Specific molecular marker, primer and method for genetic sex identification of siniperca chuatsi and application
Through the co-dominant genetic sex-specific molecular markers and primer design of the co-dominant, the problem of gender identification of male and female gender was solved, and the accurate identification of male and female gender was achieved, laying the foundation for sexual control breeding, and providing data support for the study of gender determination mechanism.
Patent Information
- Application Number
- CN202510319105.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art is difficult to accurately judge the gender of chewynthetics through morphological characteristics, especially the distinction between pseudo-male fish and male fish, which affects the sexually controlled breeding and breeding efficiency of chewynthetics.
The co-dominant genetic sex-specific molecular markers of Chrysanthemum was developed, specific primers were designed for PCR amplification, and the primers F/R were designed using differential fragments of male and female genomes to achieve genetic sex identification of Chrysanthemum.
It realizes accurate identification of male and female genders, which is simple and fast, and reduces damage to fish. It is suitable for male and female at different developmental stages, providing basic data on gender determination mechanism research and sexual control breeding.
Smart Images

Figure CN120272580A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of fish sex identification, and particularly relates to a specific molecular marker, primer, method and application for genetic sex identification of Siniperca chuatsi. Background Art
[0002] Siniperca chuatsi belongs to the genus Siniperca of Perciformes and Serranidae, also known as Aohua, Osmanthus, Mandarin fish, and is a unique precious freshwater fish in China. Siniperca chuatsi has delicious meat and rich nutritional value, and is widely loved by consumers in the market. It is an important economic fish in China. Siniperca chuatsi has obvious sexual dimorphism in growth, that is, females grow faster than males in the first eight months of cultivation. Therefore, cultivating a single-sex all-female variety can shorten the cultivation cycle and save land and bait costs. It is difficult to judge the sex of Siniperca chuatsi by morphological characteristics before sexual maturity, and it is even more difficult to distinguish pseudo-males from males by whether sperm are produced at sexual maturity. Analyzing its genomic sequence and developing sex-specific molecular markers are the basis for sex-controlled breeding.
[0003] Sex determination has always been a hot and difficult issue in biological research. As a lower vertebrate, understanding the sex regulation mechanism of Siniperca chuatsi is of great significance for understanding vertebrate sex differentiation and realizing the single-sex breeding of mandarin fish. Sex molecular markers, as the basic tools for studying sex determination mechanisms and sex control, have always been the forefront hotspots in the research of fish sex determination and sex control. Internationally, sex-specific molecular markers of different fish species have been searched for, and reliable genetic sex identification methods have been established. Therefore, developing sex-specific molecular markers for Siniperca chuatsi is of great significance for understanding sex determination mechanisms and for sex-controlled breeding. Summary of the Invention
[0004] The purpose of the present invention is to provide a specific molecular marker for genetic sex identification of Siniperca chuatsi, a primer for amplifying the specific molecular marker, and a kit.
[0005] The purpose of the present invention is also to provide a method for genetic sex identification of Siniperca chuatsi.
[0006] The last purpose of the present invention is to provide the application of a reagent for detecting the specific molecular marker, the primer, the kit or the method in genetic sex identification of Siniperca chuatsi, artificial cultivation of Siniperca chuatsi or all-female cultivation of Siniperca chuatsi.
[0007] The above first object of the present invention can be achieved by the following technical solution: A specific molecular marker for genetic sex identification of Siniperca chuatsi, the nucleotide sequence of the specific molecular marker is shown in SEQ ID NO.1 and SEQ ID NO.2. In female Siniperca chuatsi, only the molecular marker shown in SEQ ID NO.1 exists, and in male Siniperca chuatsi, both the molecular markers shown in SEQ ID NO.1 and SEQ ID NO.2 exist.
[0008] The specific molecular marker is a codominant genetic sex-specific molecular marker. There are two sequences in male fish and one sequence in female fish for this codominant genetic sex-specific molecular marker. It is equivalent to that female fish are homozygotes and there is only one band in electrophoresis, while male fish are heterozygotes and there are two bands in electrophoresis.
[0009] The present invention also provides a primer for amplifying the specific molecular marker. The primer includes an upstream primer F and a downstream primer R. The nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.4.
[0010] The present invention further provides a kit for genetic sex identification of Siniperca chuatsi, and the kit includes the above-mentioned primer.
[0011] The above second object of the present invention can be achieved by the following technical solution: A method for genetic sex identification of Siniperca chuatsi, using the above-mentioned primer to perform PCR amplification on the genomic DNA of the Siniperca chuatsi to be tested, and performing genetic sex identification of Siniperca chuatsi according to the detection result of agarose gel electrophoresis.
[0012] Preferably, the genomic DNA of Siniperca chuatsi is taken from the caudal fin tissue of Siniperca chuatsi.
[0013] Preferably, the genomic DNA is extracted from the tissue of the Siniperca chuatsi to be tested by using the column genomic extraction kit method or the chloroform extraction method.
[0014] Preferably, the column genomic extraction kit is a genomic DNA extraction kit for marine animal tissues, purchased from Tiangen Biochemical Technology (Shanghai) Co., Ltd.
[0015] Preferably, the reaction system for PCR amplification is 25 μL, including 12.5 μL of 2×Taq Master Mix, 2 μL of DNA template at 2 μg / mL, 1 μL of upstream primer F at 10 μM, 1 μL of downstream primer R at 10 μM, and 8.5 μL of ddH2O.
[0016] Preferably, the 2× Taq Master Mix contains 0.1 U Taq DNA Polymerase / mL, 500 mmol / L dNTP each, 50 mmol / L Tris-HCl (pH 8.7), 20 mmol / L KCl, and 4 mmol / L MgCl2.
[0017] Preferably, the reaction program for PCR amplification is: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 55°C for 25 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 5 min, cooled to 4°C for incubation.
[0018] Preferably, the mass percentage content of the agarose gel is 1%, and it is prepared using an electrophoresis buffer.
[0019] Preferably, the electrophoresis buffer is TAE, and electrophoresis is carried out at 150 V for 30 min.
[0020] Preferably, when the agarose gel electrophoresis detection result shows two bands of 584 bp and 288 bp, the gender of the tested mandarin fish Siniperca chuatsi is male; when the agarose gel electrophoresis detection result shows a single band of 584 bp, the gender of the tested mandarin fish Siniperca chuatsi is female.
[0021] The above last object of the present invention can be achieved by the following technical solution: the application of the reagent for detecting the specific molecular marker, the primer, the kit or the method in the genetic gender identification of mandarin fish Siniperca chuatsi.
[0022] The present invention also discloses the application of the reagent for detecting the specific molecular marker, the primer, the kit or the method in the artificial breeding of mandarin fish Siniperca chuatsi.
[0023] The present invention also discloses the application of the reagent for detecting the specific molecular marker, the primer, the kit or the method in the all-female breeding of mandarin fish Siniperca chuatsi.
[0024] The present invention has the following advantages: (1) Through the combined comparison and analysis of male and female genomes, the present invention found a gender-associated male-female differential fragment and designed a pair of primers for amplification verification. The results showed that both males and females could amplify bands. The female had a single band with a size of 584 bp, while the male had two bands with sizes of 584 bp and 288 bp respectively. Based on this band difference, the male and female could be accurately distinguished, and the identification effect was stable. Compared with the male-specific molecular fragment, this fragment could effectively exclude the false female judgment caused by amplification failure. (2)The present invention only requires a small amount of genomic DNA of the sample to be tested as a template, and can accurately, simply, quickly and stably identify the genetic genders of different individuals in each population of Siniperca chuatsi only through PCR and agarose gel electrophoresis, and is not restricted by the developmental stage of Siniperca chuatsi; (3)For the identification of juvenile and adult fish, only about 1 cm of fin tissue needs to be cut, which causes less harm to the fish body; (4)The present invention provides basic data for the further exploration of the sex determination gene of Siniperca chuatsi, and the developed molecular markers will also be beneficial to the development of related scientific research such as the sex determination mechanism of Siniperca chuatsi. The present invention also lays a foundation for sex-controlled breeding of Siniperca chuatsi. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The present invention will be further described below with reference to the accompanying drawings in conjunction with the embodiments.
[0026] Figure 1 It is the gel electrophoresis detection result of 5 female fish and 5 male fish using the primer pair for genetic sex identification of Siniperca chuatsi in Example 2; Figure 2 It is the sex identification result of Siniperca chuatsi from different population sources using the primer pair for genetic sex identification of Siniperca chuatsi in Example 3. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0027] In order to make the content of the present invention easier to understand, the technical solutions of the present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited thereto. Reagents or instruments without indicating the manufacturer can be obtained as conventional products through commercial purchase. Example 1
[0028] Obtaining specific molecular markers for genetic sex identification of Siniperca chuatsi and primer design S1: Preparation of mandarin fish DNA samples Eleven sexually mature Siniperca chuatsi were obtained from Qingyuan, Guangdong. According to the appearance of the gonads, they could be preliminarily judged to be divided into 5 males and 6 females, numbered M1-M5, F1-F6 respectively. After dissection of Siniperca chuatsi, the gonads were taken and fixed in Bouin's fluid, and after paraffin tissue sectioning and HE staining, the sex of Siniperca chuatsi was further verified. Another 5 g of dorsal muscle was taken from each Siniperca chuatsi and stored in liquid nitrogen, and about 3 cm of caudal fin was taken and stored in absolute ethanol. The muscle was used to prepare DNA samples by the conventional column centrifugation method (universal column genomic extraction kit, Beijing ComWin Biotech Co., Ltd.) with reference to the operation steps in the instruction manual, and the quality and concentration were detected by 1% agarose gel electrophoresis and a micro-spectrophotometer (NanoDrop2000) to ensure that the samples met the requirements of high-throughput sequencing.
[0029] S2: Construction of sequencing library and high-throughput sequencing Select 3 female fish samples and 3 male fish samples with the best DNA quality in the sampling population to construct a paired-end genomic DNA library with an insert size of 500 bp. Select the genomic sequencing data of the female individual and male individual with the highest sequencing depth for genome size assessment and assembly. Among them, the genome size assessment is mainly based on the correlation between kmer depth and frequency distribution. The analysis is carried out using the software jellyfish (2.2.10) for assessment, and the initial value of kmer is set to 21. The reference genome assembly adopts the de novo assembly strategy. According to the overlap relationship between the sequencing reads, the reads are assembled into contig sequences, and the contig sequences are further assembled into scaffold sequences based on the paired-end relationship of the sequencing. Use the software SOAPdenovo2 (version r241) and combine the multi-kmer assembly strategy, set the range of kmer parameters to vary from 35 bp to 75 bp, with an interval of 3 bp, and perform reference genome assembly on the female individual and male individual with the highest sequencing depth respectively. Finally, select the reference genome with the largest N50 value as the optimal reference genome.
[0030] S3: Screening of sex-specific molecular markers After obtaining the female and male reference genomes, align the sequencing reads of the remaining 2 male samples to the male reference genome respectively. Use the mem paired-end alignment method and default parameters in the bwa (version 0.7.17-r1188) alignment software for alignment. Then remove the sequencing reads that cannot be aligned to the reference genome at both ends. Finally, use the software samtools (version 1.9) to calculate the coverage information of each male reference genome sequence, and define the sequences covered by 2 male samples as male common DNA sequences. In addition, use the alignment software bwa (version 0.7.17-r1188) to align the 3 female sequencing reads to the male reference genome respectively. The sequencing reads aligned by females to the male reference genome do not need to be screened at both ends, and then use samtools (version 1.9) to calculate the coverage information of the male genome sequence. Finally, select the sequences that can be covered by the sequencing reads of 2 male genomes (i.e., common to 3 male samples) and cannot be covered by the sequencing reads of any female genome as potential male-specific sequences. The screening of female common sequences and specific sequences is corresponding to that of males.
[0031] Finally, a codominant molecular marker for genetic sex identification of Siniperca chuatsi was obtained. There are two sequences in male fish and one sequence in female fish for the codominant molecular marker, that is, the nucleotide sequences of the specific molecular marker (i.e., the codominant molecular marker) are shown in SEQ ID NO.1 and SEQ ID NO.2. Only the molecular marker shown in SEQ ID NO.1 exists in female Siniperca chuatsi, and both the molecular markers shown in SEQ ID NO.1 and SEQ ID NO.2 exist in male Siniperca chuatsi.
[0032] The specific molecular markers for genetic sex identification of Siniperca chuatsi are as follows: SEQ ID NO.1 (5'-3'): CCCCTGAAAGGGAACAGCCAAAA GGAAAAGAAGAAGACAGGTCAGATAAATTAAGTATGATGACAATAATACGGTATAAAGAAATAGTGCATGAACTGTCGAGTTAAGTGTAGCTTATTAAGATTATAATGAGACGGAGGATATTGCACAATTATGTCAAGTATTGCAGAGATGTTAATGATCAATGCCCAGTTTAGTGACTCAGGGTCACGCAGACTGACACTTAGAGGGAGGAGTTAAAGGGTTTGATGACTTCCTGTGGCGCTCTGTGGTGCATTGTGGGGGGATGAGTCTTCCGCTGAAGGTGCTCCTTTGTTTGACCAGCACGTCATGGAGCGGGTGGGAGACGCTGTCCAAGATGGCGTGTAGTTTGGCCAGCGTCCTCCTCTCTGACACCACCGCCAGAGAGTCCAGCTCCACCCCCACAATGTCACCGGTCCTTACGGGTCAGTTTGTTGAGCCTGTTAGCGTCCGCTACCCTCAGCCTGCTGCCCCAGCATGCAAACAGCACCACACCATCACACCAGCCGTTACAGCACAAGCTGGGTGTAATCCGGACAT TACAACATAGAGCCCAAGAAGTG。
[0033] SEQ ID NO.2 (5'-3'): CCCCTGAAAGGGAACAGCCAAAAGGAAAAGAAGAAGAAACAAGACTTGGAAGCGTTCTCAAAACATATCAATATTGTGGACCCCAACATCAAGTTCACACGAGAGGATGCCAAAGAGAACCGCCTGGCCTTTTTTGATTGTTCTACACTCAGACGAGAGGACGGAAAGCTCCAGATAGAAATGTACAGGAAACCAACACAGGATCAATACTTGCTCTTTGACTCACACCATCCATTACAGCACAAGCTGGGTGTAATTCGGACAT TACAACATAGAGCCCAAGAAGTG。
[0034] The underlined parts are the complementary sequences of the upstream primer F and the downstream primer R, respectively.
[0035] Design a pair of primers for the fragments with differences between male and female fragments as follows: Upstream primer F: 5'-CCCCTGAAAGGGAACAGCCAAAA-3' (as shown in SEQ ID NO.3); Downstream primer R: 5'-CACTTCTTGGGCTCTATGTTGTA-3' (as shown in SEQ ID NO.4).
[0036] This primer can also be used to prepare a genetic sex identification kit for Siniperca chuatsi. Example 2
[0037] A method for genetic sex identification of Siniperca chuatsi, comprising the following steps: (1) DNA extraction and PCR Take 5 female and 5 male Siniperca chuatsi samples from Example 1 and dilute the DNA to 2 μg / mL.
[0038] Take 12.5 μL of 2×Taq Master Mix [0.1 U Taq DNA Polymerase / mL, 500 mmol / L dNTP each, 50 mmol / L Tris-HCl (pH 8.7), 20 mmol / L KCl, 4 mmol / L MgCl2], 2 μL of DNA template, 1 μL of 10 μM upstream primer F, 1 μL of 10 μM downstream primer R, and 8.5 μL of ddH2O to prepare a 25 μL reaction system.
[0039] The PCR amplification reaction was carried out on a Bio-Rad T100 PCR instrument (USA), and the reaction conditions were set as follows: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 55°C for 25 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 5 min, and cooling to 4°C for incubation.
[0040] (2)Agarose gel electrophoresis and interpretation of genetic sex results Weighed 0.5 g of agarose and mixed it with 50 mL of TAE (1X), heated to boiling for about 1 min until the agarose was completely dissolved and then cooled. When the agarose gel cooled to about 45 - 50°C, 5 μL of the staining solution was added. The staining solution was 4S Gelred (10000X in water), purchased from Sangon Biotech (Shanghai) Co., Ltd. 5 μL of the PCR reaction product was added to each well, and electrophoresis was carried out at 150 V for 25 min. The ultraviolet imaging results were photographed in the gel imaging system.
[0041] The electrophoresis results were as Figure 1 shown. Among them, male fish showed 1 band (one with a molecular weight of 584 bp and one with a molecular weight of 288 bp), and female fish showed 1 band (with a molecular weight of 584 bp). Example 3
[0042] Application of primers for specific markers of genetic sex identification of Siniperca chuatsi in sex identification of Siniperca chuatsi from different population sources (1)Genomic DNA extraction and gonadal tissue sectioning Wild Siniperca chuatsi were obtained from Shaoguan, Guangdong (SGF1 - SGF12, SGM1 - SGM12) and Zhangjiajie, Hunan (ZJJF1 - ZJJF12, ZJJM1 - ZJJM12) respectively. After taking the gonads and performing histological sectioning to determine their sex, 12 female fish and 12 male fish were obtained respectively, numbered SGF1 - SGF12, SGM1 - SGM12, ZJJF1 - ZJJF12, ZJJM1 - ZJJM12. The TianGen Marine Animal Tissue Genomic DNA Extraction Kit was used for DNA extraction. The DNA quality and concentration were detected using a Nanodrop2000 spectrophotometer, and the DNA quality was further detected by 1% agarose gel electrophoresis and then stored at -20°C for standby.
[0043] (2)PCR amplification The genomic DNA samples of Siniperca chuatsi extracted in step (1) were diluted to 2 μg / mL, and using the diluted genomic DNA as a template, PCR amplification was carried out respectively using the primers in Example 1. The reaction system and reaction program of PCR amplification were both as described in Example 2.
[0044] (2)Analysis of gel electrophoresis results The PCR amplification products in step (2) were detected by electrophoresis using 1% agarose gel electrophoresis, and the results are as follows Figure 2 shown. From the electrophoresis results, it can be seen that all male individuals of Siniperca chuatsi amplified two bands (one with a molecular weight of 584 bp and one with a molecular weight of 288 bp), while only one specific band (with a molecular weight of 584 bp) was amplified in the female individuals of Siniperca chuatsi to be tested. The bands of females and males have obvious distinguishability, which can be used for distinguishing the sexes of females and males, and the identification results of genetic genders of females and males are consistent with the results of gonad sections. This indicates that the primer pair F / R developed based on the co-dominant molecular marker fragment of the present invention can accurately identify the genetic genders of Siniperca chuatsi from different population sources, and the accuracy rate is 100%. Example 4
[0045] Application of sex-specific molecular markers in all-female culture of Siniperca chuatsi (1) Induction of pseudo-male fish When the fry of Siniperca chuatsi are cultured to 10 days old, the bait fish are fed with eel feed containing 200 mg / kg of androgen 17α-methyltestosterone, and then the bait fish that have ingested the hormone feed are immediately fed to the mandarin fish. Feed continuously for two months. During the breeding period, natural light is adopted, the water temperature is 23 - 30 °C, and the feeding amount should not be too much to keep the fish in a non-satiated state, and feed continuously for two months.
[0046] (2) Screening of pseudo-male fish and all-female culture Take a tissue sample of about 3 cm of the caudal fin, and use the genetic gender identification method of Siniperca chuatsi in Example 2 to screen out pseudo-male fish (XX♂) with genetic gender of female. The identified pseudo-male fish (XX♂) are continuously cultured until sexual maturity and mated with normal XX female Siniperca chuatsi during the breeding season, and the offspring of Siniperca chuatsi obtained are all-female fish.
[0047] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention without departing from the principles and purposes of the present invention.
Claims
1. A specific molecular marker for genetic sex identification of Siniperca chuatsi, characterized in that, The nucleotide sequences of the specific molecular markers are shown in SEQ ID NO.1 and SEQ ID NO.
2. In female Siniperca chuatsi, only the molecular marker shown in SEQ ID NO.1 exists, while in male Siniperca chuatsi, the molecular markers shown in both SEQ ID NO.1 and SEQ ID NO.2 exist simultaneously.
2. A primer for amplifying the specific molecular marker described in claim 1, characterized in that, The primer includes an upstream primer F and a downstream primer R. The nucleotide sequence of the upstream primer F is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO.
4.
3. A kit for genetic sex identification of Siniperca chuatsi, characterized in that, The kit includes the primer described in claim 2.
4. A method for genetic sex identification of Siniperca chuatsi, characterized in that, The genomic DNA of the Siniperca chuatsi to be tested is subjected to PCR amplification using the primer described in claim 2, and the genetic sex of the Siniperca chuatsi is identified according to the detection results of agarose gel electrophoresis.
5. The method according to claim 4, characterized in that, The reaction system for PCR amplification is 25 μL, including 12.5 μL of 2×TaqMaster Mix, 2 μL of DNA template at 2 μg / mL, 1 μL of upstream primer F at 10 μM, 1 μL of downstream primer R at 10 μM, and 8.5 μL of ddH2O.
6. The method according to claim 4, wherein The reaction procedure for PCR amplification is: pre-denaturation at 95°C for 4 min; denaturation at 95°C for 30 s, annealing at 55°C for 25 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 5 min, and cooling to 4°C for incubation.
7. The method according to claim 4, wherein When the detection results of agarose gel electrophoresis show two bands of 584 bp and 288 bp, the sex of the Siniperca chuatsi to be tested is male; when the detection results of agarose gel electrophoresis show a single band of 584 bp, the sex of the Siniperca chuatsi to be tested is female.
8. Application of the reagent for detecting the specific molecular marker described in claim 1, the primer described in claim 2, the kit described in claim 3, or the method described in any one of claims 4-7 in the genetic sex identification of Siniperca chuatsi.
9. Application of the reagent for detecting the specific molecular marker described in claim 1, the primer described in claim 2, the kit described in claim 3, or the method described in any one of claims 4-7 in the artificial breeding of Siniperca chuatsi.
10. Application of the reagent for detecting the specific molecular marker described in claim 1, the primer described in claim 2, the kit described in claim 3, or the method described in any one of claims 4-7 in the all-female breeding of Siniperca chuatsi.
Citation Information
Cited By
Molecular marker related to siniperca chuatsi excellent feed utilization character and application
CN121182988A
Molecular marker primer pair, kit, application and method for identifying sex of siniperca chuatsi
CN121826179A
Siniperca chuatsi sex identification molecular marker and application thereof
CN121992091A
A molecular marker for identifying the gender of protocobitis typus and application thereof
CN121992091B