.: 10828028) ^ L-Glutamine (GibcoTM, cat. no.: 21051024) ^ Matrigel® Membrane Matrix (Corning®, cat. no.: 354234) ^ MEM Non-Essential Amino Acids (GibcoTM, cat. no.: 11140050) ^ mTeSR1TMBasal Medium (Stem CellTMTechnologies, cat. no.: 85850) ^ NeurobasalTMMedium (GibcoTM, cat. no.: 21103049) ^ Neutral protease (Dispase, Worthington, cat. no.: LS02100) ^ Optimal Cutting Temperature compound, OCT (Tissue-Tek®, cat. no.: 4583) ^ Paraformaldehyde (Sigma-Aldrich®, cat. no.: 158127) ^ Penicillin-Streptomycin (GibcoTM, cat. no.: 15140122) ^ Progesterone (Sigma-Aldrich®, cat. no.: P0130) ^ Putrescine dihydrochloride (Sigma-Aldrich®, cat. no.: P7505) ^ Recombinant Human FGF basic / FGF2 / bFGF (146 aa) Protein (R&D Systems, cat. no.: 233- FB) ^ Recombinant Mouse Noggin Fc Chimera Protein, CF (R&D Systems, cat. no.: 719-NG) ^ SB-431542 (Tocris, cat. no.: 1614) ^ Sodium bicarbonate (Sigma-Aldrich®, cat. no.: S5761) ^ Sodium Selenite (Sigma-Aldrich®, cat. no.: 214485) ^ Sucrose (Sigma-Aldrich®, cat. no.: S0389) ^ TritonTMX-100 (Sigma-Aldrich®, cat. no.: X100) ^ Trypan Blue Solution (GibcoTM, cat. no.: 15250061) ^ UltraPure™ EDTA, pH 8.0 (Invitrogen™, cat. no.: 15575020) ^ XAV 939 (Tocris, cat. no.: 3748) ^ Y-27632 dihydrochloride (ROCK inhibitor, ROCKi, Tocris, cat. no.: 1254) 2.1 Equipment and instruments ^ Portable Pipet-Aid® XP Pipette Controller (Drummond, cat. no.: 4-000-101) ^ Pipettes (P1000, P200, P10, Eppendorf Research Plus 3-Pack Option 2, cat. no.: 3120000917) ^ Serological pipettes (25ml, 10ml, 5ml, Sarstedt, cat. no.: 86.1685.020, 86.1254.025 and 86.1253.025) ^ Sterile filter tips (1000, 200, 20, 10 ul, Biozym, SafeSeal SurPhob®, cat. no.: VT0270, VT0250, VT0220 and VT0200) ^ 500 mL Vacuum Filter / Storage Bottle System, 0.22 µm Pore 33.2cm² PES Membrane, Sterile (Corning®, cat. no.: 431097)^ 250 mL Vacuum Filter / Storage Bottle System, 0.22 µm Pore 19.6cm² CN Membrane, Sterile (Corning®, cat. no.: 430756) ^ Screw cap tube, 50 ml, (LxØ): 114 x 28 mm, PP, with print (Sarstedt, cat. no.: 62.547.254) ^ Screw cap tube, 15 ml, (LxØ): 120 x 17 mm, PP, with print (Sarstedt, cat. no.: 62.554.502)^ 60 mm TC-treated Culture Dish (Corning®, cat. no.: 430166) ^ 96-well Clear Round Bottom Ultra-Low Attachment Microplate, Individually Wrapped, with Lid, Sterile (Corning®, cat. no.: 7007) ^ 24-well Clear Flat Bottom Ultra-Low Attachment Multiple Well Plates, Individually Wrapped, Sterile (Corning®, cat. no.: 3473) ^ 6-well Clear Flat Bottom Ultra-Low Attachment Multiple Well Plates, Individually Wrapped, Sterile (Corning®, cat. no.: 3471) ^ Counting Chamber (Marienfeld, cat. no.: 0610010) ^ Cryotube (Greiner Cryo.s™ vials, VWR, cat. no.: 122277) ^ Fluid aspiration system BVC control (Vacuubrand, cat. no.: 20727200) ^ Aqualine AL 12 Water bath (LAUDA, cat. no.: 92635) ^ Heracell VIOS CO2 incubators (Thermo Scientific™, cat. no.: 50145515) ^ Herasafe™ KS, Class II Biological Safety Cabinet (Thermo Scientific™, cat. no.: 51022734) ^ Celltron Orbital Shaker (Infors HT, cat. no.: 69455) ^ Inverted microscope (Nikon SMZ1270, cat. no.: MNA52110)^ 4200 TapeStation System (Agilent, cat. no.: G2991BA)^ LSM 880 Confocal Laser Scanning Microscope (Zeiss) ^ BD FACSAria™ Fusion flow cytometer (BD Biosciences)2.3 Cell culture2.3.1 hiPSC line The ZIP13K2 hiPSC line (a gift from Franz-Josef Müller, Zentrum für Integrative Psychiatrie, University Hospital Schleswig-Holstein, Kiel, Germany) was obtained by reprogramming human dermal fibroblast cell line (HDF51) derived from an aborted female fetus as previously described (Tandon et al., 2018). 2.3.2 Cell propagation For propagation of hiPSC lines, cells were cultured in mTeSR1 medium (85850, StemCell Technologies) in standard cell culture plates coated with Matrigel Basement Membrane Matrix (354234, BD Biosciences), and grown at 37 °C, 5 % CO2 in a water vapor saturated atmosphere. Under the same conditions, HEK273T cells were grown in uncoated plates and cultured in self-made HEK medium containing KnockOut DMEM (10829018, Gibco) supplemented with 10% Fetal Bovine Serum (16140071, Gibco), 2mM Glutamine (35050038, Thermo Scientific), 50 µM 2-Mercaptoethanol (31350010, Gibco) and Penicillin / Streptomycin (15140122, Gibco).2.3.3 Passaging hiPSCsFor passaging hiPSC lines, cells were dissociated by adding EDTA (15575020, Invitrogen) to the culture dish and incubating for 3-4 minutes at 37ºC. After incubation, EDTA was removed carefully and the detachment of the colonies was achieved by flushing the cells with mTESR1 medium. Cells were then resuspended in fresh mTESR1 medium to achieve the desired density and re-seeded in matrigel-coateddishes. Cells were cultured until they reached c.a. 70-80% confluency. 2.3.4 Freezing hiPSCs In order to create stocks of the generated cell lines, cells were frozen and stored in liquid nitrogen using the following protocol. The mTESR1 medium was removed, cells were washed with DPBS and EDTA was added to the cells which where incubated at 37ºC for 5 min. Detached cells were washed with DPBS and centrifuged at 14,000 rpm for 3 min. Then, cells were resuspended freezing mix containing 10% DMSO (D2650, Sigma-Aldrich) in KSR media (description below). The desired number of cells in a total volume of 1 ml were transferred into a Cryotube (Greiner). Cryotubes were then placed in a slow freezing box, where one 1 °C drops per 1 minute which was stored at the -80°C. The next day, all Cryotubes were placed in the liquid nitrogen tank for long-term storage.2.4 Neural induction media2.4.1 KSR medium The KSR medium used for monolayer neural differentiation was made by adding 75 ml of KSRsupplement, 5 ml of GlutaMAX, 5 ml of MEM-NEAA, 5 ml of Penicillin-Streptomycin, and 0.5 ml of beta-mercaptoethanol to 409.5 ml of Knockout DMEM (for a total volume of 500 ml). The medium was then filtered by using a vacuum-driven 0.2-μm filter unit and store at 4°C for up to one month. 2.4.2 N2 medium The N2 medium used for neural differentiation was made by adding the following components to 490 ml of double distilled water: 6.5 g of DMEM / F-12 powder, 0.775 g of D-Glucose, 1 g of Sodium bicarbonate, 5 mg of Apo-transferrin, 12.5 mg of insulin, 30 µl of 500µM Sodium selenite, 100 µl of 830 nM Putrescine, 100 µl of 100 µM Progesterone and 5 ml of Penicillin-Streptomycin (for a total volume of 500 ml). The medium was stirred at room temperature until all components were dissolved, then filtered by using a vacuum-driven 0.2-μm filter unit and store at 4°C for up to one month. 2.4.3 Neurobasal (NB) medium The NB medium used for neural differentiation was made by adding, 5 ml of GlutaMAX, 5 ml of MEM- NEAA, 5 ml of Penicillin-Streptomycin, and 0.5 ml of beta-mercaptoethanol to 484.5 ml of Neurobasal medium (for a total volume of 500 ml). The medium was then filtered by using a vacuum-driven 0.22- μm filter unit and store at 4°C for up to one month. 2.5 Neural induction protocols2.5.1 Monolayer neural differentiationhiPSC colonies were dissociated by adding EDTA to the culture dish and incubating for 2 minutes at 37ºC. After incubation, EDTA was removed carefully Accutase (A6964, Sigma-Aldrich) was added to the culture dish and incubated for 3-4 minutes at 37ºC. After incubation, the detachment of the cells was achieved by flushing the cells and resuspending them in fresh mTESR1 medium containing 10 µM ROCKinhibitor. The single cell suspension was then centrifuged at 270 xg for 5 min at room temperature. Aftercentrifugation, the supernatant was aspirated, and cells were washed once and then resuspended with ½ KSR + ½ N2+NB media containing 10 µM ROCK inhibitor. After counting, 750,000 cells were seeded per each well of a 6-well low-attachment plate in 2 ml of ½ KSR + ¼ N2 + ¼ NB media containing 1% B27 without retinoic acid and 10 µM ROCK inhibitor. Next day- day 1 of the differentiation protocol- EBs were gently scraped to avoid their settlement on the bottom of the dish and to allow them to grow in suspension. Neural induction was initiated on day 2 by changing the medium to ¼ KSR and ¾ N2+NB containing 1% B27 without retinoic acid, 10 µM of ROCK inhibitor, and adding the inhibitor molecules SB-431542 (10 µM), Noggin (250 ng / ml) and XAV939 (3.3 µM). On day 3, EBs are transferred from the low-attachment plates to the 6 cm dishes that had been previously coated with polyornithine (PO) (15 µg / ml), laminin (Lam) (1 µg / ml) and fibronectin (FN) (1 µg / ml). The pre-coated dishes were dried around the edges in order to limit and restrict the surface area to the center of the dish where EBs will be able to attach and grow. Then, EBs were scraped, collected and distributed into the PO / Lam / FN coated- dishes (1:2) to allow their flattening, growth and rosette-formation. On day 7, medium was change with fresh ½ N2 + ½ NB media containing 1% B27 without retinoic acid and SB-431542 (5 µM), Noggin (125 ng / ml) and XAV939 (3.3 µM). After 2 days, on day 9, medium was changed replacing all inhibitors for FGF8 (100 ng / ml) and BDNF (20 ng / ml). On day 12, for propagation of the neural stem cells, rosetteswere harvested by picking and re-plated on PO / Lam / FN pre-coated dishes with fresh media (same ason day 9). This procedure was performed every 5-7 days- once confluency was reached- unless cells were collected for downstream analysis on the desired time point. From day 28 onwards, medium was substituted with of ½ N2 + ½ NB media containing 1% B27 without retinoic acid and with FGF2 (20 ng / ml), EGF (20 ng / ml), and BDNF (20 ng / ml), which was changed every 2-3 days. 2.5.2 Generation of neural organoids hiPSC colonies were dissociated and processed as mentioned above (see Monolayer neural differentiation section). After centrifugation, the supernatant was aspirated, and cells were washed twice and then resuspended in hESC medium containing 4 ng / ml FGF2 and 50 µM ROCK inhibitor. After counting, 9,000 cells were seeded per each well of a 96-well U-bottom low-attachment plate in a total volume of 150 µl resuspension medium. After 2 days, neural induction was initiated by exchanging 75 µl of the medium for 150 µl of fresh hESC medium containing 4 ng / ml FGF2 and 50 µM ROCK inhibitor, together with the inhibitor molecules SB-431542 (10 µM), Noggin (250 ng / ml) and XAV939 (3.3 µM). On day 4, 150 µl of the medium was exchanged for fresh one containing the same concentration of inhibitor molecules. If the organoid size was above 350 µm in diameter, FGF2 and ROCK inhibitor were not added to the medium. Once organoids achieved a size greater than 400 µm in diameter and showed the expected morphology (around day 6), they were transferred to a 24-well low-attachment plates in 500 µl of N2 medium supplemented with the inhibitor molecules SB-431542 (10 µM), Noggin (250 ng / ml) and XAV939 (3.3 µM). Every 2 days, 300 µl of media was replaced for fresh one. On day 11, organoidswere embedded in matrigel drops (30 µl) and transferred into a 6-well low-attachment plates. For eachwell, 4 organoids were transferred with 2.5 ml of N2 medium containing 1% B27 without retinoic acid. Every 2 days media was changed. On day 15, organoids were transferred to an orbital shaker (at 86 rpm) to allow for better oxygenation, and N2 medium was supplemented with 1% B27 with retinoic acid. From day 50 onwards, for long term organoid differentiation, 1% matrigel was added into the mediumevery time the media was changed- every 2-3 days. 2.5.3 Processing organoid samples for immunostainingsOrganoid samples were taken at the desired date were fixed with 4% paraformaldehyde solution(E15713-S, Science Service) for 30 minutes to 1 hour depending on the size. Following fixation, theywere washed twice in PBS and infused in 30% (w / v) sucrose in DPBS for minimum 3 hours (to overnight at 4ºC) for cryoprotection. The following day, organoids were submerged in OCT (4583, Tissue-Tek®) for embedding and stored at -80ºC until processing. Prior to cryosectioning, the prepared blocks containing the organoids were placed at -20ºC to allow the tissue to acclimate, and then were sectioned into 10-μm-thick slices. Samples were then stored at -80ºC until used for immunofluorescence analysis.2.6 Immunofluorescence and confocal microscopyThe immunostaining protocol was done either directly on cells grown on matrigel-coated plastic plates or on cryopreserved organoid sections. For cultures, cells were fixed for 30 minutes with 4% paraformaldehyde solution. After a couple washesin DPBS, cells were permeabilized for 30 minutes at room temperature in PBST: DPBS containing 0.3%Triton X-100 (9002-93-1, Sigma Aldrich), 1% bovine serum albumin (BSA) (A9647-100G, Sigma Aldrich), 10% Fetal Bovine Serum (FBS) (16140071, Gibco). Followed by blocking for 30 minutes at room temperature in PB (DPBS containing 1% BSA and 10% FBS). Then, cells were incubatedovernight at 4ºC with the desired primary antibody combination diluted in PB (listed in table 3.1). Forsignal detection, cells were washed three times during 10 minutes in PB followed by a 45 min incubation at room temperature with fluorescent conjugated secondary antibodies (listed in table 3.2), and a 5minutes incubation of DAPI (10 μg / ml, Roche) in PBS for nuclear counterstaining. After washing twicewith DPBS, fresh DPBS was added and plates were stored, covered from light, at 4ºC until image acquisition. For organoids, circles around the organoid sections were traced with the hydrophobic PAP-pen to form a repellent barrier to keep the reagents localized on the organoid tissue and preventing the mixing of reagents. After a wash in DPBS, sections were permeabilized for 45 minutes at room temperature in PBST followed by blocking for 45 minutes at room temperature in PB. Then, sections were incubated with the desired antibody combination diluted in PB (listed in table 2.1) for 3 hours at 37ºC. After the incubation, sections were washed three times during 10 minutes in PB followed by a 45 min incubation at room temperature with fluorescent conjugated secondary antibodies (listed in table 2.2), and a 5minutes incubation of DAPI (10 μg / ml, Roche) in PBS for nuclear counterstaining. After washing twicewith DPBS, slides were dried and coverslips were mounted with Mowiol mounting solution (0713.2,Roth).Image acquisition was done by using a confocal microscope LSM880 (Carl Zeiss Micro Imaging) and obtained data were processed and analysed with the Zeiss ZEN 2011 software (Carl Zeiss, Inc.). Primary antibodies Distributor Cat. No. DilutionCEMIP2 ThermoFisher Scientific BS-8059R 1:200DCX Merck Millipore AB2253 1:500EMX1 Merck Millipore HPA006421 1:100FOXG1 Abcam ab18259 1:400GBX2 proteintech 21639-1-AP 1:200IGDCC3 (PUNC) Santa Cruz Biotechnology sc-514023 1:200LGR5 Origene TA503316 1:200MCAM Santa Cruz Biotechnology sc-18837 1:100OTX2 R&D Systems AF1979 1:500PAX6 DSHB Supernatant 1:22PRTG ThermoFisher Scientific TA501394 1:200SDC1 Santa Cruz Biotechnology sc-390791 1:100TFAP2A (3B5) DSHB Concentrate 1:100Table 2.1 Primary antibodies. Table showing the primary antibodies and the concentration used for the immunostainings of cells. Secondary antibodies Distributor Cat. No.Goat anti-Mouse IgG1 Cross-Adsorbed SecondaryInvitrogen A-21123Antibody, Alexa Fluor 546 Goat anti-Mouse IgG1 Cross-Adsorbed SecondaryInvitrogen A-21121Antibody, Alexa Fluor 488 Goat anti-Mouse IgG2a Cross-Adsorbed SecondaryInvitrogen A-21143Antibody, Alexa Fluor 546 Goat anti-Mouse IgG2b Cross-Adsorbed SecondaryInvitrogen A-21242Antibody, Alexa Fluor 647 Goat anti-Mouse IgG2b Cross-Adsorbed SecondaryInvitrogen A-21141Antibody, Alexa Fluor 488 Goat anti-Mouse IgM Heavy Chain Secondary Antibody,Invitrogen A-21238Alexa Fluor 647 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed SecondaryInvitrogen A-11010Antibody, Alexa Fluor 546 Goat anti-Rabbit IgG (H+L) Cross-Adsorbed SecondaryInvitrogen A-21244Antibody, Alexa Fluor 647 Table 2.2. Secondary antibodies. Table showing the secondary antibodies together used for the immunostainings of cells. Concentration used for all was 1:700 dilution.2.7 Fluorescence activated cell sorting of live cellsCells were harvested and gently dissociated using HBSS (14025092, Gibco) containing 7.5 ml HEPES 1M for a non-enzymatic dissociation to avoid disruption of surface antigens. Cells were collected and centrifuged at 300xg for 5 minutes and resuspended in HBSS with 5% FBS and ROCKi (10 µM). Then, cells were filtered through a 35-µm mesh cell strainer caps and counted to obtain a single cell suspension of approximately 10x106cells per ml for analysis. Cell viability was determined by trypan blue dye exclusion for a viability above 80% before use for analysis and sorting experiments. Surface antigens were labeled by incubating with MCAM and PRTG primary antibodies diluted in HBSS with 5% FBS and ROCKi (10 µM) (table 2.3) for 15 minutes on ice, followed by two washes in HBSS and incubation for 10 minutes with the appropriate fluorescent secondary antibodies diluted in HBSS with 5% FBS and ROCKi (10 µM) (table 2.4). After incubation, cells were washed twice and resuspended inHBSS with ROCKi (10 µM) for sorting. Cell sorting was done with a BD FACSAria™ Fusion flowcytometer (BD Biosciences) by using an 85 µm nozzle and collecting the sorted cells in FBS with ROCKi (10 µM). For sorting we used the FACSDiva software (BD Biosciences) and fluorescence was determined by the analysis and gating against appropriate controls. Flow cytometry forward (FSC) versus side scatter(SSC) density plots were first used to exclude debris. Then, singlets were selected based on FSC-areaversus FSC- width, and SSC-area versus SSC-width. Samples stained only with the secondary antibodies were used as controls to set the appropriate negative gates since there was some false positive background signal. Primary antibodies Distributor Cat. No. DilutionMCAM Santa Cruz sc-18837 1:50Biotechnology PRTG ThermoFisher Scientific TA501394 1:100Table 2.3. Primary antibodies use for the pre-staining of cells for FACS analysis. Cell-surface staining was done by using the antibodies listed individually or in combination. Secondary antibodies Distributor Cat. No. DilutionGoat anti-Mouse IgG1 Cross-Adsorbed SecondaryInvitrogen A-21121 1:2000Antibody, Alexa Fluor 488 Goat anti-Mouse IgG2a Cross-Adsorbed SecondaryInvitrogen A-21143 1:4000Antibody, Alexa Fluor 546 Table 2.4. Secondary antibodies use for the detection of surface antigens for FACS analysis. For MCAM the anti-Mouse IgG1 on the 488-emission wavelength was used, and for PRTG anti-Mouse IgG2a on the 546-emission wavelength. After sorting, data were additionally analysed by using FlowJo software (Tree Star, Ashland, OR,http: / / www.treestar.com), and collected cells were either replated in conditioned medium or pelleteddown and snap frozen for downstream analysis. For neuronal terminal differentiation, sorted cells were replated at very high density (400,000 cells per cm2) and differentiated for 14 days with NB medium supplemented with BDNF (20 ng / ml), ascorbic acid (0.2 mM), GDNF (20 ng / ml) and DAPT (10 μM). 2.8 RNA extraction Total RNA was isolated using the miRNeasy™ RNA Mini Kit (Qiagene) according to the manufacturer’s instructions. Briefly, cell pellets were resuspended and homogenized in 700 µl of QIAzol lysis reagent. After incubation at room temperature for 5 minutes, 140 µl of chloroform was added and incubated again for 3 minutes. Next, the homogenate was then centrifuged at 12000 xg for 15 min and at 4oC. After centrifugation, 300 µl of the aqueous phase was collected and mixed with 450 µl of 100% ethanol. The sample was then transferred into a RNeasy mini column and centrifuged at 8000 xg for 15 seconds. After washing with 350 µl of RWT buffer and centrifuged for 15s at 8000 xg, 80 µl of DNAse I mix was added directly into the RNeasy mini spin column membrane and incubated for 15 minutes at room temperature. After incubation, two washes were done with 500 µl RWT and RPE buffers and centrifugingfor 15 s at 8000 xg. The membrane of the RNeasy mini spin column was dried by additionalcentrifugation and, lastly, samples were eluted in 20 µl of RNase free water. RNA quality assessment and concentration measurement was done by using the Nanodrop (for samples being used for RT- qPCR) or the Tapestation (for samples being used for library preparation). cDNA synthesis 250 ng of total RNA was used for cDNA synthesis by using the high-capacity cDNA reverse transcription kit (4368814, Applied biosystems) as described by the manufacturer. Briefly, RNA was added to themaster mix and incubated on the thermocycler as described on table 2.5.cDNA reaction (20 µl) Cycle nº T [°C] Time[h:min:sec] 2 µl RT buffer x10 1 25 10:00 2 µl Random Primers x10 2 37 2:00:00 0.8 µl dNTPs mix x25 (100mM) 3 85 0:5 0.25 µl RNase inhibitor 4 4 hold 0.25 µl RT enzyme 5 µl RNA (250 ng) Up to 20 µl Nuclease free water Table 2.5. Brief protocol for cDNA synthesis. Master mix reaction and thermocycler conditions for conducting the cDNA preparation. 2.10 Real-time quantitative PCR Quantitative real-time PCR reaction was performed with the FastStart Universal SYBR green (Roche)on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) following instructions (table 2.6).Three biological replicates were used for each condition and normalized on HPRT expression levels.Oligonucleotides used to measure mRNA levels are summarized in table 2.7. Melt and standard curves for each primer set were generated to confirm that only one amplicon was generated at the same efficiency as the housekeeping gene HPRT. Obtained data were analyzed using the ΔΔCT method described elsewhere (Livak and Schmittgen, 2001). For statistical analysis, the GraphPad Prism software was used. RT-PCR reaction (12 µl) Cycle nº T [°C] Time[min:sec] 6 µl FastStart Universal SYBR Green Master 1 48 30:00 (ROX) 2 95 10:00 0.4 µl Forward Primer (30 µM) [3 95 0:15 0.4 µl Reverse Primer (30 µM) 4] x 40 60 1:00 5 µl of cDNA lysate (6 ng) 5 95 0:15 Up to 12 µl Nuclease free water 6 60 0:15 7 95 0:15 Table 2.6. Brief protocol for RT-qPCR. Master mix reaction and thermocycler conditions for conducting the RT-qPCR. Target Forward oligonucleotide (5’-3’) Reverse oligonucleotide (5’-3’)DCX CATCCCCAACACCTCAGAAGA CGTTTGCTGAGTCAGCTGGAEMX1 GAGACGCAGGTGAAGGTGTG CACCGGTTGATGTGATGGGAEMX2 GTCATCGCTTCCAAGGTAAAAGT TGTTGCGAATCTGAGCCTTCTEOMES AACCACTGGCGCTTCCA AACATACATTTTGTTGCCCTGFOXG1 AGGAGGGCGAGAAGAAGAAC TGAACTCGTAGATGCCGTTGGBX2 GCGGTGACCTGGGGTTC GAGAAGCTCTCCTCCTTGCCHES5 ACCAGCCCAACTCCAAGCT GGCTTTGCTGTGCTTCAGGTAHPRT TGACACTGGCAAAACAATGCA GGTCCTTTTCACCAGCAAGCTIRX3 GATCGCTGTAGTGCCTTGGA CAGATGGTTCTGGGGCCGLHX2 CAAAAGACGGGCCTCACCAA TTCCTGCCGTAAGAGGTTGCOTX2 GGGAGTGAAGAGGGAAGGGA GTGAGAGTTCAAAGCAGGGCPAX6 CACACCGGTTTCCTCCTTCA GGCAGAGCGCTGTAGGTGTTTSIX3 CAGCAAGAAACGCGAACTGG TGCTGGAGCCTGTTCTTGGSOX2 GGCAATAGCATGGCGAGC TTCATGTGCGCGTAACTGTCTable 2.7. RT-qPCR oligonucleotides. Oligonucleotides used for conducting the quantitative Real-Time PCR experiments. 2.11 Preparation of RNA-seq libraries RNA-seq libraries were generated by using the TruSeq RNA Library Preparation Kits (Illumina), as described by the manufacturer. Briefly, the main steps are described below. 2.11.1 Purification and fragmentation of mRNA 100 ng per sample of total RNA was diluted with nuclease-free ultra-pure water to a final volume of 50 μl with the RBP barcode label.50 μl of RNA Purification Beads was added to each sample to bind the poly-A RNA to the oligo dT magnetic beads. Samples were added to the thermocycler for mRNA denaturation (65°C for 5 minutes, 4°C hold) to denature the RNA and facilitate binding of the poly-A RNA to the beads was done. Next, samples were incubated at room temperature for 5 minutes to allow the RNA to bind to the beads. Without disturbing the beads, the supernatant was discarded. Beads were washed by adding 200 μl of Bead Washing Buffer per sample and incubated at room temperature for 5 minutes. Without disturbing the beads, the supernatant was discarded, and 50 μl of Elution Buffer was added to each sample. Samples were placed on the pre-programmed thermal cycler (80°C for 2 minutes, 25°C hold) to elute the mRNA from the beads.50 μl of Bead Binding Buffer was added to each sample and were incubated at room temperature for 5 minutes. Supernatant was then removed and beads were washed by adding 200 μl of Bead Washing Buffer. After 5 minutes of incubation at room temperature, the supernatant was discarded and 19.5 μl of Elute, Prime, Fragment Mix was added per sample which were added to the thermocycler (94°C for 8 minutes, 4°C hold) to elute, fragment, and prime the RNA. The Elute, Prime, Fragment Mix contains random hexamers for RT priming and serves as the 1st strand cDNA synthesis reaction buffer. 2.11.2 Synthesis of the first strand of cDNA 17 μl of the supernatant (fragmented and primed mRNA) was transferred to new eppendorfs, and 50 μl SuperScript II was added to the First Strand Master Mix tube (ratio: 1 μl SuperScript II for each 7 μl First Strand Master Mix). Samples were then incubated in the thermocycler using the 1st Strand program: 25°C for 10 minutes, 42°C for 50 minutes, 70°C for 15 minutes and hold at 4°C. 2.11.3 Synthesis of the second strand of cDNA 25 μl of thawed Second Strand Master Mix was added to each sample and incubated in a pre-heated thermal cycler at 16°C for 1 hour. After incubation, 90 μl of well- mixed AMPure XP beads was added to 50 μl of ds cDNA and incubated at room temperature for 15 minutes. Then, 135 μl of the supernatant was removed and beads were washed twice by adding 200 μl of freshly prepared 80% EtOH for 30 seconds. Then, samples were air-dried for 15 minutes at room temperature and 52.5 μl of Resuspension Buffer was added and incubated at room temperature for 2 minutes. Aplacing samples on the magnetic rack, 50 μl of the supernatant (ds cDNA) was transferred to new tubes. 2.11.4 End repair 10 μl of diluted End Repair Control (or 10 μl of Resuspension Buffer if not using End Repair Control) was added to the 50 μl of ds cDNA. Then, 40 μl of End Repair Mix was added and samples were incubated on the pre-heated thermal cycler at 30°C for 30 minutes. After incubation, 160 μl of well-mixed AMPure XP Beads were added to the samples and incubated at room temperature for 15 minutes. Then, 127.5 μl of the supernatant was removed beads were washed twice by adding 200 μl of freshly prepared 80% EtOH for 30 seconds. Then, samples were air-dried for 15 minutes at room temperature and resuspended in 17.5 μl Resuspension Buffer. After incubating for 2 minutes room temperature and placing samples on the magnetic rack, 15 μl of the clear supernatant was transferred to new tubes. 2.11.5 3'-ends adenylation2.5 μl of diluted A-Tailing Control (or 2.5 μl of Resuspension Buffer if not using A-Tailing Control) wasadded to each sample together with 12.5 μl of A-Tailing Mix. Samples were then incubated on the pre- heated thermal cycler at 37°C for 30 minutes. 2.11.6 Adapters ligation 2.5 μl of diluted Ligase Control (or 2.5 μl of Resuspension Buffer if not using Ligase Control) was added to each sample together with 2.5 μl of single RNA Adapter Indexes. Samples were then incubated on the pre-heated thermal cycler at 30°C for 10 minutes. To inactivate the ligation mix, 5 μl of Stop Ligase Mix was added to each sample. After incubation, 42 μl of well-mixed AMPure XP Beads were added to the samples and incubated at room temperature for 15 minutes. Then, 127.5 μl of the supernatant was removed beads were washed twice by adding 200 μl of freshly prepared 80% EtOH for 30 seconds. Then, samples were air-dried for 15 minutes at room temperature and resuspended in 52.5 μl Resuspension Buffer. After incubating for 2 minutes room temperature and placing samples on the magnetic rack, 50 μl of the clear supernatant was transferred to new tubes. Another clean-up round was done by adding 50 μl of mixed AMPure XP Beads. After washes, 95 μl of the supernatant was removed and discarded. After air-drying samples for 15 minutes at room temperature, 22.5 μl of Resuspension Buffer was added. After incubating for 2 minutes room temperature and placing samples on the magnetic rack, 20 μl of the clear supernatant was transferred to new tubes. 2.11.7 Enrich DNA Fragments 5 μl of the PCR Primer Cocktail was added to each sample together with 25 μl of PCR Master Mix. Library was then amplified by using the following thermocycler settings: 98°C for 30 seconds and 15 cycles of: 98°C for 10 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 72°C for 5 minutes, and hold at 4°C. After incubation, 50 μl of well-mixed AMPure XP Beads were added to the samples and incubated at room temperature for 15 minutes. Then, 95 μl of the supernatant was removed beads were washed twice by adding 200 μl of freshly prepared 80% EtOH for 30 seconds. Then, samples were air- dried for 15 minutes at room temperature and resuspended in 32.5 μl Resuspension Buffer. After incubating for 2 minutes room temperature and placing samples on the magnetic rack, 30 μl of the clear supernatant was transferred to new tubes. Finally, libraries were validated by using a Tapestation (Agilent 4200) to check for quality control and accurate quantification. The final product was a band at approximately 260 bp (for single-read libraries). Samples were then sequenced on the Illumina HiSeq 2500 sequencer as 100 bp paired-end reads. 2.12 RNA-Seq processing and analysis Raw RNA-Seq reads were processed by trimming using Trimmomatic v0.36 (Bolger et al., 2014). The following parameters were used: leading:3; trailing:3; sliding window:4:15; minlen:36. Trimmed reads were then mapped to the human reference genome hg38 with gencode v29 as a reference transcriptome (https: / / www.gencodegenes.org / human / release_29.html) using STAR v2.6.1d (Dobin et al., 2013). After mapping, FPKM values for each gene and corresponding isoforms were estimated with RSEM v1.3.1 (Li and Dewey, 2011) and aligned to the reference transcriptome by using the STAR aligned bam. Principal component analysis was run on the logged FPKM expression values (base 10 with a pseudocount of 1) using the top 10,000 genes with the highest variance. 2.13 Single cell RNA sequencing 2.13.1 Sample preparation For generating the 2D monolayer differentiation dataset, neural rosettes were picked at the three different timepoints (day 12, day 35, and day 50). Cells were collected in 15 ml falcon tubes containing Accutase and were incubated in a water bath for 5 minutes at 37ºC. 25µg / ml of DNAse I (07469, STEMCELL technologies) was added to reduce viscosity. After incubation, the detachment of the cells was achieved by flushing the cells and resuspending them in fresh mTESR1 medium containing 10 µM ROCK inhibitor. The single cell suspension was then centrifuged at 270 xg for 5 min at room temperature. After centrifugation, the supernatant was aspirated,and cells were washed once with PBS containing 0.4% BSA and then counted to obtain the desiredconcentration. 2.13.2 Library construction Chromium Next GEM Single Cell 3’ GEM, Library & Gel Bead Kit (PN-1000121, 10xGenomics) with the v3.1 chemistry. Briefly, a cell suspension of 16500 cells per sample (1000 / µl) was taken aiming at a recovery of 10000 cells per sample, as recommended in the protocol. Cells were then used to generate the Gel Bead-In-Emulsions and then followed by library preparation as suggested by v3.1 single cell kit protocol as mentioned by manufactured. Briefly, the main steps are described below. 2.13.3 GEM generation and barcoding 70 µl Master Mix was added to the cell suspension and was gently dispensed into the bottom center of each well in row labeled 1 without introducing bubbles. After vortexing, 50 µl of Gel Beads were dispense into the wells in row labeled 2 without introducing bubbles.45 µl Partitioning Oil was added into the wells in row labeled 3 from a reagent reservoir. And, 50% Glycerol was dispensed into all the unused chip wells, following the same volumes. Finally, the chip was covered with a gasket. Assembled chip with the gasket was then placed inside the Chromium Controller ensuring that the chip stays horizontal. After the program was completed, 100 µl GEMs were slowly aspirated from the lowest points of the recovery wells in the top row labeled 3 without creating a seal between the tips and the bottom of thewells. GEMs should appear opaque and uniform across all channels. Over the course of ~20 sec, GEMswere dispensed into a new tube strip on ice with the pipette tips against the sidewalls of the tubes. Then, the samples incubated in the thermocycler with the following program: 53°C for 45 minutes, 85°C for 5 minutes, and hold at 4°C.2.13.4 Post GEM–RT cleanup and cDNA amplificationAdd 125 µl of Recovery Agent to each sample at room temperature without disrupting the biphasic mix. The resulting biphasic mixture contains Recovery Agent / Partitioning Oil (pink) and aqueous phase (clear), with no persisting emulsion (opaque). Then, 125 µl of the Recovery Agent / Partitioning Oil (pink) was slowly removed and discarded from the bottom of the tube, being careful not to aspirate any aqueous sample.200 µl of pre-vortexed Dynabeads MyOne SILANE were added to each sample and incubated for 10 min at room temperature. At the end of 10 min incubation, samples were placed on a 10x Magnetic Separator until the solution was cleared.300 µl of 80% ethanol was added to the pellet while on the magnet for 30 seconds and removed. Another 200 µl 80% of ethanol was added repeating the previous step. Samples were then air-dried for 1 minute and immediately 35.5 µl of Elution Solution was added to each sample. After incubation for 2 minutes at room temperature, samples were placed on a 10x Magnetic Separator until the solution was cleared. Then, 35 µl of sample was transferred to a new tube strip for amplifying cDNA.65 µl of cDNA Amplification Reaction Mix was added to 35 µl of each sample and incubated in a thermal cycler with the following protocol. cDNA amplification reaction (100 µl) Cycle nº T [°C] Time[min:sec] 1 98 03:00 50 µl Amp Mix [2 98 0:15 15 µl cDNA Primers 3 63 0:20 35 µl sample4] x 972 1:00 5 72 1:00 6 4 Hold Table 2.8. Brief protocol for cDNA amplification. Master mix reaction and thermocycler conditions for amplifying cDNA. At the end of the program, 60 µl of SPRIselect reagent (0.6X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and the supernatant was removed. Beads were washed twice by adding 200 µl of 80% ethanol to the pellet while on the magnet for 30 seconds and removed. Samples were then air- dried for 1 minute and immediately 40.5 µl of Elution Solution was added to each sample. After incubation for 2 minutes at room temperature, samples were placed on a 10x Magnetic Separator until the solution was cleared, and 40 µl of sample was transferred to new tubes. Final quality assessment and quantification of the amplified cDNA was done by using the Tapestation (Agilent 4200). Accurate quantification is essential since the total number of SI PCR cycles need to beoptimized based on carrying forward a fixed proportion (10 µl, 25%) of the total cDNA yield calculatedduring post cDNA amplification QC and quantification. 2.13.5 3ʹ-Gene expression library construction 10 µl of the purified cDNA sample (25%) was used for generating the 3ʹ-Gene Expression libraries.25 µl of Buffer EB and 15 µl of Fragmentation Mix were added together to each sample. Samples were then transferred into the pre-cooled thermal cycler (4°C) and first step was skipped to initiate the protocol. Fragmentation reaction (50 µl) Cycle nº T [°C] Time[min:sec] 5 µl Fragmentation Buffer 1 4 Hold 10 µl Fragmentation Enzyme 2 32 30:00 10 µl purified cDNA 3 65 5:00 25 µl Buffer EB 4 4 Hold Table 2.9. Brief protocol for cDNA fragmentation. Master mix reaction and thermocycler conditions for fragmenting the cDNA. At the end of the program, 30 µl of SPRIselect reagent (0.6X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and 75 µl of the supernatant was transferred to new tubes. Then, 10 µl of SPRIselect reagent (0.8X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and the supernatant was removed. Beads were washed twice by adding 200 µl of 80% ethanol to the pellet while on the magnet for 30 seconds and removed. Samples were then air-dried for 1 minute and immediately 50.5 µl of Elution Solution was added to each sample. After incubation for 2 minutes at room temperature, samples were placed on a 10x Magnetic Separator until the solution was cleared, and 50 µl of sample was transferred to new tubes. In order to add the adaptors, 50 µl of the Adaptor Ligation Mix was added to 50 µl of sample. Then, samples were then transferred into the thermocycler with the following protocol. Adaptor ligation reaction (50 µl) Cycle nº T [°C] Time[min:sec] 20 µl Ligation Buffer 10 µl DNA Ligase 1 20 15:00 20 µl Adaptor Oligos 2 4 Hold 50 µl sample Table 2.10. Brief protocol for adaptor ligation. Master mix reaction and thermocycler conditions for adding the adaptors to the cDNA. At the end of the program, 80 µl of SPRIselect reagent (0.8X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and the supernatant was removed. Beads were washed twice by adding 200 µl of 80% ethanol to the pellet while on the magnet for 30 seconds and removed. Samples were then air- dried for 1 minute and immediately 30.5 µl of Elution Solution was added to each sample. After incubation for 2 minutes at room temperature, samples were placed on a 10x Magnetic Separator until the solution was cleared, and 30 µl of sample was transferred to new tubes. 2.13.6 Sample indexing PCR Individual indexes from the Single Index Kit T Set A (PN-1000213, 10xGenomics) were used for samplebarcoding. 60 µl of Sample Index PCR Mix was added to 30 µl of each sample and incubated in athermal cycler with the following protocol. Sample Index PCR reaction (100 µl) Cycle nº T [°C] Time[min:sec] 1 98 0:45 50 µl Amp Mix [2 98 0:20 10 µl SI Primer 3 54 0:30 30 µl sample4] x 1172 0:20 5 72 1:00 6 4 Hold Table 2.11. Brief protocol for the indexing PCR. Master mix reaction and thermocycler conditions indexing the samples. At the end of the program, 60 µl of SPRIselect reagent (0.6X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and 150 µl of the supernatant was transferred to new tubes. Then, 20 µl of SPRIselect reagent (0.8X) was added to each sample and incubated for 5 minutes at room temperature. Then, samples were placed on a 10x Magnetic Separator until the solution was cleared and the supernatant was removed. Beads were washed twice by adding 200 µl of 80% ethanol to the pellet while on the magnet for 30 seconds and removed. Samples were then air-dried for 1 minute and immediately 50.5 µl of Elution Solution was added to each sample. After incubation for 2 minutes at room temperature, samples were placed on a 10x Magnetic Separator until the solution was cleared, and 35.5 µl of sample was transferred to new tubes. In order to add the adaptors, 30 µl of the Adaptor Ligation Mix was added to 50 µl of sample. Then, quality assessment and quantification of the libraries was done by using the Tapestation (Agilent4200). We obtained an average library of 0.55 ng / ul in a total of 33 ul (18.15 ng). Finally, libraries werepooled and sequenced using the 28 / 91 Illumina high output sequencing aiming at 500 million fragmentsper sample on the Illumnia NovaSeq 6000 S2 flow cell.2.13.7 Single cell RNA sequencing data processingThe scRNA-Seq data were processed using the Cellranger v3.1.0 software (Zheng, G., et al 2017) was used to cluster and determine valid cell barcodes, identify unique molecular identifier (UMI) corresponding to identify and quantify unique RNA molecules for each individual cell, and map reads to the reference genome hg38 and nd ensembl reference transcriptome version 93 (http: / / ftp.ensembl.org / pub / release-93 / gtf / homo_sapiens / Homo_sapiens.GRCh38.93.gtf.gz). Cell barcodes that had at least 10,000 unique molecular identifiers (UMIs) or at least 40% mitochondrial UMIs were filtered out from the downstream analyses together with the detected doublets. Detection ofdoublets was done by running scrublet version 0.2.3 (Wolock et al., 2019) setting the input parameterto ‘expected_doublet_rate = 0.05’ and applying a doublet score threshold of 0.2. For normalization of gene expression values, UMI gene counts per cell were divided by the library size, then multiplied by a scaling factor of 10000, and log transformed after adding a pseudocount of 1. Individual cell expressionprofiles were then clustered using Scanpy v1.5.1 (Wolf et al., 2018) and clusters were assigned to invivo biological cell types based on relative expression levels of well-known marker genes for cell type, brain region, and cycling status. Finally, Principal Component Analysis was then performed on the normalized expression values of the top 2000 highly variable genes. Clusters were determined using the Louvain clustering procedure on the top 50 principal components with scanpy’s louvain function. For the PRTG-sorted datasets at day 5 and at day 10 we ran differential expression analysis comparingthe NSC populations. Differential expression analysis was done by using a t-test with scanpy’srank_genes_group function and the method t-test_overestim_var. Only genes expressed in at least 5%of cells within at least one cluster were tested, and they were labelled as significantly upregulated if theyhad a log2-transformed fold change of at least one and q-value less than 0.05 after applying aBenjamini–Hochberg multiple hypothesis correction to the estimated p-values.3. RESULTS3.1 Characterization of hiPSC3-derived cortical progenitors by scRNA-seqAs a first step towards identifying novel surface markers for early cortical NSCs, we focused on betterunderstanding our 2D monolayer differentiation paradigm (Figure 1). Neural induction of ZIP13K2(hiPSC line) towards cortical lineages is conducted in a 2D setting using the Triple-inhibitor (Triple-i)protocol which was established in the lab (Rosebrock et al, 2022). The triple-i protocol combines WNTinhibition using XAV 939, and TGF-β and BMP inhibition using SB-431542 and Noggin, respectively. We employ these inhibitors starting on day 2 of differentiation, after EB formation and continue until day9 to promote expansion of anterior neuroectodermal fates. Around day 12, neural rosette formation- ahallmark of early cortical differentiation- is visible, representing the early NSC stage. Such rosette structures are manually picked and replated weekly in order to propagate the NSCs. Progression of the culture will eventually entail the dismantlement of the rosette structures in accordance with the advancement of differentiation.To evaluate the transcriptional identity of the hiPSCs-derived cortical progenitors, we performed scRNA-seq on rosette cells collected from three relevant time points: day 12, day 35 and day 50, corresponding to early-, mid-, and late-NSC populations. Initially, we analyzed each time point individually. After clustering for the highly variable genes amongthe diverse cell populations, we characterized each cluster based on the expression of a panel of well-known marker genes for cell state and brain regions, including dorsal pallium (neocortex), medial pallium, subpallium, and diencephalic, as well as more posterior regions such as mid-hindbrain and non- neural lineages (epithelial and mesenchymal) (Figure 2, 3, 4). At the earliest stage, day 12, we identify thirteen clusters which were primarily composed of dividing and non-dividing NSCs denoted by the expression of SOX2, SOX1, FABP7 and HES5. Moreover, ten out of these thirteen clusters appear to highly express forebrain markers including PAX6, FOXG1, SP8, SIX3, EMX2, LHX2. However, there appears to be a clear dichotomy in the identity of these forebrain cells, where half of the population at day 12 shows anterior forebrain identity (neocortex and medial pallium) (clusters 1, 4, 6, 10, 7, and 8) whereas the other half shows posterior forebrain identity (clusters 0, 2, 3, and 5). Additionally, one cluster of NCS show expression mid / hindbrain markers instead, such as GBX2, IRX2, IRX3 and EN1 among others. While a small number of remaining cells form two additional clusters corresponding to pluripotent stem cells denoted by the expression of POU5F1 and NANOG, and early neurons marked by expression of DCX, ELAVL2 and ELAVL3 (Figure 2).On day 35, we observe an increased in cell type diversity as exemplified with the identification of twentycell clusters. As expected, most of the population is composed by NSCs but we observe the appearance of more differentiated cells exemplified by the presence of intermediate progenitors (IP) (cluster 17) expressing EOMES and TBR1, and neuronal clusters of various regional identities (clusters 11, 14, 18,and 19) expressing DCX and TUBB3. Surprisingly, expression of posterior fate (diencephalon andmid / hindbrain) genes were increased, promoting tissues posterior to the cortex at expenses of cortical fates. Additionally, we also found clusters of choroid plexus and non-neural lineages (clusters 0, 1, 8, 13, 15, and 16) such as mesenchymal cells expressing KRT18 and KRT8, and epithelial cells expressing DCN and LUM (Figure 3). Similarly, on day 50 we also observe a larger diversity of cell types identifying 24 cell clusters. Again, we can appreciate the same cell identities that appear on day 35, but posterior identities gain even more prevalence (Figure 4). Altogether our analysis suggests that even though we induce a highly homogeneous forebrain population by day 12, the culture becomes more heterogeneous as differentiation progresses, highlighting the need for protocol improvement towards the generation of more homogeneous cortical lineages in monolayer cultures.3.2 Identification of potential surface markers for early cortical NSCsWe made use of the scRNA-seq dataset to investigate possible surface markers for identifying earlycortical NSCs in culture. In order to profile cell surface markers that identify specific regional andtemporal populations in our culture system we integrated the tree time points (Figure 5) and used the above-described clustering annotation. Upon merging the scRNA-seq data, we can see that day 35 and day 50 cluster together or in greatproximity while day 12 clusters separately further indicating how transcriptionally similar day 35 and day50 are, while day 12 has the most distinct signature most probably due to the high homogeneity in forebrain NSCs. Most interestingly, we identified stage and cell state specific genes which exhibited differential expression patterns in the diverse cell types throughout time during neural induction (Figure6). Recapitulating in vivo development and consolidating the fact that the progressively emerging andchanging NSC populations have distinct molecular signatures, from which we can extract potential surface marker genes. For selecting potential surface markers of early cortical NSCs from our scRNA-seq dataset, we examined and extracted such gene expression patterns and focused on identifying those genes that followed five main criteria: 1) stem cell marker: must be higher expressed in the stem cell populations compared to the intermediate progenitor or neuronal cell populations; 2) cortical identity: must be regionally restricted and highly expressed in those cells with cortical identity (forebrain specific); 3) early marker: must have a clear peak expression in early days followed by a decrease in its expression at later stages; 4) representative: must be expressed in at least 50% of the cells in the target population; 5) surface marker: to be able to conduct fluorescence-activated single cell sorting (FACS) restricts the gene to be expressed in the membrane. However, when analyzing the data, it becomes apparent that it is not straightforward to find a candidate that follows all the criteria. Hence, we shortlisted candidates that followed the above-mentioned criteria to the greatest extent (Figure 7), and from which we were able to obtain commercial antibodies. A total number of 6 candidate genes were selected to be validated: Melanoma Cell Adhesion Molecule (MCAM), Leucine Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5), Cell Migration Inducing Hyaluronidase 2 (CEMIP2), Immunoglobulin Superfamily DCC Subclass Member 3 (IGDCC3), Syndecan 1 (SDC1), and Protogenin (PRTG). Early forebrain NSCs (day 12) show high expression of PRTG, CEMIP2, IGDCC3 and SDC1 compared to other cell states and the later stages, while showing a lower expression of MCAM and LGR5. However, these latter genes show a more specific expression pattern being virtually absent in other cell states and in the other time points. Even though we detect high expression of some markers in mid / hindbrain NSCs on day 12 we need to consider that under our differentiation protocol there is less than 0.5% of cells accounting for this population at that stage. Most importantly, none of the genes show higher expression in pluripotent stem cells (PSC) or neuronal populations. In order to confirm the feasibility of the potential surface markers to isolate early cortical NCSs, we first checked the expression pattern of the candidate markers at a protein level by means of immunostainings at various differentiation stages: day 0, 12, 35 and 50 -accounting for the key distinct stages in our neuralinduction protocol (Figure 8). In general, we observe that even though all markers seem to be expressedat day 12, they do not all follow the expected expression pattern based on the scRNA-seq results. For example, some are already being expressed in undifferentiated cells, such as CEMIP2 and SDC1, which would not allow us to see the appearance of the marker expression by day 12 thus hindering the identification of early cortical NCSs in culture. Other markers like LGR5, as well as CEMPI2, areexpressed in higher levels at day 50 than at day 12 which, in turn, rendering the markers unfavorablefor tracking possible reprogramming events when conducting such experiments. Resulting in MCAM, IGDCC3 and PRTG in the only three surface markers that show a high and specific enrichment in early stages (day 12), being present in early NSCs while being virtually absent in the cellular populations of the other time points of neural induction. However, in the case of IGDCC3 the staining pattern of the marker is the punctate type instead of being expressed in the cell membrane which hinders the possibility of conducting FACS and sorting for such marker. Taken together, these results show the potential of PRTG and MCAM for being markers of early NSC populations in cortical development. To further assess fidelity of both markers in identifying early cortical NSCs in culture, we decided to check their expression in cerebral organoid derived under the same conditions, i.e. Triple-i protocol. In agreement with the expression of these markers in the 2D system, we find an early enrichment of PRTG and MCAM (day 15) compared to a complete absence (day 30) or lower expression (day 50) on later days (Figure 9). Whereas MCAM expression seems less specific on day 12, concomitant expression of these markers is higher in the organoid’s vesicles- which represent an equivalent structure to neuralrosettes - indicative of a higher expression in early cortical NSCs also in 3D cultures.Based on these initial immunostaning results we decided to only continue with, PRTG and MCAM for further characterization, standing out as the most promising surface markers for early cortical NSCs. Additionally, we thought relevant to make use of a publicly available human cortical development dataset to check the expression of these two markers in primary cortical cells (Bhaduri et al., 2020). Upon examination we found both markers being enriched in the early stages of human cortical development.Both PRTG and MCAM are highly expressed in early RG cells, with PRTG more highly co-expressedwith other known early markers such as LIN28A and DLK1 (Figure 10). This analysis led us to have a higher confidence in PRTG and MCAM as promising candidate for early cortical NSC markers.3.3 FACS analysis confirms early expression of PRTG and MCAM following neural inductionOnce we determined the early expression of PRTG and MCAM we had to verify if we can use these surface markers as readout for detecting and isolating early cortical NSCs. To do so, we conducted FACS analysis to check their profile expression over differentiation time (Figure 11). Taking PRTG and MCAM together we see a clear trend of almost undetectable to low expression on uninduced hiPSCs (day 0) followed by a peak expression on day 12 and a slow downregulation of both markers as differentiation progresses (day 35 and day 50). Before neural induction, undifferentiated hiPSCs present very low levels of double positive cells, 1.14% (3.5% on average). By day 12, we detect the highestdouble positive population accounting for 84.1% of the total cell population (89.3% on average) (Figure12). When moving towards day 35 of differentiation, we detect a steep reduction in double positive cells which only account for 8.21% of the total population (10.3% on average). At the latter stage, the number double positive population drops lower than on day 0, being 1.82% (1.87% on average). However, when looking individually at each marker we do see relevant differences in their temporal specificity, whichwas unexpected since we did not detect it in the immunostainings but could be explained by the factthat FACS is more sensitive in detecting fluorescent signal. When examining MCAM individually, we see a higher level of positive populations in day 0, 35 and 50. This could potentially hinder the specific detection of early NSCs if we would base it solely MCAM sorting. However, PRTG follows more closely the pattern seen when being coimmunostained with MCAM, indicating that PRTG is more specific in its temporal expression. 3.4 PRTG enriches for early cortical NSCs The next step was to determine if by using these two surface markers to sortin the neural induced cells, we are in fact isolating early cortical NSCs within our culture. Hence, we assessed the transcriptional signature of the sorted populations at day 12 and at day 35 by means of RNA-Seq. We collected single negative and positive cells for both time points as well as collecting double positive and double negative cells at day 12, in order to potentially increase accuracy in detecting and isolating our population of interest. We also included uninduced hiPSCs to use as an undifferentiated control. Firstly, we assessed intragroup variability by performing a Pearson’s correlation analysis across log10FPKM of the top 2000 highly variable genes (measured using variance of log10 FPKM values across allsamples) to see the extent to which the sorted populations differ or relate (Figure 14). The correlation analysis first confirms a general trend of samples grouping together based on time point which falls in line with the idea of there being different NSCs population- building blocks- at the different stages of differentiation, changing in their transcriptional identity and developing distinct commitment as differentiation progresses. However, day 35 PRTG negative is an exception, sharing a higher correlation with day 12 samples. This could suggest the ability of PRTG to segregate a more advanced and committed subpopulation versus a an ‘‘earlier phenotype’’ population on day 35. Similarly, the PRTG sorted negative subpopulation shares a higher correlation than expected with the undifferentiated hiPSCs (day 0 unsorted), whereas the PRTG positive, the MCAM positive and the MCAM negative subpopulations of day 12 are highly correlated and segregate from the day 0 undifferentiated cells, reflecting expected differences in general transcriptional identity. While such analysis provides a first glimpse into the data it does not give any information about the transcriptional identity of each population so we next analyzed the differences in expression level of highly variable genes marking cell state such as pluripotent or neural stem cells as well as different brain regions (Neocortex, Subpallium, Medial pallium, Diencephalon and Mid / Hindbrain) (Figure 15). At day 12, sorted populations show a quite homogenous identity with the exception of the PRTG negative subpopulation as hinted by the correlation analysis. Commonly they all express high levels ofNSC markers such as FABP7, HES5, NES and SOX2, and telencephalic markers (Neocortex andmedial Pallium). However, the PRTG positive sorted subpopulation- compared to the PRTG negative subpopulation- showed a higher expression level of cortical markers including FOXG1, SP8, LHX2 and SIX3, together with a lower expression of posterior markers such as BARHL1 and GBX2. Also presenting lower expression levels of pluripotency - POU5F1 (OCT4) and NANOG- and neuronalmarkers- DCX, STMN2 and TUBB3. Meaning that by sorting for PRTG expression we are able to purifyour cortical culture by sorting out pluripotent cells and neurons, as well as posterior NSCs which remain in the PRTG negative subpopulation. Unexpectedly, in the early neural induction days, MCAM positive and MCAM negative populations seem to share to a large extent their transcriptional signature meaning that sorting for MCAM at day 12 is insufficient to segregate distinct subpopulations. Hence, when comparing the double sorted populations to the PRTG single sorted they share their general transcriptional identity. Surprisingly, on day 35 we see that only the PRTG negative, but not the positive population, expresses cortical markers indicating a shift in PRTG expression as a readout from cortical identity to non-cortical identity. A clear dichotomy is drawn on day 35, while the PRTG positive subpopulation exclusively expresses posterior markers such as GBX2, IRX3, PAX3 and EN2, the PRTG negative population exclusively expresses telencephalic markers. In summary, while at day 12 PRTG alone efficiently labels NSC populations enriching for cortical NSCs, MCAM does not show a clear segregation of subpopulations based on regional identity. Thus, MCAM does not provide a clear additional enrichment when sorting for both markers concomitantly. Similarlyon day 35, PRTG expression demarcates different transcriptional identities whereas MCAM positive andnegative sorted cells seem to have a very similar transcriptomic signature. These results indicate that MCAM sorting does not provide any additional enrichment beyond the one provided by PRTG sorting, hence we decided to focus on PRTG as the most promising surface marker and continued towards its validation and characterization.3.5 Characterization of PRTG further validates it as an early cortical markerIn order to provide definitive proof of PRTG being an early cortical NSC marker, we conducted a series of downstream analysis after sorting on day 12. We first have a look at our culture of hiPSCs-derived cortical progenitor cells on day 12 (before sorting) and how PRTG expression is distributed (Figure 16). As previously mentioned, at this early time point of neural induction, the culture is very homogenous in cortical NSCs which generate neural rosettes expressing high levels of PAX6 and FOXG1 (Figure 16, B and D). Remarkably, PRTG expression is highly correlated with these structures being almost exclusively expressed at their apical site (lumen) while areas of the same culture that do not form rosettes due to cells not having cortical identity (PAX6 and FOXG1 negative cells) do not possess PRTG expression (Figure 16, A and C). These findings provide further evidence that PRTG is a surface marker for early cortical NSCs. Next, we wanted to validate the FACS method to sort these early cortical NSCs and sort out any otherpossible cell lineages in order to potentially achieve a more homogenous culture. Following stringentgating for sorting on day 12, we collected the negative subpopulation and only the high PRTG positive -accounting for 33.5% of the population (Figure 17A)- and subsequently expanded them in culture under the standard culture conditions until reaching confluency.Before analyzing the identity of the sorted subpopulations, it is important to note the low survival rate ofPRTG negative cells when replating. We notice that when replating both subpopulations at the same high density, only the positive population visibly attaches to the plate already 4h after sorting. This is a result of low cell viability of the PRTG negative subpopulation which is even more noticeable 18h after sorting, with only few cells at attaching to the culture plate (Figure 17B). Although being a factor that hinders the culture of this subpopulation for downstream analysis, in itself is indicative of phenotypic differences between the two sorted populations. Since we know based on the bulk RNA-seq analysis that the PRTG negative population contains pluripotent cells and neurons, a possible explanation is that viability of the sorted subpopulation was affected by the mere sorting technique or due to lack ofappropriate environment. On one hand, differentiated neurons are known to be more susceptible tosorting procedures due to the possible disruption of their projections. On the other hand, reseeding pluripotent cells in neural induction media might prove detrimental for their survival without their standard cellular environment, possibly providing necessary growth factors that should be secreted by neighboring cells. We then dissected the cortical identity by means of immunostainings of the sorted subpopulations. Compared with the PRTG negative subpopulation, FACS-purified PRTG positive cells displayed higherlevels of cortical markers, PAX6 and EMX1 (Figure 18A and 19A, top), while simultaneously showing agreater ability to generate rosettes (Figure 18C and 19C) and displaying lower levels of the neuronal marker DCX (Figure 18A, bottom). Interestingly, at day 18 after replating the positive sorted cells we observe lower levels of PRTG expression remaining in rosettes cells (lumen) (Figure 19A, top right). However, a higher expression level of PRTG is found in non-cortical cells lacking EMX1 expression within the PRTG positive sorted subpopulation (Figure 19A, top right). Moreover, we show that PRTG fluorescence intensity is anticorrelated with the one of EMX1 (Figure 19E), supporting the results that we observe in the bulk RNA-seq data from day 35 where cells that are PRTG positive have a non-cortical identity. Sorted cells at day 12 were also cultured in neuron differentiation medium, for 14 days post FACS, and subsequently stained for FOXG1 and DCX markers. Upon inducing neuronal differentiation of sorted cells, we see a higher differentiation rate in PRTG positive cells exemplified by the higher number of DCX positive cells (Figure 20A, C). This supports the idea of the positive subpopulation being mainly composed of NSCs since they have the plasticity to become neurons when instructed. Also, there seem to be morphological differences among the neurons generated by both subpopulations such as shape and length axonal projection. This could be indicative of distinct neuronal subtypes being generated, although specific neuronal markers would be needed to be sure. Notably, we see comparable high levels of FOXG1 indicating general telencephalic identity (Figure 20A, C). Finally, we also decided to grow the sorted PRTG positive cells (D35 re-sorted) until day 35 and compare them to an unsorted culture. Before sorting, we can appreciate that there are more NSC clusters in the pre-sorted culture (Figure 21A) already indicating higher homogeneity. FACS analysis further shows a shift in PRTG expression levels being lower in the re-sorted population (going from 11.1% PRTG positivecells to 2.18%) (Figure 21B), highlighting an enrichment towards cortical NSCs based on our previousknowledge. Upon further transcriptional analysis of the sorted populations at day 35 by means of RT-qPCR, we see a higher expression of the pan-telencephalic marker OTX2 as well as cortical markers PAX6, FOXG1 and SIX3 in there-sorted PRTG negative cells versus the positive (Figure 21C). Importantly to address is that we detect lower expression levels of these markers when we compare the re-sorted PRTG positive subpopulation with the D35 PRTG positive (unsorted at day 12). However, we find that expression of posterior marker GBX2 is completely absent in the re-sorted culture (both in positive and negative subpopulations at day 35), supporting the idea of higher purity of cortical identity in the culture. Taken together, our results show that sorting for PRTG high positive cells at day 12 allows the prospective isolation of early cortical NSCs while removing unwanted cell lineages, including posterior NSCs, pluripotent, and more differentiated cells, thus increasing the purity of cortical fates in culture.3.6 PRTG expression begins after four days of cortical neural inductionGiven that PRTG expression peaks at day 12, distinguishing a more cortical NSC population, we wereinterested to know at what time point PRTG starts being expressed to better understand if itsappearance correlates with early cell type specification of cortical lineages. In order to address this question, we conducted FACS analysis at various early time points after neural induction. We began by examining the PRTG expression pattern from day 2 to day 10 (here shown 4-6, Figure 22). We see that expression of PRTG starts coming up at day 4, accounting for 16.9% of the total population. By day 5 the PRTG positive cells more than double in numbers becoming a clear PRTG positive subpopulation- being 39.2% of the total population- which keeps increasing by day 6- 56.1% of the total population- and peaks at day 12.3.7 Sorting for PRTG at day 5 enriches for anterior telencephalic identityIn order to investigate whether PRTG expression relates to the first signs of telencephalic specification in our culture, we proceeded to FACS our neural induced cells at day 5. Following stringent gating for sorting on day 5, we took 12.5% accounting for the whole negative subpopulation and we took cells at the 12.6% highest PRTG intensity (Figure 23A). Collected cells were subsequently expanded under the standard culture conditions until reaching confluency, and some were acute fixated a few hours after sorting. Upon replating the cells after sorting, we found impaired cell viability of the PRTG negative cells, very similar to the phenotype seen on day 12 (Figure 23B). Again, this could be explained by the lack of paracrine cell communication being needed for the survival of these cells, hinting to the possiblephenotype of the PRTG negative subpopulation.By sorting for PRTG at this early day of neural induction, we can already see differences in the sorted subpopulations upon replating them and staining them with a set of ectodermal lineage markers. Therefore, indicating that we can isolate distinct subpopulations present in our culture based solely onPRTG expression. Compared with the PRTG negative subpopulation, FACS-purified PRTG positive cells displayed higher levels of the anterior marker OTX2 and lower levels of the posterior marker GBX2 (Figure 24A). Upon comparing both sorted subpopulations with the unsorted population and quantifying OTX2- and GBX2- expressing cells (Figure 24B), we clearly see that GBX2 positive cells present in the unsorted culture are enriched in the negative subpopulation whereas OTX2 positive cells are enriched in the positive subpopulation. These data show that PRTG expression on day 5 identifies those cells undergoing anterior neural plate specification. We next sought to investigate whether we identify segregation of other lineages that are specified in early stages of differentiation within our culture. Thus, we stained day 5 sorted subpopulations with the pan-neural marker SOX2, the dorsal telencephalic marker PAX6, and the TFAP2A marker which is highly expressed in neural crest and non-neural ectoderm. Again, we see a mixed population in the unsorted culture comprised by cells expressing all three markers, being SOX2 and PAX6 more prominent as expected. FACS-purified PRTG positive cells show equally high levels of SOX2 and PAX6positive cells but almost complete lack of TFAP2A positive cells. Oppositely, all cells found in the PRTGnegative subpopulation are triple positive, compatible with cranial placode identity (Figure 25). These results indicate that based on PRTG expression we are able to segregate neural ectoderm from placodal ectoderm, additionally purifying our culture from unwanted lineages. Taken together, these immunostainings suggest that PRTG expression within early stages of neural induction marks those cells that have been already specified to anterior neural ectoderm. Therefore, FACS-purification of PRTG positive cells allows for an enrichment of anterior CNS identity providing a more homogeneous culture. Following 10 days in culture, after replating the cells and allowing them to grow under the standard neural induction media, we can immediately observe morphological differences between populations. The most striking one is the ability of the PRTG positive subpopulation to generate rosettes compared to the unsorted population. As seen in Figure 26, the faster appearance of rosettes in the PRTG positive cells culture is either indicative of an accelerated or more efficient neural induction, which could be explain by having a more homogenous cortical NSC identity within the culture. To further confirm cell identity, we stained for cortical markers together with PRTG. Not surprisingly, we find a higher PRTG intensity in the positive subpopulation which beautifully marks the apical site of rosettes. Clusters of cells co-expressing PAX6 and FOXG1, mainly in rosette structures, were observedin both cultures. However, while unsorted cells are known to generate rosettes, immunostaining ofunsorted and PRTG positive cells show heterogeneity within forebrain identity. Our results show that sorting for PRTG high positive cells enriches for a more homogeneous cortical identity shown by the higher PAX6 and FOXG1 expression correlating with radial organization (rosettes) (Figure 27).3.8 PRTG demarcates early specification of anterior identity and prospectively isolatesdistinct telencephalic subpopulations Given that PRTG expression clearly defines distinct lineages within our culture, we wanted to further characterize the sorted population in order address whether we can prospectively isolate our population of interest. Hence, three subpopulations were sorted at day 5, including the PRTG negative, the PRTG high positive, and the PRTG low positive (referred as middle subpopulation). We thought it would be interesting to also sort the middle population to decipher if it represents a transition state from negative to positive, a mixed population or simply a completely different third subpopulation. Stringent gating was performed in order to avoid contamination of subpopulations. For the PRTG high positive cells at 24.1% of the highest fluorescent intensity were sorted. Each population was collected for scRNA-seq after sorting. Simultaneously, sorted cells were replated into wells for further culture under standard conditions, and collected on day 10 for scRNA-seq. For each day, 5 and 10, we integrated the three subpopulations- positive (P), middle (M) and negative (N)- and we clustered the cells based on the expression of well-known marker genes as previously done. On day 5, we observe three main clusters based on cell identity: i) early NSCs marked by expression the of SOX2, NES and GLI3, among others; ii) PSCs mainly marked by POU5F1 (OCT4), and high SOX2 and IRX2; iii) early neurons expressing STMN2 and DCX (Figure 29C). These three clusters are formed by cells coming from the three sorted populations discarding a clear enrichment of lineages. However, there are differences in proportions making the positive population the most homogeneous one among them, and being the negative the most heterogenous. A total of 93% of cells in the positive-sorted population are early NSCs while in the negative-sorted they only account for 88% of the total population. Only 6% and 1% of the cells in the positive-sorted population is assigned to PSCs and neurons, respectively (Figure 29B), whereas the negative population contains 11% of PSCs. In between, we find the middle population which is very similar to the high positive population, seemingly transitioning towards it. As already mentioned, this early stage is characterized by high cell homogeneity given that 91.1% of the total amount cells are early NSCs. However, we detect some signs of regional specification such as the specific expression of PAX6 (and RSPO2) in the positive population (Figure 29C), in agreement withwhat we have previously observed in our immunostainings.In order to gain a better insight into the transcriptional identity of these early NSCs and to address whether we can detect early specification based on PRTG expression, we conducted differential gene expression analysis on pairwise comparisons of the different early NSCs populations i.e., P5 versus N5 (Figure 30A), P5 versus M5 (Figure 30B), and M5 versus N5 (Figure 30C). As expected, PRTG is enriched in the positive population compared to the middle and the negative, being also highly expressed in the middle. A striking difference is the expression exclusive expression of CDH1 (E-cadherin) in the negative population versus CDH2 (N-cadherin) in the positive and middle. It is known that during neural induction cells of the neural tube loose CDH1 and acquire CDH2, hinting at the progression from PRTG negative neuroectodermal cells towards PRTG positive radial glia cells. Radial glia identity is also characterized by the expression of VIM and PAX6 which are enriched in the positive and middle populations. Additionally, already as indicated with the enriched PAX6 expression in the PRTG positive and middle population, we detect the enrichment of other forebrain markers- FEZF1, LRP2, RSPO2 and SOX5- in these two populations highlighting their early specification towards forebrain identity. However, at this stage we are not able to detect FOXG1 expression yet. Beyond the differential expression of marker genes, we also see high variability in signaling molecules such as WNT5B and guidance molecules like SEMA3A which can contribute to specification of regional identity. While WNT5B has been reported to be specifically expressed in the neocortex together withother WNTs, SEMA3A is also expressed in the developing neocortex, specifically in the upper layers.Interestingly, both molecules are highly differentially expressed in a gradual manner, from positive highto middle low and absent in the negative population.This analysis reveals that expression of PRTG at day 5 (P5 and M5) demarcates those cells that have already transitioned from neuroectoderm (N5) to radial glial cells (P5, and to lesser extent M5) and that have acquired an early regional identity towards forebrain lineages (P5, and to lesser extent M5). When analyzing day 10, we observe six distinct clusters based on cell identity: i) Telencephalic NSCs marked by the expression of SOX2, NES and GLI3, among others; ii) Mid / Hindbrain NSCs mainly expressing IRX2; iii) PSCs mainly marked by POU5F1 (OCT4), and high SOX2 and IRX2; iv) early neurons expressing STMN2 and DCX; v) Cortical Hem cells specifically expressing WNT2B; vi) Neural crest marked by the expression of TTR (Figure 31C). At this stage, there is increased heterogeneity but it is important to point out that the middle and the positive populations are more homogenous than the negative. While the negative population only contains 84.3% of telencephalic NSCs, the positive contains 97% and the middle contains 98.5%. Remarkably, the middle population and the positive population lacks cells assigned to cortical hem or PSC identity. Additionally, the middle population lacks cells with neural crest identity (Figure 31B). These observations indicate that cultures derived from PRTG expressing cells on day 5 become purer in telencephalic lineages. We were surprised to discover that even the PRTG negative-derived population acquires PRTG expression by day 10 (Figure 31C). However, it remains higher in the positive and middle populations (Figure 31A and C). At this stage, we are able to detect FOXG1 expression in all three populations.Interestingly, we also detect higher expression of PAX6 in the positive population, reminiscent of day 5expression pattern (Figure 31C), which also presents specific expression of C1orf61 which marks a subset of early cortical progenitors in the developing brain (Figure 32D). As we did for day 5, in order to gain a better insight into the transcriptional identity of thesesubpopulations, we conducted differential gene expression analysis on pairwise comparisons of thedifferent telencephalic NSCs populations i.e., P10 versus N10 (Figure 32A), P10 versus M10 (Figure 32B), and M10 versus N10 (Figure 32C). This analysis allows us to identify unique expression patterns associated with cortical areal specification. On one hand, within the positive population we find high expression of NR2F1 and EMX2 together withPAX6 indicating dorso-medial identity (Figure 32A and B). On the other hand, in the middle populationwe find high expression of SP8 and SOX6, known to be expressed in a slight dorsal-high ventral-lowgradient. Combined with higher expression of FZD5 and SEMA5A assigns the middle population to arostro-dorsal identity (Figure 32B and C). Finally, the negative population seems to represent the rostro-ventral cortical identity marked by its unique expression of the ventral marker NKX2-1 together with anterior rostral marker SIX3. This is further supported by the higher expression of FZD8 which is known to be expressed ventrally in the telencephalon (Figure 32A and C).To conclude, our results show that sorting for PRTG at early stages allows to prospectively isolatedistinct cortical fates increasing the homogeneity in our culture. We report that within the telencephalon, we are able to derive highly pure NSCs corresponding to rostro-dorsal, dorso-medial and rostro-ventral cortical areas based on PRTG expression levels.4. DISCUSSIONStem cell-derived neural cultures hold great promise as a tool for functional studies to understand invivo cortical brain development. Even more importantly, the development of methods to reprogram adult somatic cells to generate pluripotent cells (Takahashi et al., 2007 -human; Yu et al., 2007) makespossible to generate patient-derived hiPSCs that provide the platform for in vitro disease modelling anddrug discovery, as well as therapeutic advents to tackle a wide range of neurological diseases (Park et al., 2008, Lindvall et al., 2020. In the past years, research on stem cells has expanded greatly and there have been numerous efforts in order to optimize protocols for the generation and differentiation of cortical progenitors and their neuronal derivates (Shi, Kirwan et al., 2012; Shi, Y., Kirwan, P., Smith, J., Robinson, H.P. & Livesey, et al.2012; Bible et al, 2004; Hansen et al., 2011; Ying, Stavridis, et al.,2003; Hu and Zhang, 2010; Saurat et al., 2016; Mariani et al.,2012). During mammalian corticogenesis, a wide diversity of NSCs orchestrate the development and the organization of the cortex. Initially, there is the expansion of the NSC pool through proliferative symmetric divisions, and later through differentiative asymmetric divisions they give rise to the diverse cell populations that reside within the cortical layers. Throughout this process, NSCs undergo extensive modifications in their transcriptomic profile and chromatin landscape contributing to the formation of heterogeneous progenitor populations. These NSC subtypes are more restricted in their differentiationcapacity, and thus more limited in the types of neurons they can generate. In our lab, such NSCpopulations were derived and studied to dissect the differentiation process from neuroepithelial cellstowards the diverse cortical cell types, recapitulating in vivo development (Ziller et al., 2015; Edri et al.,2015). Such studies provided the first glimpse into cell-fate decisions and specification during theontogeny of in vitro derived cortical neural stem cells. However, the regulatory mechanisms thatorchestrate the stage-specific differentiation process remain poorly understood. More recently, efforts to study the development and function of the human cerebral cortex in health and disease have promoted the establishment and optimization of multiple protocols, especially involving3D systems, for better mimicking in vivo development (Lancaster et al., 2014; Camp et al., 2015; Pascaet al., 2015; Quadrato et al., 2017; Eiraku et al., 2008; Velasco et al., 2019). Additionally, an improved in vitro model has been established by the lab relying on Triple-inhibition (dual SMAD-i and WNT-i) topromote cortical fates in a higher yield (Rosebrock et al., 2022). However, given the array of highdiversity of neuronal cell types being generated during cortical development, one of the biggest challenges in neural differentiation is to reliably generate specific neuronal cell types which is a prerequisite for cell-based therapeutical approaches. Thus, differentiation protocols are continuously being developed and improved to work towards high pure cortical NSC cultures with a specific and limited differentiation potential. One key aspect to achieve this is to understand the variability in NSC populations during cortical development and the mechanisms driving the transition through these different NSC subtypes. This knowledge will allow to generate a homogeneous and unlimited culture of the desired early-onset NSC subtype (‘the founder’ NSC population). To this end, the main aim of this project was to develop a strategy to isolate the early cortical NSC population, derived under our differentiation paradigm, for its characterization and potential manipulation in vitro. Since prospective methods for identifying and isolating NSCs have been developed over the pastseveral years based on cell-surface antigen-based selection (Panchision et al., 2017), we thought thiswould be the best strategy to follow. This method of enrichment allows prospective isolation of NSCsand provides a valuable tool to purify neural subpopulations under defined conditions from embryonictissue and in vitro cultures. For example, there are several pan surface markers that identify NSCs, suchas Prominin-1 (CD133) (Uchida et al.,2000; Shwartz et al., 2003), NCAM (CD56) (Butenschön et al.,2016) and NGFR (CD271) (Vishwakarma et al., 2014). However, no specific surface markers haveemerged for identifying cortical NSCs. Hence, our primary goal was to find a surface marker whichpositively identifies the early cortical NSCs in our culture. To do so, we first derived cortical NSC from hiPSCs under our Triple-i protocol and propagated them long-term (until day 50). We collected the early- stage NSCs (day 12), mid-stage NSCs (day 35) and late-stage NSCs (day 50) by specifically pickingthe rosette structures on every stage and conducted scRNA-seq. In alignment with the previous studiesfrom our lab (Ziller et al., 2015; Edri et al., 2015) and mimicking in vivo development, we identify stage-and cell state-specific genes which exhibit differential expression patterns in the diverse cell types across the progression of neural induction. From this dataset we analyzed the highest differentiallyexpressed genes in early NSCs compared to late NSCs, and we initially identify 6 potential candidatesfor early cortical NSCs that followed five main criteria: 1) being a stem cell marker; 2) having cortical identity; 3) being an early marker; 4) being representative of the population; and 5) being expressed in the cell membrane to be able to conduct FACS. After initial immunostaining analysis we show that only two markers, PRTG and MCAM, are specifically enriched in early NSCs. In line with these observations,we also show their enrichment in early cerebral organoids compared to late-stage organoids, derivedunder the same conditions. Additionally, upon examining a publicly available dataset containing primary human cortical samples from embryonic development, we find both markers being enriched in the early stages of human cortical development (pcw 6), predominantly in early cortical RG cells (Bhaduri et al., 2020). While the above findings support the potential of both markers being used to isolate early NSC populations in cortical development, there is no studies reporting a specific expression of these markers in cortical NSCs. Remarkably, there is published evidence that PRTG is expressed in early CNS development, but there is no literature that connects MCAM expression to any NSC population. On one hand, PRTG is a cell adhesion molecule, part of the immunoglobulin superfamily, that was first identified during embryonic development in chick (Toyoda et al., 2005) and soon after in mouse (Vesque et al., 2006). One of the more recent studies reports that expression of PRTG emerges during mouse development in the neural tube by day E7.75, being strong until day E9.5 and starting to decrease after E10.5. Co-expression of PRTG together with Sox2 during E7.5–E10.5 in mouse embryos confirms expression of PRTG in early neural progenitors (Wong et al., 2010). This sharp downregulation thatPRTG undergoes during mouse embryonic neurogenesis falls in line with our results that show an earlyand transitional stage of PRTG expression during neural differentiation. However, there are no studies that provide any evidence of PRTG demarcating cortical lineages.On the other hand, MCAM, also known as CD146, was originally identified as an endothelial cell markerwith a role in cell-matrix interaction and angiogenesis, and highly expressed in many tumors andmesenchymal cells (Lehmann, 1987). Multiple studies identify and demonstrate that MCAM defines asubpopulation of mesenchymal stem cells (MSCs) that are capable of bone formation and in vivo trans-endothelial migration (Harkness et al., 2015). Also, it has been reported that high expression of MCAMcan be used to detect a specific subpopulation of self-renewing MSCs from the bone marrow (Sacchetti et al., 2007) and from the placenta (Ulrich et al., 2015). Higher MCAM expression in these cellscorrelates with their robust osteogenic differentiation potential (Tormin et al., 2011). However, in theneural context, the only reported evidence connecting MCAM to the CNS is in neural stem cell vascular niche regulation. It has been shown that MCAM is expressed in endothelial cells composing the SVZniche, and that physical binding between neural matriptase expressed in NSCs and MCAM induces asignaling cascade that regulates NSC behavior (Tung et al., 2017). Based on the above-described studies, there is some evidence to further support the idea that both PRTG and MCAM are potential markers for progenitor cells. However, discrepancies appear upon further assessing the fidelity of both markers by means of FACS and subsequent RNA-seq of the sortedsubpopulations in our culture. We discover that MCAM does not show a clear segregation ofsubpopulations based on regional identity, while sorting for PRTG expression alone efficiently enriches for cortical NSCs since pluripotent cells, neurons, and posterior NSCs remain in the PRTG negative subpopulation. Remarkably, on day 35, PRTG expression clearly demarcates non-cortical identity instead of cortical fates. This shift in PRTG expression falls in line with the fact that on day 35 only about10% of the total population is PRTG positive, since our protocol promotes cortical fates at expenses ofnon-cortical fates. Considering these results, we moved forward with PRTG as the most promising surface marker. To further validate PRTG we characterized the day 12 sorted subpopulations by means of immunostainings. While both subpopulations show similarly high levels of FOXG1 expression, FACS- purified PRTG positive cells display higher levels of cortical markers, PAX6 and EMX1. The higher expression correlates with enhanced radial organization while and displaying lower levels of the neuronal marker DCX. Thus, indicating differences in regional identity within telencephalic fates. Interestingly, we also observe that PRTG expression at day 18 is already reduced. While low expression remains in rosette cells, a higher expression level of PRTG is found in non-cortical cells that lack EMX1 expression. Again, supporting the idea that the remaining expression of PRTG on later days will eventually be marking non-cortical cells in culture. Finally, when terminally differentiating both sorted subpopulations, we find that PRTG positive cells are more prone to differentiate into neurons as indicated by the higher number of DCX positive cells. These results further support the idea that the positive subpopulation is mainly composed of NSCs since they have more plasticity and differentiation potential to become neurons.Finally, we also decided to grow the sorted PRTG positive cells and re-sort them on day 35. Whencomparing them to an unsorted culture, we see a downregulation in PRTG expression going from 11.1% of total positive cells (control) to 2.18% in the re-sorted population. Based on our previous knowledge, this indicates an enrichment towards cortical identity when pre-sorting on day 12. This is confirmed by RT-qPCR analysis of the sorted populations. We show the high expression of anterior telencephalic markers such as OTX2, PAX6, FOXG1 and SIX3 and complete absence of posterior marker GBX2 in the re-sorted populations. In summary, we show evidence that sorting for PRTG high positive cells at day 12 allows for the prospective isolation of early cortical NSCs while excluding unwanted lineages such as posterior NSCs. Next, we investigated whether the emergence of PRTG in culture correlates with the specification of telencephalic lineages during early neural induction. First, we identify that the earliest prominent PRTG positive population appears after 5 days of neural induction, and that its expression demarcates a distinct population. FACS-purified PRTG positive cells at day 5 display higher levels of the anterior marker OTX2 and lower levels of the posterior marker GBX2, as well as lower levels of neural crest / placodal marker TFAP2A (Dincer et al., 2013) compared to the negative subpopulation. This initial immunostaining analysis of the sorted populations show clear differences indicating PRTG’s ability in segregating anterior neural ectodermal cells from other lineages such as placodal ectodermal cells. Finally, by using scRNA-seq we further provide evidence that the establishment of cortical NSC identityin culture can be detected by the emergence of high PRTG expression as early as day 5. Furthermore,the analysis of re-plated cells grown until day 10, shows unique expression patterns of each subpopulation associated with cortical areal specification. We report that sorting for PRTG expression at early stages allows to prospectively isolate distinct cortical identities within the telencephalon in a highly homogenous manner. In this study, we did not address the functional role of PRTG since it was not relevant for our aim. However, we believe that it would be interesting to examine its potential role in telencephalic development since, in view of our results, it is not unreasonable to think that PRTG could be implicatedin the initial specification of cortical identity and arealization. To date, there is little information about thebiological function of PRTG. One study has reported that PRTG might act as a cellular receptor by interacting with DNAJB11 (also known as ERdj3). By extrapolating experimental results that they obtained from in vitro cultures and chick models, they propose that DNAJB11 / PRTG signaling might play a role in maintaining the stemness potential of neural progenitors and suppressing premature neuronal differentiation during development (Wong et al., 2010). Even though the exact mechanism by which PRTG exercise its role is not clear, it is not surprising that it can act as a receptor since it has been previously demonstrated that cell adhesion molecules can function as signaling receptors, as is the case of NCAM (Paratcha et al., 2003). Moreover, recent studies report that mutations in the PRTG gene are linked to disease that arise from cortical developmental abnormalities such as autism (Chenet al., 2022) and attention deficit / hyperactivity disorder (Wigg et al, 2008), proposing a key role of PRTGduring cortical development.To conclude, in this study a novel surface marker for early human cortical NSCs has been identified.The results presented herein provide proof that PRTG can be used as a marker to cell sort and enrich for specific cortical progenitors in culture. This knowledge opens the possibility to generate more homogenous cultures of cortical NSCs derived from hiPSCs that can be used for potential therapeutic approaches. Additionally, this knowledge can be used for developing a screening platform to unravel regulatory mechanisms driving the transition throughout the cortical NSC stages (Figure 33). Moreover, PRTG can be used as a readout in a FACS-based screening platform to identify and isolate early cortical NSCs upon perturbation. For example, the differentiation paradigm may be perturbed at different stages with a TF lentiviral library. PRTG would then be used in order to detect and isolate those cells that maintain or achieve an early cortical NSC identity upon overexpression of a specific TF. Sorted cells would then be analyzed by means of DNA-sequencing to identify the integrated TF responsible for the effect, and by means of RNA-sequencing to corroborate the early cortical NSC identity. Such strategy would allow us to identify TFs involved in the establishment of early cortical NSCs and possibly TFs that regulate the transition towards other NSC stages. We believe that such knowledge would provide the tools to manipulate and generate highly homogeneous stage- and region-specific NSCs which could eventually be derived from patient samples providing a reliable source for cell replacement therapies.5. REFERENCESAcampora, D., Barone, P., & Simeone, A. (1999). Otx genes in corticogenesis and brain development. Cereb Cortex, 9(6), 533-542. https: / / doi.org / 10.1093 / cercor 79.6.533 Acampora, D., Mazan, S., Lallemand, Y., Avantaggiato, V., Maury, M., Simeone, A., & Brulet, P. (1995). Forebrain and midbrain regions are deleted in Otx2- / - mutants due to a defective anterior neuroectoderm specification during gastrulation. Development, 121(10), 3279-3290. https: / / doi.org / 10.1242 / dev. 121.10.3279 Adesnik, H., & Naka, A. (2018). Cracking the Function of Layers in the Sensory Cortex. Neuron, 100(6), 1028-1043. https: / / doi.Org / 10.1016 / i.neuron.2018.10.032 Aoto, K., Nishimura, T., Eto, K., & Motoyama, J. (2002). Mouse GLI3 regulates Fgf8 expression and apoptosis in the developing neural tube, face, and limb bud. Dev Biol, 251(2), 320-332. https: / / doi.org / 10.1006 / dbio.2002.Q811 Appolloni, I., Calzolari, F., Corte, G., Perris, R., & Malatesta, P. (2008). Six3 controls the neural progenitor status in the murine CNS. Cereb Cortex, 18(3), 553-562. https: / / doi.org / 10.1093 / cercor / bhm092 Azim, E., Jabaudon, D., Fame, R. M., & Macklis, J. D. (2009). SOX6 controls dorsal progenitor identity and interneuron diversity during neocortical development. Nat Neurosci, 12(10), 1238-1247. https: / / doi.org / 10.1038 / nn.2387 Baker, J. C., Beddington, R. S., & Harland, R. M. (1999). Wnt signaling in Xenopus embryos inhibits bmp4 expression and activates neural development. Genes Dev, 13(23), 3149-3159. https: / / doi.org / 10.1101 / gad.13.23.3149 Bhaduri, A., Andrews, M. G., Mancia Leon, W., Jung, D., Shin, D., Allen, D., Jung, D., Schmunk, G., Haeussler, M., Salma, J., Pollen, A. A., Nowakowski, T. J., & Kriegstein, A. R. (2020). Cell stress incortical organoids impairs molecular subtype specification. Nature, 578(7793), 142-148.https: / / doi.org / 10.1038 / s41586-02Q-1962-0 Bibel, M., Richter, J., Schrenk, K., Tucker, K. L., Staiger, V., Körte, M., Goetz, M., & Barde, Y. A. (2004). Differentiation of mouse embryonic stem cells into a defined neuronal lineage. Nat Neurosci, 7(9), 1003- 1009. https: / / doi.org / 10.1038 / nnl3Ql Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(16), 2114-2120. https: / / doi.org / 10.1093 / bioinformatics / btu!70 Bush, G. (2011). Cingulate, frontal, and parietal cortical dysfunction in attentiondeficit / hyperactivity disorder. Biol Psychiatry, 69(12), 1160-1167. https: / / doi.Org / 10.1016 / i.biopsvch.2011.01.022 Butenschon, J., Zimmermann, T., Schmarowski, N., Nitsch, R., Fackelmeier, B., Friedemann, K., Radyushkin, K., Baumgart, J., Lutz, B., & Leschik, J. (2016). PSA-NCAM positive neural progenitorsstably expressing BDNF promote functional recovery in a mouse model of spinal cord injury. Stem CellRes Ther, 7,; 11. https: / / doi.org / 10.1186 / sl3287-015-Q268-x Butt, S. J., Sousa, V. H., Fuccillo, M. V., Hjerling-Leffler, J., Miyoshi, G., Kimura, S., & Fishell, G. (2008). The requirement of Nkx2-1 in the temporal specification of cortical interneuron subtypes. Neuron, 59(5), 722-732. https: / / doi.org / 10.1016 / i .neuron.2008.07.031 Cadwell, C. R., Bhaduri, A., Mostajo-Radji, M. A., Keefe, M. G., & Nowakowski, T. J. (2019). Development and Arealization of the Cerebral Cortex. Neuron, 103(6), 980-1004. https: / / doi.Org / 10.1016 / i.neuron.2019.07.009 Camp, J. G., Badsha, F., Florio, M., Kanton, S., Gerber, T., Wilsch-Brauninger, M., Lewitus, E., Sykes,A., Hevers, W., Lancaster, M., Knoblich, J. A., Lachmann, R., Paabo, S., Hüttner, W. B., & Treutlein, B.(2015). Human cerebral organoids recapitulate gene expression programs of fetal neocortex development. Proc Natl Acad Sei USA, 112(51), 15672-15677. https: / / doi.org / 10.1073 / pnas. 1520760112 Camus, A., & Tam, P. P. (1999). The organizer of the gastrulating mouse embryo. Curr Top Dev Biol,45,, 117-153. https: / / doi.org / 10.1016 / sQ070-2153f08l60315-4Carulli, D., de Winter, F., & Verhaagen, J. (2021). Semaphorins in Adult Nervous System Plasticity and Disease. Front Synaptic Neurosci, 13, 672891. https: / / doi.org / 10.3389 / fnsvn.2021.672891 Chambers, S. M., Fasano, C. A., Papapetrou, E. P., Tomishima, M., Sadelain, M., & Studer, L. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol, 27(3), 275-280. https: / / doi.org / 10.1038 / nbt.1529 Chang, E., Ruan, X., Zhu, R., Wang, Y., & Zhang, J. (2020). Values of Single-Cell RNA Sequencing in Development of Cerebral Cortex. Adv Exp Med Biol, 1255, 231-247. https: / / doi.org / 10.10Q7 / 978-981- 15-4494-l 19 Charron, F., & Tessier-Lavigne, M. (2005). Novel brain wiring functions for classical morphogens: a role as graded positional cues in axon guidance. Development, 132( 10), 2251-2262. https: / / doi.org / 10.1242 / dev.01830 Chen, G., Sima, J., Jin, M., Wang, K. Y., Xue, X. J., Zheng, W., Ding, Y. Q., k Yuan, X. B. (2008). Semaphorin-3A guides radial migration of cortical neurons during development. Nat Neurosci, 11(1), 36-44. https: / / doi.org / 10.1038 / nn2018 Chen, S., Xiong, J., Chen, B., Zhang, C., Deng, X., He, F., Yang, L., Chen, C., Peng, J., & Yin, F. (2022). Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical andgenetic profile of a pediatric cohort. Clin Chim Acta, 524, 179-186.https: / / doi.Org / 10.1016 / i.cca.2021.ll.014 Cheung, A. F., Pollen, A. A., Tavare, A., DeProto, J., k Molnar, Z. (2007). Comparative aspects of cortical neurogenesis in vertebrates. J Anat, 211(2), 164-176. https: / / doi.Org / 10.llll / i.1469-7580.2007.00769.x Copp, A. J., Stanier, P., k Greene, N. D. (2013). Neural tube defects: recent advances, unsolved questions, and controversies. Lancet Neurol., 12(8), 799-810. https: / / doi.org / 10.1016 / S1474- 4422fl3l70110-8 Corbin, J. G., Gaiano, N., Machold, R. P., Langston, A., k Fishell, G. (2000). The Gsh2 homeodomain gene controls multiple aspects of telencephalic development. Development, 127(23), 5007-5020. https: / / doi.org / 10.1242 / dev.127.23.5007 Costamagna, G., Comi, G. P., k Corti, S. (2021). Advancing Drug Discovery for Neurological Disorders Using iPSC-Derived Neural Organoids. Int J Mol Sei, 22(5). https: / / doi.org / 10.3390 / iims22Q52659 Crossley, P. H., Martinez, S., Ohkubo, Y., k Rubenstein, J. L. (2001). Coordinate expression of Fgf8, Otx2, Bmp4, and Shh in the rostral prosencephalon during development of the telencephalic and optic vesicles. Neuroscience, 108(2), 183-206. https: / / doi.org / 10.1016 / s0306-4522f01100411-0 Danesin, C., Peres, J. N., Johansson, M., Snowden, V., Cording, A., Papalopulu, N., k Houart, C. (2009). Integration of telencephalic Wnt and hedgehog signaling center activities by Foxgl. Dev Cell, 16(4), 576-587. https: / / doi.Org / 10.1016 / i.devcel.2009.03.007 Darmanis, S., Sloan, S. A., Zhang, Y., Enge, M., Caneda, C., Shuer, L. M., Hayden Gephart, M. G., Barres, B. A., & Quake, S. R. (2015). A survey of human brain transcriptome diversity at the single celllevel. Proc Natl Acad Sei USA, 112(23), 7285-7290. https: / / doi.org / 10.1073 / pnas.1507125112Dincer, Z., Piao, J., Niu, L., Ganat, Y., Kriks, S., Zimmer, B., Shi, S. H., Tabar, V., k Studer, L. (2013). Specification of functional cranial placode derivatives from human pluripotent stem cells. Cell Rep, 5(5), 1387-1402. https: / / doi.org / 10.1016 / i .celrep.2013.10.048 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., kGingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29(1), 15-21. https: / / doi.org / 10.1093 / bioinformatics / bts635 Edri, R., Yaffe, Y., Ziller, M. J., Mutukula, N., Volkman, R., David, E., Jacob-Hirsch, J., Malcov, H., Levy, C., Rechavi, G., Gat-Viks, L, Meissner, A., k Elkabetz, Y. (2015). Analysing human neural stem cell ontogeny by consecutive isolation of Notch active neural progenitors. Nat Commun, 6, 6500. https: / / doi.org / 10.1038 / ncomms7500 Eiraku, M., Watanabe, K., Matsuo-Takasaki, M., Kawada, M., Yonemura, S., Matsumura, M., Wataya, T., Nishiyama, A., Muguruma, K., k Sasai, Y. (2008). Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell, 3(5), 519-532. https: / / doi.org / 10.1016 / i .stem.2008.09.002 Elkabetz, Y., Panagiotakos, G., AI Shamy, G., Socci, N. D., Tabar, V., k Studer, L. (2008). Human ES cell-derived neural rosettes reveal a functionally distinct early neural stem cell stage. Genes Dev, 22(2), 152-165. https: / / doi.org / 10.1101 / gad.1616208 Feng, H., Moakley, D. F., Chen, S., McKenzie, M. G., Menon, V., k Zhang, C. (2021). Complexity and graded regulation of neuronal cell-type-specific alternative splicing revealed by single-cell RNA sequencing. Proc Natl Acad Sei USA, 118( 10). https: / / doi.org / 10.1073 / pnas.2013056118 Fischer, T., Guimera, J., Wurst, W., & Prakash, N. (2007). Distinct but redundant expression of theFrizzled Wnt receptor genes at signaling centers of the developing mouse brain. Neuroscience, 147(3),693-711. https: / / doi.org / 10.1016 / i .neuroscience.2007.04.060 Gaspard, N., Bouschet, T., Hourez, R., Dimidschstein, J., Naeije, G., van den Ameele, J., Espuny- Camacho, I., Herpoel, A., Passante, L., Schiffmann, S. N., Gaillard, A., k Vanderhaeghen, P. (2008). An intrinsic mechanism of corticogenesis from embryonic stem cells. Nature, 455(7211), 351-357. https: / / doi.org / 10.1038 / nature07287 Georgala, P. A., Carr, C. B., & Price, D. J. (2011). The role of Pax6 in forebrain development. DevNeurobiol, 71(8), 690-709. https: / / doi.org / 10.1002 / dneu.20895 Gilbert SF. (2000) Developmental Biology.6th edition. Sunderland (MA): Sinauer Associates. Available from: https: / / www.ncbi.nlm.nih.gov / books / NBK9983 / Greig, L. C., Woodworth, M. B., Galazo, M. J., Padmanabhan, H., k Macklis, J. D. (2013). Molecular logic of neocortical projection neuron specification, development and diversity. Nat Rev Neurosci, 14(11), 755-769. https: / / doi.org / 10.1038 / nrn3586 Grove, E. A., Tole, S., Limon, J., Yip, L., k Ragsdale, C. W. (1998). The hem of the embryonic cerebral cortex is defined by the expression of multiple Wnt genes and is compromised in Gli3-deficient mice. Development, 125(12), 2315-2325. https: / / doi.org / 10.1242 / dev.125.12.2315 Gunhaga, L., Marklund, M., Sjodal, M., Hsieh, J. C., Jessell, T. M., k Edlund, T. (2003). Specification of dorsal telencephalic character by sequential Wnt and FGF signaling. Nat Neurosci, 6(7), 701-707. https: / / doi.org / 10.1038 / nnlQ68 Hansen, D. V., Rubenstein, J. L., k Kriegstein, A. R. (2011). Deriving excitatory neurons of the neocortexfrom pluripotent stem cells. Neuron, 70(A), 645-660. https: / / doi.Org / 10.1016 / i.neuron.2011.05.006Harkness, L., Zäher, W., Ditzel, N., Isa, A., k Kassem, M. (2016). CD146 / MCAM defines functionality of human bone marrow stromal stem cell populations. Stem Cell Res Tber, 7, 4. https: / / doi.org / 10.1186 / sl3287-015-0266-z Harrison-Uy, S. J., k Pleasure, S. J. (2012). Wnt signaling and forebrain development. Cold Spring HarbPerspect Biol, 4(7), a008094. https: / / doi.org / 10.1101 / cshperspect.a008094Haubst, N., Berger, J., Radjendirane, V., Graw, J., Favor, J., Saunders, G. F., Stoykova, A., k Gotz, M. (2004). Molecular dissection of Pax6 function: the specific roles of the paired domain and homeodomain in brain development. Development, 131(24), 6131-6140. https: / / doi.org / 10.1242 / dev.01524 Hebert, J. M., & Fishell, G. (2008). The genetics of early telencephalon patterning: some assembly required. Nat Rev Neurosci, 5(9), 678-685. https: / / doi.org / 10.1038 / nrn2463 Hedlund, E., & Deng, Q. (2018). Single-cell RNA sequencing: Technical advancements and biological applications. Mol Aspects Med, 59, 36-46. https: / / doi.org / 10.1016 / i .mam.2017.07.003 Hemmati-Brivanlou, A., Kelly, O. G., & Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neutralizing activity. Cell, 77(2), 283-295. https: / / doi.org / 10.1016 / 0092-8674f94)90320-4 Hettige, N. C., Peng, H., Wu, H., Zhang, X., Yerko, V., Zhang, Y., Jefri, M., Soubannier, V., Maussion, G., Alsuwaidi, S., Ni, A., Rocha, C., Krishnan, J., McCarty, V., Antonyan, L., Schuppert, A., Turecki, G., Fon, E. A., Durcan, T. M., & Ernst, C. (2022). FOXG1 dose tunes cell proliferation dynamics in humanforebrain progenitor cells. Stem Cell Reports, 17(3), 475-488.https: / / doi.Org / 10.1016 / i.stemcr.2022.01.010 Hoerder-Suabedissen, A., & Molnar, Z. (2015). Development, evolution and pathology of neocorticalsubplate neurons. Nat Rev Neurosci, 76(3), 133-146. https: / / doi.org / 10.1038 / nrn3915Holm, P. C., Mader, M. T., Haubst, N., Wizenmann, A., Sigvardsson, M., & Gotz, M. (2007). Loss- and gain-of-function analyses reveal targets of Pax6 in the developing mouse telencephalon. Mol Cell Neurosci, 34(1), 99-119. https: / / doi.org / 10.1016 / i .men.2006.10.008 Hu, B. Y., & Zhang, S. C. (2010). Directed differentiation of neural-stem cells and subtype-specific neurons from hESCs. Methods Mol Biol, 636, 123-137. https: / / doi.org / 10.1007 / 978-l-60761-691-78 Inoue, F., Kurokawa, D., Takahashi, M., & Aizawa, S. (2012). Gbx2 directly restricts Otx2 expression to forebrain and midbrain, competing with class III POU factors. Mol Cell Biol, 32(12,), 2618-2627. https: / / doi.org / 10.1128 / MCB.00083-12 Ishikawa, Y., Yamamoto, N., Yoshimoto, M., & Ito, H. (2012). The primary brain vesicles revisited: are the three primary vesicles (forebrain / midbrain / hindbrain) universal in vertebrates? Brain Behav Evol, 79(2), 75-83. https: / / doi.org / 10.1159 / 000334842 Jacobson, A. G., k. Tam, P. P. (1982). Cephalic neurulation in the mouse embryo analyzed by SEM and morphometry. Anat Rec, 203(2), 375-396. https: / / doi.org / 10.1002 / ar.1092030308 Juric-Sekhar, G., & Hevner, R. F. (2019). Malformations of Cerebral Cortex Development: Molecules and Mechanisms. Annu Rev Pathol, 14, 293-318. https: / / doi.org / 10.1146 / annurev-pathmechdis- 012418-012927 functional recovery in a mouse model of spinal cord injury. Stem Cell Res Ther, 7,; 11. https: / / doi.org / 10.1186 / sl3287-015-Q268-x Butt, S. J., Sousa, V. H., Fuccillo, M. V., Hjerling-Leffler, J., Miyoshi, G., Kimura, S., & Fishell, G. (2008). The requirement of Nkx2-1 in the temporal specification of cortical interneuron subtypes. Neuron, 59(5),722-732. https: / / doi.org / 10.1016 / i .neuron.2008.07.031Cadwell, C. R., Bhaduri, A., Mostajo-Radji, M. A., Keefe, M. G., & Nowakowski, T. J. (2019). Development and Arealization of the Cerebral Cortex. Neuron, 103(6), 980-1004. https: / / doi.Org / 10.1016 / i.neuron.2019.07.009 Camp, J. G., Badsha, F., Florio, M., Kanton, S., Gerber, T., Wilsch-Brauninger, M., Lewitus, E., Sykes,A., Hevers, W., Lancaster, M., Knoblich, J. A., Lachmann, R., Paabo, S., Hüttner, W. B., & Treutlein, B.(2015). Human cerebral organoids recapitulate gene expression programs of fetal neocortex development. Proc Natl Acad Sei USA, 112(51), 15672-15677. https: / / doi.org / 10.1073 / pnas. 1520760112 Camus, A., & Tam, P. P. (1999). The organizer of the gastrulating mouse embryo. Curr Top Dev Biol, 45,, 117-153. https: / / doi.org / 10.1016 / sQ070-2153f08l60315-4 Carulli, D., de Winter, F., & Verhaagen, J. (2021). Semaphorins in Adult Nervous System Plasticity and Disease. Front Synaptic Neurosci, 13, 672891. https: / / doi.org / 10.3389 / fnsvn.2021.672891 Chambers, S. M., Fasano, C. A., Papapetrou, E. P., Tomishima, M., Sadelain, M., & Studer, L. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol, 27(3), 275-280. https: / / doi.org / 10.1038 / nbt.1529 Chang, E., Ruan, X., Zhu, R., Wang, Y., & Zhang, J. (2020). Values of Single-Cell RNA Sequencing in Development of Cerebral Cortex. Adv Exp Med Biol, 1255, 231-247. https: / / doi.org / 10.10Q7 / 978-981- 15-4494-l 19 Charron, F., & Tessier-Lavigne, M. (2005). Novel brain wiring functions for classical morphogens: a role as graded positional cues in axon guidance. Development, 132( 10), 2251-2262. https: / / doi.org / 10.1242 / dev.01830Chen, G., Sima, J., Jin, M., Wang, K. Y., Xue, X. J., Zheng, W., Ding, Y. Q., k Yuan, X. B. (2008).Semaphorin-3A guides radial migration of cortical neurons during development. Nat Neurosci, 11(1), 36-44. https: / / doi.org / 10.1038 / nn2018 Chen, S., Xiong, J., Chen, B., Zhang, C., Deng, X., He, F., Yang, L., Chen, C., Peng, J., & Yin, F. (2022). Autism spectrum disorder and comorbid neurodevelopmental disorders (ASD-NDDs): Clinical and genetic profile of a pediatric cohort. Clin Chim Acta, 524, 179-186. https: / / doi.Org / 10.1016 / i.cca.2021.ll.014 Cheung, A. F., Pollen, A. A., Tavare, A., DeProto, J., k Molnar, Z. (2007). Comparative aspects of cortical neurogenesis in vertebrates. J Anat, 211(2), 164-176. https: / / doi.Org / 10.llll / i.1469-7580.2007.00769.x Copp, A. J., Stanier, P., k Greene, N. D. (2013). Neural tube defects: recent advances, unsolved questions, and controversies. Lancet Neurol., 12(8), 799-810. https: / / doi.org / 10.1016 / S1474- 4422fl3l70110-8 Corbin, J. G., Gaiano, N., Machold, R. P., Langston, A., k Fishell, G. (2000). The Gsh2 homeodomain gene controls multiple aspects of telencephalic development. Development, 127(23), 5007-5020. https: / / doi.org / 10.1242 / dev.127.23.5007 Costamagna, G., Comi, G. P., k Corti, S. (2021). Advancing Drug Discovery for Neurological Disorders Using iPSC-Derived Neural Organoids. Int J Mol Sei, 22(5). https: / / doi.org / 10.3390 / iims22Q52659 Crossley, P. H., Martinez, S., Ohkubo, Y., k Rubenstein, J. L. (2001). Coordinate expression of Fgf8, Otx2, Bmp4, and Shh in the rostral prosencephalon during development of the telencephalic and optic vesicles. Neuroscience, 108(2), 183-206. https: / / doi.org / 10.1016 / s0306-4522f01100411-0Danesin, C., Peres, J. N., Johansson, M., Snowden, V., Cording, A., Papalopulu, N., kHouart, C. (2009). Integration of telencephalic Wnt and hedgehog signaling center activities by Foxgl. Dev Cell, 16(4), 576-587. https: / / doi.Org / 10.1016 / i.devcel.2009.03.007 Darmanis, S., Sloan, S. A., Zhang, Y., Enge, M., Caneda, C., Shuer, L. M., Hayden Gephart, M. G., Barres, B. A., & Quake, S. R. (2015). A survey of human brain transcriptome diversity at the single celllevel. Proc Natl Acad Sei USA, 112(23), 7285-7290. https: / / doi.org / 10.1073 / pnas.1507125112Dincer, Z., Piao, J., Niu, L., Ganat, Y., Kriks, S., Zimmer, B., Shi, S. H., Tabar, V., k Studer, L. (2013). Specification of functional cranial placode derivatives from human pluripotent stem cells. Cell Rep, 5(5), 1387-1402. https: / / doi.org / 10.1016 / i .celrep.2013.10.048 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Chaisson, M., k Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29(1), 15-21. https: / / doi.org / 10.1093 / bioinformatics / bts635 Edri, R., Yaffe, Y., Ziller, M. J., Mutukula, N., Volkman, R., David, E., Jacob-Hirsch, J., Malcov, H., Levy, C., Rechavi, G., Gat-Viks, L, Meissner, A., k Elkabetz, Y. (2015). Analysing human neural stem cell ontogeny by consecutive isolation of Notch active neural progenitors. Nat Commun, 6, 6500. https: / / doi.org / 10.1038 / ncomms7500 Eiraku, M., Watanabe, K., Matsuo-Takasaki, M., Kawada, M., Yonemura, S., Matsumura, M., Wataya, T., Nishiyama, A., Muguruma, K., k Sasai, Y. (2008). Self-organized formation of polarized cortical tissues from ESCs and its active manipulation by extrinsic signals. Cell Stem Cell, 3(5), 519-532. https: / / doi.org / 10.1016 / i .stem.2008.09.002 Elkabetz, Y., Panagiotakos, G., AI Shamy, G., Socci, N. D., Tabar, V., k Studer, L. (2008). Human ES cell-derived neural rosettes reveal a functionally distinct early neural stem cell stage. Genes Dev, 22(2),152-165. https: / / doi.org / 10.1101 / gad. 1616208Feng, H., Moakley, D. F., Chen, S., McKenzie, M. G., Menon, V., k Zhang, C. (2021). Complexity and graded regulation of neuronal cell-type-specific alternative splicing revealed by single-cell RNA sequencing. Proc Natl Acad Sei USA, 118( 10). https: / / doi.org / 10.1073 / pnas.2013056118 Fischer, T., Guimera, J., Wurst, W., & Prakash, N. (2007). Distinct but redundant expression of the Frizzled Wnt receptor genes at signaling centers of the developing mouse brain. Neuroscience, 147(3), 693-711. https: / / doi.org / 10.1016 / i .neuroscience.2007.04.060 Gaspard, N., Bouschet, T., Hourez, R., Dimidschstein, J., Naeije, G., van den Ameele, J., Espuny- Camacho, I., Herpoel, A., Passante, L., Schiffmann, S. N., Gaillard, A., k Vanderhaeghen, P. (2008). An intrinsic mechanism of corticogenesis from embryonic stem cells. Nature, 455(7211), 351-357. https: / / doi.org / 10.1038 / nature07287 Georgala, P. A., Carr, C. B., & Price, D. J. (2011). The role of Pax6 in forebrain development. DevNeurobiol, 71(8), 690-709. https: / / doi.org / 10.1002 / dneu.20895 Gilbert SF. (2000) Developmental Biology.6th edition. Sunderland (MA): Sinauer Associates. Available from: https: / / www.ncbi.nlm.nih.gov / books / NBK9983 / Greig, L. C., Woodworth, M. B., Galazo, M. J., Padmanabhan, H., k Macklis, J. D. (2013). Molecular logic of neocortical projection neuron specification, development and diversity. Nat Rev Neurosci, 14(11), 755-769. https: / / doi.org / 10.1038 / nrn3586 Grove, E. A., Tole, S., Limon, J., Yip, L., k Ragsdale, C. W. (1998). The hem of the embryonic cerebral cortex is defined by the expression of multiple Wnt genes and is compromised in Gli3-deficient mice.Development, 125(12), 2315-2325. https: / / doi.org / 10.1242 / dev.125.12.2315Gunhaga, L., Marklund, M., Sjodal, M., Hsieh, J. C., Jessell, T. M., k Edlund, T. (2003). Specification of dorsal telencephalic character by sequential Wnt and FGF signaling. Nat Neurosci, 6(7), 701-707. https: / / doi.org / 10.1038 / nnlQ68 Hansen, D. V., Rubenstein, J. L., k Kriegstein, A. R. (2011). Deriving excitatory neurons of the neocortexfrom pluripotent stem cells. Neuron, 70(A), 645-660. https: / / doi.Org / 10.1016 / i.neuron.2011.05.006Harkness, L., Zäher, W., Ditzel, N., Isa, A., k Kassem, M. (2016). CD146 / MCAM defines functionality of human bone marrow stromal stem cell populations. Stem Cell Res Tber, 7, 4. https: / / doi.org / 10.1186 / sl3287-015-0266-z Harrison-Uy, S. J., k Pleasure, S. J. (2012). Wnt signaling and forebrain development. Cold Spring Harb Perspect Biol, 4(7), a008094. https: / / doi.org / 10.1101 / cshperspect.a008094 Haubst, N., Berger, J., Radjendirane, V., Graw, J., Favor, J., Saunders, G. F., Stoykova, A., k Gotz, M. (2004). Molecular dissection of Pax6 function: the specific roles of the paired domain and homeodomain in brain development. Development, 131(24), 6131-6140. https: / / doi.org / 10.1242 / dev.01524 Hebert, J. M., & Fishell, G. (2008). The genetics of early telencephalon patterning: some assembly required. Nat Rev Neurosci, 5(9), 678-685. https: / / doi.org / 10.1038 / nrn2463 Hedlund, E., & Deng, Q. (2018). Single-cell RNA sequencing: Technical advancements and biological applications. Mol Aspects Med, 59, 36-46. https: / / doi.org / 10.1016 / i .mam.2017.07.003 Hemmati-Brivanlou, A., Kelly, O. G., & Melton, D. A. (1994). Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neutralizing activity. Cell, 77(2), 283-295. https: / / doi.org / 10.1016 / 0092-8674f94)90320-4 Hettige, N. C., Peng, H., Wu, H., Zhang, X., Yerko, V., Zhang, Y., Jefri, M., Soubannier, V., Maussion,G., Alsuwaidi, S., Ni, A., Rocha, C., Krishnan, J., McCarty, V., Antonyan, L., Schuppert, A., Turecki, G.,Fon, E. A., Durcan, T. M., & Ernst, C. (2022). FOXG1 dose tunes cell proliferation dynamics in humanforebrain progenitor cells. Stem Cell Reports, 17(3), 475-488.https: / / doi.Org / 10.1016 / i.stemcr.2022.01.010 Hoerder-Suabedissen, A., & Molnar, Z. (2015). Development, evolution and pathology of neocortical subplate neurons. Nat Rev Neurosci, 76(3), 133-146. https: / / doi.org / 10.1038 / nrn3915 Holm, P. C., Mader, M. T., Haubst, N., Wizenmann, A., Sigvardsson, M., & Gotz, M. (2007). Loss- and gain-of-function analyses reveal targets of Pax6 in the developing mouse telencephalon. Mol Cell Neurosci, 34(1), 99-119. https: / / doi.org / 10.1016 / i .men.2006.10.008 Hu, B. Y., & Zhang, S. C. (2010). Directed differentiation of neural-stem cells and subtype-specific neurons from hESCs. Methods Mol Biol, 636, 123-137. https: / / doi.org / 10.1007 / 978-l-60761-691-78 Inoue, F., Kurokawa, D., Takahashi, M., & Aizawa, S. (2012). Gbx2 directly restricts Otx2 expression to forebrain and midbrain, competing with class III POU factors. Mol Cell Biol, 32(12,), 2618-2627. https: / / doi.org / 10.1128 / MCB.00083-12 Ishikawa, Y., Yamamoto, N., Yoshimoto, M., & Ito, H. (2012). The primary brain vesicles revisited: are the three primary vesicles (forebrain / midbrain / hindbrain) universal in vertebrates? Brain Behav Evol, 79(2), 75-83. https: / / doi.org / 10.1159 / 000334842 Jacobson, A. G., k. Tam, P. P. (1982). Cephalic neurulation in the mouse embryo analyzed by SEM and morphometry. Anat Rec, 203(2), 375-396. https: / / doi.org / 10.1002 / ar.1092030308 Juric-Sekhar, G., & Hevner, R. F. (2019). Malformations of Cerebral Cortex Development: Moleculesand Mechanisms. Annu Rev Pathol, 14, 293-318. https: / / doi.org / 10.1146 / annurev-pathmechdis-012418-012927 Kelava, L, & Lancaster, M. A. (2016). Stem Cell Models of Human Brain Development. Cell Stem Cell\ 18(6), 736-748. https: / / doi.Org / 10.1016 / i.stem.2016.05.022 Klein, A. M., Mazutis, L., Akartuna, L, Tallapragada, N., Veres, A., Li, V., Peshkin, L., Weitz, D. A., &Kirschner, M. W. (2015). Droplet barcoding for single-cell transcriptomics applied to embryonic stemcells. Cell, 161(5), 1187-1201. https: / / doi.org / 10.1016 / i .cell.2015.04.044 Kumar, R. M., Cahan, P., Shalek, A. K., Satija, R., DaleyKeyser, A., Li, H., Zhang, J., Pardee, K., Gennert, D., Trombetta, J. J., Ferrante, T. C., Regev, A., Daley, G. Q., & Collins, J. J. (2014). Deconstructing transcriptional heterogeneity in pluripotent stem cells. Nature, 516(7529), 56-61. https: / / doi.org / 10.1038 / naturel3920 Lancaster, M. A., & Knoblich, J. A. (2014). Generation of cerebral organoids from human pluripotent stem cells. Nat Protoc, 9(10), 2329-2340. https: / / doi.org / 10.1038 / nprot.2014.158 Lee, H. K., Lee, H. S., & Moody, S. A. (2014). Neural transcription factors: from embryos to neural stem cells. Mol Cells, 37(10), 705-712. https: / / doi.org / 10.14348 / molcells.2014.0227 Lehmann, J. M., Holzmann, B., Breitbart, E. W., Schmiegelow, P., Riethmuller, G., & Johnson, J. P. (1987). Discrimination between benign and malignant cells of melanocytic lineage by two novel antigens, a glycoprotein with a molecular weight of 113,000 and a protein with a molecular weight of 76,000. Cancer Res, 47(3), 841-845. https: / / www.ncbi.nlm.nih.gov / pubmed / 3542195 Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics, 12, 323. https: / / doi.org / 10.1186 / 1471-2105-12-323 Lindvall, O., k Kokaia, Z. (2010). Stem cells in human neurodegenerative disorders—time for clinicaltranslation? J Clin Invest, 120(1), 29-40. https: / / doi.org / 10.1172 / JCI40543Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 26(4), 402-408. https: / / doi.org / 10.1006 / meth.2Q01.1262 Loomba, S., Straehle, J., Gangadharan, V., Heike, N., Khalifa, A., Motta, A., Ju, N., Sievers, M., Gempt, J., Meyer, H. S., k Helmstaedter, M. (2022). Connectomic comparison of mouse and human cortex. Science, 377(6602), eabo0924. https: / / doi.org / 10.1126 / science .abo0924 Macosko, E. Z., Basu, A., Satija, R., Nemesh, J., Shekhar, K., Goldman, M., Tirosh, L, Bialas, A. R., Kamitaki, N., Martersteck, E. M., Trombetta, J. J., Weitz, D. A., Sanes, J. R., Shalek, A. K., Regev, A., k McCarroll, S. A. (2015). Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell, 161(5), 1202-1214. https: / / doi.Org / 10.1016 / i.cell.2015.05.002 Mangold, O., & Spemann, H. (1927). [Not Available]. Wilhelm Roux Arch Entwickl Mech Org, 111(1), 341-422. https: / / doi.org / 10.1007 / BF0208Q953 (Uber Induktion von Medullarplatte durch Medullarplatte im Jüngeren Keim, ein Beispiel homoogenetischer oder assimilatorischer Induktion.) Manuel, M. N., Martynoga, B., Molinek, M. D., Quinn, J. C., Kroemmer, C., Mason, J. O., & Price, D. J. (2011). The transcription factor Foxgl regulates telencephalic progenitor proliferation cell autonomously, in part by controlling Pax6 expression levels. Neural Dev, 6, 9. https: / / doi.org / 10.1186 / 1749-8104-6-9 Mariani, J., Simonini, M. V., Palejev, D., Tomasini, L., Coppola, G., Szekely, A. M., Horvath, T. L., & Vaccarino, F. M. (2012). Modeling human cortical development in vitro using induced pluripotent stem cells. Proc Natl Acad Sei USA, 109(31), 12770-12775. https: / / doi.org / 10.1073 / pnas.1202944109Maroof, A. M., Keros, S., Tyson, J. A., Ying, S. W., Ganat, Y. M., Merkle, F. T., Liu, B., Goulburn, A.,Stanley, E. G., Elefanty, A. G., Widmer, H. R., Eggan, K., Goldstein, P. A., Anderson, S. A., & Studer, L. (2013). Directed differentiation and functional maturation of cortical interneurons from human embryonic stem cells. Cell Stem Cell, 12(h), 559-572. https: / / doi.Org / 10.1016 / i.stem.2013.04.008 Martynoga, B., Morrison, H., Price, D. J., & Mason, J. O. (2005). Foxgl is required for specification ofventral telencephalon and region-specific regulation of dorsal telencephalic precursor proliferation andapoptosis. Dev Biol, 283(1), 113-127. https: / / doi.Org / 10.1016 / i.vdbio.2005.04.005 Medina, L., & Abelian, A. (2009). Development and evolution of the pallium. Semin Cell Dev Biol, 20(h), 698-711. https: / / doi.Org / 10.1016 / i.semcdb.2009.04.008 Miyata, T., Kawaguchi, A., Saito, K., Kawano, M., Muto, T., &, Ogawa, M. (2004). Asymmetric production of surface-dividing and non-surface-dividing cortical progenitor cells. Development, 131(13), 3133-3145. https: / / doi.org / 10.1242 / dev.01173 Molyneaux, B. J., Arlotta, P., Menezes, J. R., & Macklis, J. D. (2007). Neuronal subtype specification in the cerebral cortex. Nat Rev Neurosci, #(6), 427-437. https: / / doi.org / 10.1038 / nrn2151 Muzio, L., Di Benedetto, B., Stoykova, A., Boncinelli, E., Gruss, P., & Mallamaci, A. (2002). Conversion of cerebral cortex into basal ganglia in Emx2(- / -) Pax6(Sey / Sey) double-mutant mice. Nat Neurosci, 3(8), 737-745. https: / / doi.org / 10.1038 / nn892 Nestor, M. W., Phillips, A. W., Artimovich, E., Nestor, J. E., Hussman, J. P., & Blatt, G. J. (2016). Human Inducible Pluripotent Stem Cells and Autism Spectrum Disorder: Emerging Technologies. Autism Res, 9(h), 513-535. https: / / doi.org / 10.1002 / aur.1570 Nieuwkoop, P. D. (1973). The organization center of the amphibian embryo: its origin, spatial organization, and morphogenetic action. Adv Morphog, 10, 1-39. https: / / doi.org / 10.1016 / b978-0-12-028610-2.500Q5-8Noctor, S. C., Martinez-Cerdeno, V., Ivic, L., & Kriegstein, A. R. (2004). Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat Neurosci, 7(2), 136- 144. https: / / doi.org / 10.1038 / nnll72 Ohkubo, Y., Chiang, C., & Rubenstein, J. L. (2002). Coordinate regulation and synergistic actions of BMP4, SHH and FGF8 in the rostral prosencephalon regulate morphogenesis of the telencephalic and optic vesicles. Neuroscience, 111(1), 1-17. https: / / doi.org / 10.1016 / s0306-4522f01100616-9 Panchision, D. M., Chen, H. L., Pistollato, F., Papini, D., Ni, H. T., & Hawley, T. S. (2007). Optimized flow cytometric analysis of central nervous system tissue reveals novel functional relationships among cells expressing CD133, CD15, and CD24. Stem Cells, 25(6), 1560-1570. https: / / doi.org / 10.1634 / stemcells.2006-026Q Paratcha, G., Ledda, F., & Ibanez, C. F. (2003). The neural cell adhesion molecule NCAM is an alternative signaling receptor for GDNF family ligands. Cell, 113(7), 867-879. https: / / doi.org / 10.1016 / s0092-8674f03100435-5 Park, I. H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A., Lensch, M. W., Cowan, C., Hochedlinger, K., & Daley, G. Q. (2008). Disease-specific induced pluripotent stem cells. Cell, 134(6), 877-886. https: / / doi.Org / 10.1016 / i.cell.2008.07.041 Pasca, A. M., Sloan, S. A., Clarke, L. E., Tian, Y., Makinson, C. D., Huber, N., Kim, C. H., Park, J. Y., O'Rourke, N. A., Nguyen, K. D., Smith, S. J., Huguenard, J. R., Geschwind, D. H., Barres, B. A., & Pasca, S. P. (2015). Functional cortical neurons and astrocytes from human pluripotent stem cells in 3Dculture. Nat Methods, 12(7), 671-678. https: / / doi.org / 10.1038 / nmeth.3415Pera, E. M., Ikeda, A., Eivers, E., & De Robertis, E. M. (2003). Integration of IGF, FGF, and anti-BMP signals via Smadl phosphorylation in neural induction. Genes Dev, 17(24), 3023-3028. https: / / doi.org / 10.1101 / gad.1153603 Pollen, A. A., Nowakowski, T. J., Shuga, J., Wang, X., Leyrat, A. A., Lui, J. H., Li, N., Szpankowski, L.,Fowler, B., Chen, P., Ramalingam, N., Sun, G., Thu, M., Norris, M., Lebofsky, R., Toppani, D., Kemp,D. W., 2nd, Wong, M., Clerkson, B., ...West, J. A. (2014). Low-coverage single-cell mRNA sequencing reveals cellular heterogeneity and activated signaling pathways in developing cerebral cortex. Nat Biotechnol, 32(10), 1053-1058. https: / / doi.org / 10.1038 / nbt.2967 Polleux, F., Morrow, T., & Ghosh, A. (2000). Semaphorin 3A is a chemoattractant for cortical apical dendrites. Nature, 404(6778), 567-573. https: / / doi.org / 10.1038 / 35007001 Qi, Y., Zhang, X. J., Renier, N., Wu, Z., Atkin, T., Sun, Z., Ozair, M. Z., Tchieu, J., Zimmer, B., Fattahi, F., Ganat, Y., Azevedo, R., Zeltner, N., Brivanlou, A. H., Karayiorgou, M., Gogos, J., Tomishima, M., Tessier-Lavigne, M., Shi, S. H., & Studer, L. (2017). Combined small-molecule inhibition accelerates the derivation of functional cortical neurons from human pluripotent stem cells. Nat Biotechnol, 35(2), 154- 163. https: / / doi.org / 10.1038 / nbt.3777 Quadrato, G., Nguyen, T., Macosko, E. Z., Sherwood, J. L., Min Yang, S., Berger, D. R., Maria, N., Scholvin, J., Goldman, M., Kinney, J. P., Boyden, E. S., Lichtman, J. W., Williams, Z. M., McCarroll, S. A., 8z Arlotta, P. (2017). Cell diversity and network dynamics in photosensitive human brain organoids. Nature, 545(7652), 48-53. https: / / doi.org / 10.1038 / nature22Q47 Quinlan, R., Graf, M., Mason, I., Lumsden, A., 8z Kiecker, C. (2009). Complex and dynamic patterns of Wnt pathway gene expression in the developing chick forebrain. Neural Dev, 4, 35. https: / / doi.org / 10.1186 / 1749-8104Hl-35Rakic, P. (1972). Mode of cell migration to the superficial layers of fetal monkey neocortex. J Comp Neurol, 145(1), 61-83. https: / / doi.org / 10.1002 / cne.9014501Q5 Ramon y Cajal, S. (1995). Histology of the Nervous System of Man and Vertebrates. Oxford Univ. Press, New York. Rosebrock, D., Arora, S., Mutukula, N., Volkman, R., Gralinska, E., Balaskas, A., Aragones Hernandez, A., Buschow, R., Brandi, B., Muller, F. J., Arndt, P. F., Vingron, M., 8z Elkabetz, Y. (2022). Enhanced cortical neural stem cell identity through short SMAD and WNT inhibition in human cerebral organoids facilitates emergence of outer radial glial cells. Nat Cell Biol, 24(6), 981-995. https: / / doi.org / 10.1038 / s41556-022-0Q929-5 Ruiz i Altaba, A., Palma, V., 8z Dahmane, N. (2002). Hedgehog-Gli signalling and the growth of the brain. Nat Rev Neurosci, 5(1), 24-33. https: / / doi.org / 10.1038 / nrn704 Sabitha, K. R., Shetty, A. K., 8z Upadhya, D. (2021). Patient-derived iPSC modeling of rare neurodevelopmental disorders: Molecular pathophysiology and prospective therapies. Neurosci Biobehav Rev, 121, 201-219. https: / / doi.org / 10.1016 / i .neubiorev.2020.12.025 Sacchetti, B., Funari, A., Michienzi, S., Di Cesare, S., Piersanti, S., Saggio, I., Tagliafico, E., Ferrari, S., Robey, P. G., Riminucci, M., 8z Bianco, P. (2007). Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell, 131(2), 324-336. https: / / doi.Org / 10.1016 / i.cell.2007.08.025 Sasai, Y., Lu, B., Steinbeisser, H., Geissert, D., Gont, L. K., 8z De Robertis, E. M. (1994). Xenopuschordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell, 79(6), 779-790. https: / / doi.org / 10.1016 / 0Q92-8674('94i90068-x Saurat, N. G., Livesey, F. J., 8z Moore, S. (2016). Cortical Differentiation of Human Pluripotent Cells for In Vitro Modeling of Alzheimer's Disease. Methods Mol Biol, 1303, 267-278. https: / / doi.org / 10.10Q7 / 978-l-4939-2627-516Schmierer, B., 8z Hill, C. S. (2007). TGFbeta-SMAD signal transduction: molecular specificity andfunctional flexibility. Nat Rev Mol Cell Biol, 5(12), 970-982. https: / / doi.org / 10.1038 / nrm2297 Schwartz, P. H., Bryant, P. J., Fuja, T. J., Su, H., O'Dowd, D. K., k, Klassen, H. (2003). Isolation and characterization of neural progenitor cells from post-mortem human cortex. J Neurosci Res, 74(6), 838- 851. https: / / doi.org / 10.1002 / inr.10854 Shalek, A. K., Satija, R., Adiconis, X., Gertner, R. S., Gaublomme, J. T., Raychowdhury, R., Schwartz, S., Yosef, N., Malboeuf, C., Lu, D., Trombetta, J. J., Gennert, D., Gnirke, A., Goren, A., Hacohen, N., Levin, J. Z., Park, H., & Regev, A. (2013). Single-cell transcriptomics reveals bimodality in expression and splicing in immune cells. Nature, 495(7453), 236-240. https: / / doi.org / 10.1038 / naturel2172 Sheng, G., dos Reis, M., & Stern, C. D. (2003). Churchill, a zinc finger transcriptional activator, regulates the transition between gastrulation and neurulation. Cell, 115(h), 603-613. https: / / doi.org / 10.1016 / s0092-8674(03')00927-9 Shi, Y., Kirwan, P., & Livesey, F. J. (2012). Directed differentiation of human pluripotent stem cells to cerebral cortex neurons and neural networks. Nat Protoc, 7(10), 1836-1846. https: / / doi.org / 10.1038 / nprot.2Q12.116 Shi, Y., Kirwan, P., Smith, J., Robinson, H. P., & Livesey, F. J. (2012). Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses. Nat Neurosci, 15(3), 477-486, S471. https: / / doi.org / 10.1038 / nn.3041Shih, J., & Fraser, S. E. (1996). Characterizing the zebrafish organizer: microsurgical analysis at the early-shield stage. Development, 122(A), 1313-1322. https: / / doi.Org / 10.1242 / dev.122.4.1313 Shimamura, K., & Rubenstein, J. L. (1997). Inductive interactions direct early regionalization of the mouse forebrain. Development, 124(14), 2709-2718. https: / / doi.org / 10.1242 / dev.124.14.2709 Smith, W. C., & Harland, R. M. (1992). Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell, 70(h), 829-840. https: / / doi.org / 10.1016 / 0092- 8674l92j9Q316-5 Staal, F. J., Luis, T. C., & Tiemessen, M. M. (2008). WNT signalling in the immune system: WNT is spreading its wings. Nat Rev Immunol, 5(8), 581-593. https: / / doi.org / 10.1038 / nri2360 Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A., & Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature, 406(6791), 74-78. https: / / doi.org / 10.1038 / 35Q17617 Sussel, L., Marin, O., Kimura, S., & Rubenstein, J. L. (1999). Loss of Nkx2.1 homeobox gene function results in a ventral to dorsal molecular respecification within the basal telencephalon: evidence for a transformation of the pallidum into the striatum. Development, 126(lh), 3359-3370. https: / / doi.org / 10.1242 / dev.126.15.3359 Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., & Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131(h), 861- 872. https: / / doi.org / 10.1016 / i .cell.2007.11.019 Tandon, R., Brandi, B., Baryshnikova, N., Landshammer, A., Steenpass, L., Keminer, O., Pless, O., &Muller, F. J. (2018). Generation of two human isogenic iPSC lines from fetal dermal fibroblasts. StemCell Res, 33, 120-124. https: / / doi.org / 10.1016 / i .scr.2018.10.004 Tang, F., Barbacioru, C., Wang, Y., Nordman, E., Lee, C., Xu, N., Wang, X., Bodeau, J., Tuch, B. B., Siddiqui, A., Lao, K., & Surani, M. A. (2009). mRNA-Seq wholetranscriptome analysis of a single cell. Nat Methods, 6(5), 377-382. https: / / doi.org / 10.1038 / nmeth.1315Tao, W., & Lai, E. (1992). Telencephalon-restricted expression of BF-1, a new member of the HNF-3 / fork head gene family, in the developing rat brain. Neuron, 6(5), 957-966. https: / / doi.org / 10.1016 / 0896-6273l92i9021Q-5 Tormin, A., Li, O., Brune, J. C., Walsh, S., Schutz, B., Ehinger, M., Ditzel, N., Kassem, M., & Scheding, S. (2011). CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization. Blood, 777(19), 5067-5077. https: / / doi.org / 10.1182 / blood-2010-08-3Q4287 Toyoda, R., Nakamura, H., & Watanabe, Y. (2005). Identification of protogenin, a novel immunoglobulin superfamily gene expressed during early chick embryogenesis. Gene Expr Patterns, <7(6), 778-785. https: / / doi.Org / 10.1016 / i.modgep.2005.04.001 Triarhou, L. C. (2021). Pre-Brodmann pioneers of cortical cytoarchitectonics I: Theodor Meynert, Vladimir Betz and William Bevan-Lewis. Brain Struct Fund, 223(1), 49-67. https: / / doi.org / 10.1007 / s00429-020-Q2168-6 Tung, H. H., & Lee, S. L. (2017). Physical Binding of Endothelial MCAM and Neural Transmembrane Protease Matriptase-Novel Cell Adhesion in Neural Stem cell Vascular Niche. Sei Rep, 7(1), 4946. https: / / doi.org / 10.1038 / s41598-017-05131-4 Uchida, N., Buck, D. W., He, D., Reitsma, M. J., Masek, M., Phan, T. V., Tsukamoto, A. S., Gage, F. H., & Weissman, I. L. (2000). Direct isolation of human central nervous system stem cells. Proc Natl AcadSei USA, 97(26), 14720-14725. https: / / doi.org / 10.1073 / pnas.97.26.14720Ulrich, C., Abruzzese, T., Maerz, J. K., Ruh, M., Amend, B., Benz, K., Rolauffs, B., Abele, H., Hart, M. L., & Aicher, W. K. (2015). Human Placenta-Derived CD146-Positive Mesenchymal Stromal Cells Display a Distinct Osteogenic Differentiation Potential. Stem Cells Dev, 24(12>), 1558-1569. https: / / doi.org / 10.1089 / scd.2014.0465 Velasco, S., Kedaigle, A. J., Simmons, S. K., Nash, A., Rocha, M., Quadrato, G., Paulsen, B. , Nguyen, L., Adiconis, X., Regev, A., Levin, J. Z., k, Arlotta, P. (2019). Individual brain organoids reproducibly form cell diversity of the human cerebral cortex. Nature, 570(7762), 523-527. https: / / doi.org / 10.1038 / s41586-Q19-1289-x Vesque, C., Anselme, L, Couve, E., Charnay, P., & Schneider-Maunoury, S. (2006). Cloning of vertebrate Protogenin (Prtg) and comparative expression analysis during axis elongation. Dev Dyn, 235(10), 2836-2844. https: / / doi.org / 10.1002 / dvdy.20898 Viebahn, C. (2001). Hensen's node. Genesis, 29(2), 96-103. https: / / doi.org / 10.10Q2 / 1526- 968xf200102)29:2<96::aid-genel010>3.0.co;2-h Vishwakarma, S. K., Bardia, A., Tiwari, S. K., Paspala, S. A., &; Khan, A. A. (2014). Current concept in neural regeneration research: NSCs isolation, characterization and transplantation in various neurodegenerative diseases and stroke: A review. J Adv Res, 5(3), 277-294. https: / / doi.org / 10.1016 / i .iare.2013.04.005 Vonica, A., & Gumbiner, B. M. (2007). The Xenopus Nieuwkoop center and Spemann-Mangold organizer share molecular components and a requirement for maternal Wnt activity. Dev Biol, 312(1),90-102. https: / / doi.org / 10.1016 / i .ydbio. 2007.09.039Waddington, C. H., & Schmidt, G. A. (1933). Induction by heteroplastic grafts of the primitive streak in birds. Wilhelm Roux Arch Entwickl Mech Org, 128(3), 522-563. https: / / doi.org / 10.1007 / BF00649863 Wang, H., Kane, A. W., Lee, C., & Ahn, S. (2014). Gli3 repressor controls cell fates and cell adhesion for proper establishment of neurogenic niche. Cell Rep, 5(4), 1093-1104.https: / / doi.Org / 10.1016 / i.celrep.2014.07.006Watanabe, Y., & Nakamura, H. (2012). Nuclear translocation of intracellular domain of Protogenin by proteolytic cleavage. Dev Growth Differ, 54(2), 167-176. https: / / doi.Org / 10.llll / i.1440- 169X.2011.01315.x Wigg, K. G., Feng, Y., Crosbie, J., Tannock, R., Kennedy, J. L., Ickowicz, A., Malone, M., Schachar, R., & Barr, C. L. (2008). Association of ADHD and the Protogenin gene in the chromosome 15q21.3 reading disabilities linkage region. Genes Brain Behav, 7(8), 877-886. https: / / doi.Org / 10.llll / i.1601- 183X.2008.00425.x Wilson, P. A., & Hemmati-Brivanlou, A. (1995). Induction of epidermis and inhibition of neural fate by Bmp-4. Nature, 576(6538), 331-333. https: / / doi.org / 10.1038 / 376331a0 Wilson, S. I., Rydstrom, A., Trimborn, T., Willert, K., Nüsse, R., Jessell, T. M., & Edlund, T. (2001). The status of Wnt signalling regulates neural and epidermal fates in the chick embryo. Nature, 411(6835), 325-330. https: / / doi.org / 10.1038 / 35077115 Wolf, F. A., Angerer, P., & Theis, F. J. (2018). SCANPY: large-scale single-cell gene expression data analysis. Genome Biol, 19(1), 15. https: / / doi.org / 10.1186 / s!3059-017-1382-0 Wolock, S. L., Lopez, R., & Klein, A. M. (2019). Scrublet: Computational Identification of Cell Doublets in Single-Cell Transcriptomic Data. Cell Syst, 5(4), 281-291 e289. https: / / doi.org / 10.1016 / i.cels.2018.11.005Wong, Y. H., Lu, A. C., Wang, Y. C., Cheng, H. C., Chang, C., Chen, P. H., Yu, J. Y., & Fann, M. J. (2010). Protogenin defines a transition stage during embryonic neurogenesis and prevents precocious neuronal differentiation. J Neurosci, 30(12), 4428-4439. https: / / doi.org / 10.1523 / JNEURQSCI.0473- 10.2010 Ying, Q. L., Stavridis, M., Griffiths, D., Li, M., k Smith, A. (2003). Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol, 21(2), 183-186. https: / / doi.org / 10.1038 / nbt78Q Ypsilanti, A. R., k. Rubenstein, J. L. (2016). Transcriptional and epigenetic mechanisms of early cortical development: An examination of how Pax6 coordinates cortical development. J Comp Neurol, 524(3), 609-629. https: / / doi.org / 10.10Q2 / cne.23866 Yu, J., Vodyanik, M. A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J. L., Tian, S., Nie, J., Jonsdottir, G. A., Ruotti, V., Stewart, R., Slukvin, II, k Thomson, J.A. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science, 318(5858), 1917-1920. https: / / doi.org / 10.1126 / science.1151526 Zhang, S. C., Wernig, M., Duncan, I. D., Brustle, O., k Thomson, J. A. (2001). In vitro differentiation of transplantable neural precursors from human embryonic stem cells. Nat Biotechnol, 19(12), 1129-1133. https: / / doi.org / 10.1038 / nbtl201-1129 Zheng, G. X., Terry, J. M., Belgrader, P., Ryvkin, P., Bent, Z. W., Wilson, R., Ziraldo, S. B., Wheeler, T. D., McDermott, G. P., Zhu, J., Gregory, M. T., Shuga, J., Montesclaros, L., Underwood, J. G.,Masquelier, D. A., Nishimura, S. Y., Schnall-Levin, M., Wyatt, P. W., Hindson, C. M., . . . Bielas, J. H.(2017). Massively parallel digital transcriptional profiling of single cells. Nat Commun, 8, 14049. https: / / doi.org / 10.1038 / ncommsl4049 Ziller, M. J., Edri, R., Yaffe, Y., Donaghey, J., Pop, R., Mallard, W., Issner, R., Gifford, C. A., Goren, A., Xing, J., Gu, H., Cachiarelli, D., Tsankov, A., Epstein, C., Rinn, J. R., Mikkelsen, T. S., Kohlbacher, O.,Gnirke, A., Bernstein, B. E., . . . Meissner, A. (2015). Dissecting neural differentiation regulatorynetworks through epigenetic footprinting. Nature, 575(7539), 355-359. https: / / doi.org / 10.1038 / naturel3990

Claims

CLAIMS 1. A method for generating an enriched population of early cortical neural stem cells (NSCs) or a subpopulation thereof, the method comprising: isolating cells that are positive for the cell surface marker protogenin (PRTG) from aninitial population of neural progenitor cells, wherein said isolating is conducted at a time pointbetween about day 4 and about day 12, preferably on day 5, after initiation of neural induction, thereby obtaining an enriched population of early cortical neural stem cells (NSCs); and optionally re-culturing said enriched population of early cortical neural stem cells (NSCs) in a neural induction medium or other culture medium, wherein said re-culturing preferably produces progeny of said early cortical neural stem cells (NSCs).

2. The method of claim 1, wherein said initial population of neural progenitor cells has been obtained from, or is obtained by: (i) culturing primate stem cells in a primate stem cell medium until the formation of embryonic bodies (EBs); and (ii) culturing the EBs as obtained in step (i) in a neural induction medium comprising an inhibitor of WNT, an inhibitor of TGF-β, and an inhibitor of BMP, thereby initiating neural induction, whereby the EBs differentiate into neural progenitor cells.

3. A method of determining whether a test agent is an inhibitor or activator of the generation of early cortical neural stem cells (NSCs), the method comprising: (i) culturing primate stem cells in a primate stem cell medium until the formation of embryonic bodies (EBs); (ii) culturing the EBs as obtained in step (i) in a neural induction medium comprising an inhibitor of WNT, an inhibitor of TGF-β, and an inhibitor of BMP in the presence of the testagent; (iii) quantifying the cells that are positive for the cell surface marker protogenin (PRTG); and(iv) determining the test agent as an inhibitor if the number of PRTG-positive cells is reduced as compared to the absence of the test compound, or identifying the test agent as an activator if the number of PRTG-positive cells is increasedas compared to the absence of the test compound.

4. The method of claim 2 or 3, wherein said primate stem cells are: (i) primate embryonic stem cells (ESCs); or (ii) primate induced pluripotent stem cells (iPSCs).

5. The method of any one of claims 1, 2 or 4, wherein said isolating is conducted by cell sorting, preferably by fluorescence-activated cell sorting (FACS) or magnetic cell separation (e.g., Magnetic-activated cell sorting (MACS)), using an PRTG-binding agent, preferably a PRTG- binding antibody.

6. The method of any one of claims 1, 2, 4 and 5, wherein said isolating is conducted at a time point between about day 4 and about day 12, preferably between about day 4 and about day 6, morepreferably on day 5, after initiation of neural induction, and whereby the cells of the enriched population of early cortical neural stem cells (NSCs) are characterized by: (i) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for one or more telencephalic-specific markers as compared to that in: (i-a) the initial population of neural progenitor cells prior to said isolating; and / or (i-b) the PRTG negative cells, as determinable, for example, by immunostaining; wherein preferably said telencephalic- specific marker(s) is / are selected from OTX2, NES, GLI3, CDH2 (N-cadherin), VIM, PAX6, FEZF1, LRP1, and RSPO2; (ii) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of OTX2-postive cells as compared to that in:(ii-a) the initial population of neural progenitor cells prior to said isolating; and / or (ii-b) the PRTG negative cells, as determinable, for example, by immunostaining; (iii) having a lower proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% lower proportion of GBX2-positive cells as compared to that in: (iii-a) the initial population of neural progenitor cells prior to said isolating; and / or (iii-b) the PRTG negative cells, as determinable, for example, by immunostaining; (iv) having a proportion of SOX2-positive cells and / or PAX6-positive cells that is between 80% and 100% of the total amount of cells; and / or having a proportion of TFAP2A-positive cells that is at most 20%, preferably at most 10% as compared to that in: (iv-a) the initial population of neural progenitor cells prior to said isolating; or (iv-b) the PRTG negative cells; as determinable, for example, by immunostaining; (v) having an increased ability for neural rosette formation, preferably evaluated after re- culturing for a duration of between about 8-12 days in neural induction medium as compared to of: (v-a) the initial population of neural progenitor cells prior to said isolating; and / or (v-b) the PRTG negative cells,as determinable, for example, by immunostaining; and / or (vi) in that at most, with increasing preference, 10%, 9%, 8%, 7%, 6% or less than 6% of the total amount of cells are PSCs (characterized, e.g., by expression of POU5F1 (OCT4) andIRX2) and / or neurons (characterized, e.g., by expression of STMN2 and DCX).

7. The method of any one of claims 1, 2 and 4 to 6, wherein said optional re-culturing said enriched population of early cortical neural stem cells (NSCs) in a neural induction medium is conductedfor a duration of between about 8 days to about 12 days, preferably for about 10 days, thereby obtaining cells that are characterized by:(i) having a higher, preferably an at least 10% higher proportion of PAX6-positive and / or FOXG1-positive cells as compared to that in: (i-a) the initial population of neural progenitor cells prior to said isolating; and / or (i-b) correspondingly re-cultured PRTG negative cells; as determinable, for example, by immunostaining; (ii) having an increased ability for neural rosette formation as compared to: (ii-a) the initial population of neural progenitor cells prior to said isolating; and / or (ii-b) correspondingly re-cultured PRTG negative; (iii) having a detectable expression of one or more of NR2F1, EMX2, VIM and / or PAX6; (iv) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for NR2F1, EMX2, VIM and / or PAX6, as compared to that in: (iv-a) the initial population of neural progenitor cells prior to said isolating; and / or(iv-b) correspondingly re-cultured PRTG negative; (v) in that at least, with increasing preference, 50%, 60%, 70%, 80%, 90%, or at least 95% or more of the cells express CDH2 (N-cadherin) and / or lack detectable expression of CDH1 (E-cadherin); and / or (vi) having a higher proportion, preferably an at least, with increasing preference, 10%, 20%, 30%, 40%, 50%, or at least 60% higher proportion of cells which are positive for FEZF1, LRP2, RSPO2 and / or SOX5, and additionally positive for WNT5B and / or SEMA3A, as compared to that in: (vi-a) the initial population of neural progenitor cells prior to said isolating; and / or (vi-b) correspondingly re-cultured PRTG negative; wherein said cells are preferably a subpopulation or progeny of the enriched population of early cortical neural stem cells (NSCs).

8. An early cortical neural stem cell (NSC) or an enriched population of early cortical neural stem cells (NSCs) or a subpopulation or progeny thereof obtained or obtainable by the method of any one of claims 1, 2, and 4 to 7.

9. A composition comprising the early cortical neural stem cell (NSC) or enriched population of early cortical neural stem cells (NSCs) of claim 8.

10. A composition according to claim 9 for use as a medicament.

11. A composition according to claim 10 for use: (i) in treating, preventing, ameliorating at least one symptom, or slowing the progression of a disease that would benefit from an administration of said composition; and / or(ii) in cell replacement therapy, preferably in the treatment of a primate CNS disorder.

12. The composition for use according to claim 11(i), wherein said disease is selected from: - a disease of the CNS, preferably a neurodegenerative disease of the CNS, more preferably selected from Alzheimer's disease, Parkinson's disease (PD) and multiple sclerosis (MS); - a neuroinflammatory disease; - a neurodevelopmental disease, preferably a zikka- or mutated gene-induced microcephaly; - an acute brain disease (e.g., stroke) or brain injury, preferably a stroke occurring during a perinatal stage (i.e., in a prenatal embryo, preferably at a time point on or after week 20 of gestation) or an early post-birth stage (preferably until week 4 after birth); - a brain disease characterized by a shortage of cortical cells, malignant cortical cells (e.g., a brain disease characterized by a malignant conversion of cortical cells to a stem-cell like state, such as cancer stem cells) and / or a defective cortical cell formation; and / or - glioma, medulloblastoma, neuroblastoma and / or glioblastoma multiforme (GBM).

13. In-vitro or ex-vivo use of an PRTG-binding agent for detection or imaging of early cortical NSCs.

14. Use of PRTG as a cell surface marker for (i) in vitro, in vivo, in situ, or ex vivo detection and / or localization of early cortical NSCs;(ii) isolation of early cortical NSCs; (iii) enriching for early cortical NSCs; and / or (iv) maintaining symmetrically dividing of early cortical NSCs.

15. Use of PRTG as a cell surface marker for enriching oRG cells.

16. A PRTG-binding agent for use in an in vivo method of diagnosing a disease in a subject, whereinsaid disease is a disease that is causatively linked with an aberrant expression of early cortical neural stem cells (NSCs), the method comprising: (i) administering to said subject a PRTG-binding agent, (ii) detecting and / or quantifying PRTG-positive cells by means of detecting the bound PRTG- binding agent; (iii) wherein the subject is diagnosed as being positive for the disease if the level of detected PRTG is, with increasing preference, at least 10%, at least 20%, at least 30%, at least 50%, at least 70%, at least 90% higher or lower as compared to the level detected in a healthy reference subject or mean level detected in a group of healthy references subjects, wherein preferably said disease is said disease is selected from: -a disease of the CNS, preferably a neurodegenerative disease of the CNS, more preferablyselected from Alzheimer's disease, Parkinson's disease (PD) and multiple sclerosis (MS); - a neuroinflammatory disease; - a neurodevelopmental disease, preferably a zikka- or mutated gene-induced microcephaly; - an acute brain disease (e.g., stroke) or brain injury, preferably a stroke occurring during a perinatal stage (i.e., in a prenatal embryo, preferably at a time point on or after week 20 ofgestation) or an early post-birth stage (preferably until week 4 after birth); - a brain disease characterized by a shortage of cortical cells, malignant cortical cells (e.g., abrain disease characterized by a malignant conversion of cortical cells to a stem-cell like state, such as cancer stem cells) and / or a defective cortical cell formation; and / or - glioma, medulloblastoma, neuroblastoma and / or glioblastoma multiforme (GBM).

Images