Lentiviral vector and methods for labeling and monitoring cell state in real-time

Abstract

A lentivlral vector for real-time monitoring of cell state which includes a regulatory element that regulates expression of a selection marker, wherein the regulatory element comprises cell-state-specific histone H3K27-acetylation marks and / or chromatin accessibility. Methods of identifying a cell- state-specific regulatory element in a cell; optically screening a compound for the ability to modify cell identity; in vivo labeling normal and / or diseased cells at a specific developmental stage or a specific stage of disease; and real- time monitoring of transcription of a cell exposed to a stress using the lentiviral vector.

Description

SJ0118WO PATENTLENTIVIRAL VECTOR AND METHODS FOR LABELING AND MONITORING CELL STATE IN REAL-TIMECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit from U . S . Patent Application Serial No . 63 / 689 , 029 , filed August 30, 2024 , the content of which is incorporated herein by reference in its entirety .STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grant no . CA245251 awarded by the National Institutes of Health . The government has certain rights in this invention .STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0003] A Sequence Listing in XML format, entitled S J0118WO_ST26 . xml , 25 , 572 bytes in size , generated on June 23, 2025, is filed herewith . This Sequence Listing is hereby incorporated herein by reference into the specification for its disclosures .BACKGROUND

[0004] Cell state is programmed by the collective activity of multiple master transcription factors, which control the expressed transcriptome . Changes in cell state are fundamental to normal development and cancer pathogenesis . During transitions in cell state , alterations in the transcriptome are reflected in the loss and gain of cellular properties . Changes in the transcriptome of a cell are achieved through modulation of epigenetic state marked by regulatory chromatin, providing new sites for transcription factor and co-activator binding . These changes are key to understanding cell behaviors in different contexts , including normal growth,SJ0118WO PATENT differentiation and lineage specification, in addition to the acquisition of undesirable phenotypic outcomes , such as cancer cell resistance to chemotherapy and metastatic potential .

[0005] In normal cells , cell state transitions are typically unidirectional , and following lineage commitment , proceeding from less differentiated to more differentiated states . In cancer cells , however, these states may be bidirectional , and are influenced by the dynamic activity of epigenetic factors . The contribution of genetic mutation to cell identity has been a maj or focus of research, leading to the development of techniques assessing clonal single-cell genomes . However, the role of gene regulatory alterations that drive cell state transitions to enable distinct cell properties , in the absence of mutation has been less well studied. Conventional models for studying cell state transitions typically rely on static labelling of state through cell surface markers or barcoding methods, which have been instructive , but are unable to resolve real-time, flexible changes in epigenetically- controlled gene regulatory cell state . Alternative methods , such as promoter-centered or entirely synthetic reporter constructs that demonstrate the activity of specific transcription factors have been developed (Graybuck et al . (2021 ) Neuron 109 : 1449-1464 ; Schmitt et al . (2021) Cancer Discov. 11 : 754 -777 ) , though these require a priori understanding of the specific transcription factors involved in a particular cell state, which may not be known . These issues highlight a fundamental problem in visualizing changes in cell state, which limits the ability to identify mechanisms to control normal and pathogenic cell state changes .SUMMARY OF THE INVENTION

[0006] Provided herein is a lentiviral vector for real-time monitoring of cell state comprising ( i ) a first nucleic acidSJ0118WO PATENT encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell-state-speci fic histone H3K27 -acetylation marks and / or chromatin accessibility; and ( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter .

[0007] Also provided herein is a method of identifying a cellstate-specific regulatory element in a cell comprising (a ) detecting a genomic region in the cell that is preferentially marked by histone H3K27 -acetylation and / or chromatin accessibility when the cell is in a first state as compared the cell in a second state; (b) introducing said genomic region preferentially marked by histone H3K27-acetylation and / or chromatin accessibility into a lentiviral vector comprising(i) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and the cell-state-specific regulatory element , and(ii) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter; ( c) introducing the lentiviral vector into a population of host cells ; (d) selecting, from the population of host cells , a host cell that expresses the second selection marker; and (e) determining whether the first selection marker is expressed by the host cell of (d) when the host cell is in the first state as compared the second state , thereby identifying the cell-state-specific regulatory element .

[0008] Further provided is a method of optically screening a compound for the ability to modify cell identity comprising ( a) introducing into a population of host cells a lentiviral vector comprising (i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operablySJ0118WO PATENT linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27- acetylation marks and / or chromatin accessibility; and ( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter ; (b) selecting, from the population of host cells, a host cell that expresses the second selection marker; ( c) contacting the selected host cell of (b) with a test compound; and (d) measuring expression of the second selection marker by the cells of ( c) , wherein the level of expression of the second selection marker is indicative of test compound' s ability to modify cell identity.

[0009] A method of in vivo labeling normal and / or diseased cells at a specific developmental stage or a specific stage of disease is also provided, the method comprising the step of introducing into a population of normal cells , diseased cells , or combination , thereof a lentiviral vector comprising ( i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27 -acetylation marks and / or chromatin accessibility, wherein the differential cell state-speci fic histone H3K27-acetylation marks and / or chromatin accessibility of the regulatory element are associated with a specific developmental stage or a specific stage of disease ; and ( ii) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter , thereby in vivo labeling the normal and / or diseased cells at a specific developmental stage or a specific stage of disease .

[0010] A method for real-time monitoring of transcription of a cell exposed to a stress is also provided, the method comprising the steps of (a ) introducing into a population ofSJ0118WO PATENT cells a lentiviral vector comprising ( i ) a first nucleic acid encoding a first selection marker , said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having dif ferential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility; and ( ii) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter ; (b) selecting, from the population of host cells , a host cell that expresses the second selection marker ( c) exposing the selected host cell of (b) to a stress; and (d) measuring expression of the second selection marker by the cells of (c ) , thereby monitoring transcription in the cell exposed to the stress in real-time .BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIG . 1 provides an example of a lentiviral vector for labeling and monitoring cell state in real-time .

[0012] FIG . 2 shows results of a cell growth assay in CHP212 , mKate2hi9hand mKate2lowin response to the treatment of chemotherapeutic agents ( Doxorubicin and Etoposide) (bars = mean ± SD; n - 3 biological replicates ) . F-values were determined via two-tailed unpaired t-test . ****p-value < 0. 0001 .

[0013] FIG . 3 shows H3K27Ac CUT&RUN-sequencing visualization tracks at the TRECS-N1 locus and a distal contiguous locus in sorted subpopulations of mKate2hi9hand mKate2lowcells derived from transduced CHP212 and SKNAS cells . H3K27AC tracks are representative of n=3 independent biological replicates .

[0014] FIG . 4 shows bar plots of changes in mKate2 intensity / cell for the top compounds showing minimal effect on cell number with reduction of mKate2 signal in GIMEN cells transduced with full length TRECS-N1 .SJ0118WO PATENTDETAILED DESCRIPTION OF THE INVENTION

[0015] A transcriptional reporter element system for reporting cell state in real-time has now been developed for monitoring or determining a cell state , cell identity, or cell type . The vector and methods herein are based upon the identification of a cell state associated locus (regulatory element ) that is differentially active in distinct cell states . In particular, cell-state-specific regulatory elements were identified by differential activity of loci as measured by chromatin binding data of activating marks , such as H3K27ac-marked nucleosomes or accessible chromatin marked by ATAC-seq . By way of illustration, cells that predominantly represent distinct neuroblastoma cell states , referred to as MES (mesenchymal) and ADRN (adrenergic) cells, based on their RNA-seq profiles, were used to identify cell-state-specific regulatory elements . Neuroblastoma cell lines were separated into ADRN and MES subtypes and publicly available matched chromatin sequencing data were used to identify regions of the genome that were preferentially marked by histone H3K27- acetylation or accessible chromatin in MES vs . ADRN cells . This unbiased, computational approach identified regions of the genome selectively marked by H3K27ac or accessible chromatin in ADRN versus MES cells . Individual regulatory element loci were then subcloned upstream ( 5' ) of a weak promoter operably linked to a nucleic acid encoding a reporter protein of a lentiviral vector . Regulatory elements were identified based upon their selective and differential activity in one of many cell types . Upon transduction, expression of the reporter signified that the cells adhered to a specific cell type . This was due to binding of transcription-controlling proteins , normally bound at a transcriptional regulatory element locus in the native genome ,SJ0118WO PATENT to the cell state regulatory element of the vector . As an example, MES-associated regulatory element loci were identified . The expression of the fluorescence reporter was confined to MES-like cells , and was responsive to a cadre of MES transcription factors . In this example of the system, the reporter is a measure of MES state adherence .

[0016] Cell state is flexible , and it is known that ADRN and MES cells may switch between each other (Thirant et al . (2023) Na ture Commun . 14 : 2575 ) . This is further evidenced during normal development, where cell state changes as cells differentiate normally, for example from embryonic stem cell to differentiated cells like neurons , cardiomyocytes or others . It was observed that cells containing the reporter can flexibly turn their fluorescence on or off . In the present case, fluorescence indicated the MES state , and lack of fluorescence indicated the ADRN state . Thus , the system / vector allowed for real-time monitoring of cell state, and isolation of cells (even rare populations) , which may exist in heterogenous systems such as tumors . The flexibility of the system / vector was also harnessed to identify chemical methods to force cells to transition from MES to ADRN , which is associated with increased sensitivity to chemotherapy . For example, this system / vector was used to identify that inhibition of EP300 / CBP proteins forced cells to go from MES ( chemoresistant ) to ADRN (chemosensitive ) states , which corresponded with the acquisition of chemosensitivity .

[0017] Accordingly, provided herein is a system or vector and method for selectively labeling individual cells that ascribe to a specified cell identity. The vector is a lentiviral vector including ( i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell-state-specific histone H3K27-acetylationSJ0118WO PATENT marks and / or accessible chromatin; and (ii) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter .

[0018] This system and methods herein take advantage of gene expression signatures to identify individual H3K27ac-marked regions and / or chromatin accessibility of the genome, which are preferentially and differentially active in cells in distinct cell states . This system is distinct from traditional cell surface marker staining or reporter systems since reporter systems usually are based on gene promoters or linked directly to gene expression and only reflect or report the expression of a single gene . In contrast, the system and methods herein integrate hundreds of genes to yield an output . In addition , the system herein is generic across cell types , since H3K27ac marks and chromatin accessibility reflect gene activation in all known cell types . Further, this system works in living cells , uses a lentiviral vector that provides for long-term expression, responds to endogenous protein transcription factors that directly control cell state, and uses individual endogenous genomic loci , rather than synthetic chains of enhancers .

[0019] As used herein, a "vector" is a composition of matter that includes an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell . In one embodiment, the vector is an expression vector . "Expression vector" refers to a vector including a recombinant nucleic acid comprising expression control sequences operatively linked to a nucleic acid sequence to be expressed . An expression vector includes sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system . The expression vector may be a bicistronic or polycistronic expression vector . Bicistronic or polycistronic expressionSJ0118WO PATENT vectors may include (1) multiple promoters fused to each of the open reading frames; (2) insertion of splicing signals between genes; fusion of genes whose expressions are driven by a single promoter; (3) insertion of proteolytic cleavage sites between genes (self-cleavage peptide) ; and (iv) insertion of internal ribosomal entry sites (IRESs) between genes .

[0020] In an embodiment, the vector is a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. ( (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) , and in other virology and molecular biology manuals. In general, a suitable viral vector contains an origin of replication functional in at least one organism, at least one promoter sequence, convenient and unique restriction endonuclease sites, and one or more selectable markers (e.g. , WO 01 / 96584; WO 01 / 29058; and US Patent No. 6,326,193) .

[0021] In an embodiment, the viral vector is a lentiviral vector. Lentiviral vectors are a type of retrovirus that can infect both dividing and nondividing cells because their preintegration complex (virus "shell") can get through the intact membrane of the nucleus of the target cell. Lentiviruses can be used to provide highly effective gene therapy / transfer as lentiviruses can change the expression of their target cell's gene for up to six months. They can be used for nondividing or terminally differentiated cells such as neurons, macrophages, hematopoietic stem cells, retinal photoreceptors, and muscle and liver cells. Examples of lentiviruses are human immunodeficiency virus (HIV) (strain 1 and strain 2) , simian immunodeficiency virus (SIV) , feline immunodeficiency virus (FIV) , BLV, EIAV, CEV and visna virus. In some embodiments, the lentiviral vector is a primate lentiviral vector (US Patent No. 5,665,577) or a felineSJ0118WO PATENT iiranunodeficiency virus (FIV) (Poeschla et al. (1998) Wat. Medicine 4:354-357) . HIV is a very effective lentiviral vector. A vector containing such a lentivirus core (e.g. , gag gene) can transduce both dividing and non-dividing cells.

[0022] As indicated herein, the vector (e.g., lentiviral vector) includes a first nucleic acid and second nucleic acid. As used herein, a "nucleic acid" refers to a nucleotide sequence comprising DNA or RNA. The first nucleic acid and / or second nucleic acid may be naturally occurring or an artificial or synthetic molecule. In some embodiments, the first nucleic acid and / or second nucleic acid is exogenous to a host cell and may be introduced into a host cell as part of an exogenous nucleic acid molecule, such as a vector.

[0023] As used herein, "endogenous" refers to any material from or produced inside an organism, cell, tissue or system. The term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system. "Exogenous" also includes a native coding region, or portion thereof, that is reintroduced into the source organism in a form that is different from the corresponding native gene, e.g., not in its natural location in the organism's genome. An exogenous nucleic acid or gene may be introduced into the host organism or cell by, e.g. , gene transfer. An exogenous gene may include a native coding region with non-native regulatory regions that is reintroduced into the native host.

[0024] In some embodiments, the first nucleic acid and second nucleic acid each include nucleotide sequences encoding a selection marker (e.g., a first selection marker and a second selection marker) . A "selection marker" refers to a molecule (e.g., protein) that confers onto an organism or cell a detectable or selectable phenotype. In some embodiments, the selection marker confers an optically visible or detectable phenotype, e.g., a colorimetric, fluorescent or luminescentSJ0118WO PATENT(bioluminescent ) phenotype . In some embodiments , the selection marker may be a fluorescent marker protein such as a green fluorescent protein (GFP) marker, an enhanced GFP (eGFP ) marker, a synthetic GFP marker, a yellow fluorescent protein (YFP) marker, an enhanced YFP (eYFP) marker, a cyan fluorescent protein (CFP) marker, a red fluorescent protein ( RFP) marker ( e . g. , mKate2 ) , an mPlum marker, an mCherry marker, a tdTomato marker, an mStrawberry marker, a J-red marker, a DsRed-monomer marker, an mOrange marker, an mKO marker, an mCitrine marker, a Venus marker, a YPet marker, an Emerald6 marker, a CyPet marker, an mCFPm marker, a Cerulean marker, a T-Sapphire marker; a luminescent marker protein such as luxA, luxB, luxAB, luc, rue , or nluc ; or a colorimetric marker protein, e . g. , p-galactosidase ( lacZ ) , horseradish peroxidase ( HRP) , or alkaline phosphatase (AP) , that catalyzes a reaction that produces a colored substance in the presence of a suitable substrate . In some embodiments, the first selection marker is a fluorescent protein . In some embodiments, the second selection marker is a fluorescent protein .

[0025] In some embodiments, the selection marker confers a selectable phenotype , e . g. , antibiotic resistance phenotype . In some embodiments , the selection marker may be an aminoglycoside phosphotransferase (APR) ( e . g. , hygromycin phosphotransferase (HYG) , neomycin and G418 APH) , dihydrofolate reductase ( DHFR) , thymidine kinase (TK) , glutamine synthetase ( GS) , asparagine synthetase , tryptophan synthetase ( indole) , histidinol dehydrogenase (histidinol D) , or nucleic acids encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol , Zeocin, or mycophenolic acid . In some embodiments , the first selection marker confers resistance to an antibiotic . In some embodiments , the second selection marker confers resistanceSJ0118WO PATENT to an antibiotic. In some embodiments, the second selection marker comprises a puromycin resistance protein or blasticidin resistance protein.

[0026] In some embodiments, the selection marker is a cell surface receptor, e.g., an Interleukin 2 receptor (IL2R) . In some embodiments, the selection marker is toxic to a host cell, e.g. , the selection marker may be activated caspase 9 or simian diphtheria toxin receptor.

[0027] The first selection marker may be used to indicate the presence of a particular intracellular molecule (e.g., transcription factor) , or a particular cell (e.g. , cell type), as described herein. The second selection marker may be used as a marker for successful uptake of a nucleic acid molecule or exogenous sequence (e.g. , lentiviral vector) into a cell. In some embodiments, the first selection marker and the second selection marker are the same type of marker, e.g. , the first selection marker is a first fluorescent marker protein and the second selection marker is a second fluorescent marker protein, wherein the first and second fluorescent marker proteins are different. In some embodiments, the first selection marker and the second selection marker are different types of markers, e.g. , the first selection marker is a fluorescent marker protein and the second selection marker confers antibiotic resistance.

[0028] In some embodiments, the first nucleic acid and second nucleic acid are each operably linked to a promoter. As used herein, the term "operably linked" refers to a juxtaposition of two or more components, wherein the components are in a relationship permitting them to function in their intended manner. For example, a promoter and / or a regulatory element is operably linked to a coding sequence if the promoter and / or regulatory element acts to modulate the transcription of the coding sequence. In some embodiments, DNA sequences that areSJ0118WO PATENT"operably linked" are contiguous and adjacent on a single nucleic acid molecule. In some embodiments, an operably linked promoter is located upstream of the coding sequence and may be adjacent to it. In some embodiments, e.g., with respect to regulatory element sequences modulating the expression of a coding sequence, the two components may be operably linked although not be adjacent. A regulatory element is operably linked to a coding sequence if the regulatory element modulates (e.g. , increases) transcription of the coding sequence. Operably linked regulatory elements may be located upstream, within, or downstream of coding sequences and may be located at some distance from the promoter of the coding sequence, e.g. , about 10 to about 10000 bp (e.g., about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 bp) from the coding sequence. In some embodiments, a regulatory element is located upstream of a coding sequence. Operable linkage , au be accomplished by recombinant methods known in the art, e.g. , using PCR methodology and / or by ligation at convenient restriction sites. If convenient restriction sites do not exist, then synthetic oligonucleotide adaptors or linkers can be used in accord with conventional practice.

[0029] As used herein, the term "about" means within 10% of a reported numerical value, e.g. , +10%, ±5%, +4%, ±3%, ±2%, +1%, or ±0.1% of the reported numerical value.

[0030] As used herein, the term "promoter" refers to a regulatory region of DNA generally located upstream (toward the 5' region of the sense strand) of a coding sequence that allows transcription of the coding sequence. The promoter contains specific DNA sequences and response elements that are recognized by proteins known as transcription factors. These factors bind to promoter sequences, recruiting RNA polymerase,SJ0118WO PATENT the enzyme that synthesizes the RNA from the coding region of a gene. A promoter may be about 100 bp to about 10000 bp in length, e.g., about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 bp. A promoter may be constitutive or inducible.

[0031] The term "constitutive" use herein refers to "all the time" or constantly. For example, a gene product that is expressed all the time is constitutively expressed. A "constitutive" promoter is active all the time, transcribing the attached nucleic acids to primary RNA transcript all the time. Such a promoter is unregulated and it allows for continual transcription of its associated gene. Examples of "constitutive" eukaryotic promoters include the immediate early cytomegalovirus (CMV) promoter sequence and Elongation Growth Factor-la (EF-la) . Other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV) , human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as mammalian gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, the creatine kinase promoter, the Ubiquitin C (UBC) promoter, and the phosphoglycerate kinase 1 (PGK) promoter, or a part thereof. In some embodiments, the promoter is a CMV promoter. In some embodiments, the second nucleic acid is operably linked to a mammalian PGK promoter, e.g.fmouse PGK (mPGK) promoter.

[0032] As used herein, the term "inducible" refers to regulatable. For example, the activity of an inducible promoter can be turned on or off, i.e., regulated by the presence or absence of biotic or abiotic factors. Examples of inducible promoters include, e.g. , chemically-regulatedSJ0118WO PATENT promoters, including promoters whose transcriptional activity is regulated by the presence or absence of alcohol , tetracycline , steroids , metal and other compounds ; and physically-regulated promoters , including promoters whose transcriptional activity is regulated by the presence or absence of light and low or high temperatures . Chemically inducible promoters may have hormone-responsive elements (HREs ) , metal-responsive elements (MREs ) , heat shock- responsive elements (HSREs ) , tetracycline operator sequence (TetO) and interferon-responsive elements ( IREs ) .

[0033] In some embodiments , the first nucleic acid of the lentiviral vector herein is operably linked to a minimal promoter . A "minimal promoter, " "core promoter, " or "basal promoter" refers to the smallest portion of a promoter that has the ability to drive transcription at a detectable level . For purposes of the present disclosure, a "minimal promoter" may contain up to an additional 50 , 100, or 200 bp of sequence flanking either or both sides of this smallest portion . For example, if the smallest portion of a naturally occurring promoter that has the ability to drive transcription at a detectable level extends from -100 to +50 (with +1 representing the transcription start site (TSS ) ) , then a minimal promoter may include a sequence that extends from -300 to +250 . In some embodiments , a minimal promoter is able to drive transcription at a level of 50% , 60%, 70% , 80% , or 90% of the level of a naturally occurring promoter region from which it is derived, e . g. , between about 50% and about 75% or between about 75% and about 100% of the level of the promoter from which it is derived, when measured under the same or comparable conditions using the same or a comparable assay . In some embodiments , a minimal promoter is characterized in that removal of at least 50 nt, at least 100 nt , or at least 200 nt from either or both ends, would markedly reduce theSJ0118WO PATENT level of transcription, e.g. , by at least 50%, or at least 75%. Canonical regions associated with a minimal promoter include, e.g. , the CAAT box, TATA box, and the transcriptional start site. In some embodiments, the first nucleic acid of the lentiviral vector herein is operably linked to a CMV minimal promoter (e.g. , SEQ ID NO:1) .

[0034] To regulate expression of the first selection marker in a cell-state-specific manner, the lentiviral vector further includes a regulatory element operably linked to the first nucleic acid and minimal promoter (e.g. , CMV minimal promoter) . In some embodiments, the term "regulatory element" is not intended to include a promoter. As used herein, a regulatory element may include an enhancer, super-enhancer, insulator, facilitator, or repressor. In some embodiments, a regulatory element may be an enhancer. An "enhancer" refers to a cis-acting DNA sequence that can modulate (e.g., increase) the transcription of genes. Regulatory elements such as enhancers may function independently of orientation and at various distances from their target promoter (or promoters) . The identification of regulatory elements such as enhancers has proved challenging because enhancers are scattered across the 98% of the human genome that does not encode proteins, resulting in a large search space and, while it is known that they regulate genes in cis, their location relative to their target gene (or genes) may vary, e.g., they may be found upstream or downstream of genes or within introns. Furthermore, regulatory elements such as enhancers do not necessarily act on the respective closest promoter but can bypass neighboring genes to regulate genes located more distantly along a chromosome. In addition, individual regulatory elements such as enhancers have been found to regulate multiple genes, adding further complexity to their functional annotation. Moreover, in contrast to the well-SJ0118WO PATENT defined sequence code of protein-coding sequences, the general sequence code of regulatory elements such as enhancers, if one exists at all, is poorly understood. Thus, enhancers cannot be identified computationally from DNA sequence alone with high confidence.

[0035] As used herein, a "regulatory element," e.g. , enhancer, is a nucleic acid sequence, region of genomic DNA, or locus that modulates the activity (e.g. , transcription) of a locus (e.g., gene) . In some aspects, a regulatory element is a cell state-specific regulatory element. A "cell statespecific regulatory element" is a regulatory element that is active (e.g., capable of modulating transcription) in a distinct cell state relative to its activity in cells that are not in that state. For example, the cell state-specific regulatory element may be characterized in that inhibiting its activity (e.g. , by modulating (e.g. , decreasing) transcription factor binding) causes the cell to cease being in a particular state, e.g., causes the cell to enter a different state, or causes a cell that is not in a particular state to assume that state. Specific cell states in accordance with the vector / system and methods herein include, but are not limited to, cells of a particular tissue or cell type, cells at a particular time point in life, or cells in a specific physiological, pathological or environmental stress or condition. A cell state may be the result of an internal and / or external stimulus that alters the transcriptome of the cell thereby resulting in different phenotypes that are not genetically programmed.

[0036] In some embodiments, a cell state-specific regulatory element is characterized by the presence or absence of epigenetic marks, e.g., acetylated histones such as H3K27, H3K4, H3K9, H3K14, H3K18, H3K23, H4K5, H4K8, H4K12, and H4K16, e.g. , methylation of lysine residues may be either associatedSJ0118WO PATENT with transcriptional repression (H3K9 , H3K27 , and H4K20 ) or activation (H3K4 , H3K36, and H3K79) depending on which amino acid and to what extent (monomethylation, dimethylation, or trimethylation) . In some embodiments , cell state-specific regulatory elements are characterized by an enrichment in acetylated H3K27 (H3K27Ac marks ) . In some embodiments, cell state-specific regulatory elements are characterized by an enrichment in accessible chromatin . In some embodiments , a regulatory element is selected for having differential cell state-specific histone H3K27-acetylation marks . A " regulatory element selected for having differential cell state-specific histone H3K27 -acetylation marks" refers to a regulatory element that has differential and / or preferential histone H3K27-acetylation marks when a cell is in a first state as compared to the same cell in a second state . In some embodiments, a "regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks" may be devoid of H3K27-acetylation marks when a cell is in a first state and have one or more H3K27-acetylation marks when a cell is in a second state .

[0037] The term "chromatin accessibility" refers to the degree to which nuclear macromolecules are able to contact DNA in the chromatin complex . Accessible chromatin allows for interaction of transcription factors and recruitment of other macromolecules , which regulate processes including gene expression . Chromatin accessibility may be determined by conventional methods such as Transposase Accessible Chromatin using sequencing (ATAC-seq) .

[0038] According to some embodiments , provided herein is a method of identifying a cell state-specific regulatory element , e . g. , enhancer, in a cell by (a ) detecting a genomic region in the cell that is preferentially and / or differentially marked by histone H3K27-acetylation and / orSJ0118WO PATENT chromatin accessibility when the cell is in a first state as compared the cell in a second state; (b) introducing ( e . g. , cloning ) said genomic region preferentially and / or differentially marked by histone H3K27-acetylation and / or chromatin accessibility into a lentiviral vector comprising( i ) a first nucleic acid encoding a first selection marker , said first nucleic acid being operably linked to a minimal promoter and the cell-state-specific regulatory element , and( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter; (c) introducing or transducing the lentiviral vector into a population of host cells ; ( d) selecting, from the population of host cells, a host cell (or one or more host cells ) that expresses the second selection marker ( e . g. , by optical detection or antibiotic resistance) ; and (e) determining whether the first selection marker is expressed by the host cell of (d) when the host cell is in the first state as compared the second state thereby identifying the cell-state-specific regulatory element . In some embodiments , the cell-state-specific regulatory element is an enhancer . In some embodiments , the cell-state-specific regulatory element is in a neuroblastoma cell, e. g. , a MES or ADRN cell .

[0039] A genomic region in the cell that is preferentially and / or differentially marked by histone H3K27-acetylation and / or chromatin accessibility when the cell is in a first state as compared the cell in a second state may be detected using chromatin immunoprecipitation (ChIP) followed by sequencing (ChlP-Seq) or followed by microarray hybridization (ChlP-Chip) or other methods known in the art , e . g. , CUT&RUN or CUT&TAG . These methods may also or alternately be used to detect occupancy of genomic DNA by transcription factors ( or other proteins ) .SJ0118WO PATENT

[0040] In some embodiments, the cells that may be used in conjunction with the methods herein are eukaryotic cells. In some embodiments, the cell is a vertebrate cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell, a non-human primate cell, a rodent cell (e.g., a mouse, rat, hamster, or guinea pig cell) , or rabbit cell. In some embodiments, the mammalian cell is a bovine, ovine, caprine, equine, porcine, canine, or feline cell. Host cells may be primary cells or cells of a cell line generated using methods known in the art or obtained, e.g., from depositories or cell banks such as the American Type Culture Collection (ATCC) , Coriell Cell Repositories, Deutsche Sammlung von Mikroorganismen und Zellkulturen (German Collection of Microorganisms and Cell Cultures; DSMZ) , European Collection of Cell Cultures (ECACC) , Japanese Collection of Research Bioresources ( JCRB) , RIKEN, Cell Bank Australia, and the like.

[0041] In some embodiments, a cell in a first state and a second state may comprise a cell of a first tissue or type and a cell of a second tissue or type, a cell at a first developmental stage and / or differentiation stage and a cell at a second developmental stage and / or differentiation stage, or a cell in a first physiological, pathological or environmental stress or condition and a cell in a second physiological, pathological or environmental stress or condition. In some embodiments, a cell in a first state and a second state may comprise a MES cell and a ADRN cell.

[0042] "Cell type" is used interchangeably herein with "cell identity". Cell types that may be compared in the methods herein include, but are not limited to, adipocyte (e.g., white fat cell or brown fat cell) , cardiac myocyte, chondrocyte, endothelial cell, epidermal cells, epithelial cells, exocrine gland cell, fibroblast, glial cell, hematopoietic cells,SJ0118WO PATENT hepatocyte, hair follicle cells, keratinocyte, macrophage, melanocyte, monocyte, mononuclear cell, myeloid cell, neuron, neutrophil, osteoblast, osteoclast, pancreatic islet cell (e.g., a beta cell) , Sertoli cell, skeletal myocyte, smooth muscle cell, B cell, plasma cell, T cell (e.g., regulatory, cytotoxic, helper) , or dendritic cell. In some embodiments a cell types are lineage specific, e.g. , it is specific to a particular lineage (e.g. , hematopoietic, neural, muscle, etc.) . For example, a cell-state-specific regulatory element is active in a keratinocyte, but is not active in epidermal cells .

[0043] "Developmental stage" refers to any distinct stage in the life cycle of an organism. Developmental stages of a cell that may be compared in the methods herein include, but are not limited to, immature embryonic cells, mature embryonic cells, adolescent cells, adult cells, elderly cells. For example, a cell-state-specific regulatory element is active in an adult stem cell, e.g. , a hematopoietic stem cell, neural stem cell, intestinal stem cell, mammary stem cell, mesenchymal stem cell, olfactory stem cell, or neural crest stem cell, but is not active in at least one other type of adult stem cell. "Differentiation stage" refers to the successive steps of differentiation of a cell from a stem cell, progenitor cell, or precursor cell to an immature or mature cell. By way of illustration, a cell-state-specific regulatory element is active in a bone marrow hematopoietic stem cell (hematopoietic bone marrow progenitor cell) but not immature dendritic cells or mature dendritic cells. Cells in different stages of the cell cycle may also be compared, e.g. , Gl, S, G2, and M.

[0044] A "physiological condition" or "physiological stress" refers to factors or states within an organism that can influence its functioning, such as temperature, hormones orSJ0118WO PATENT pH levels. Examples of physiological stresses or conditions of a cell that may be compared in the methods herein include, but are not limited to, cells exposed to a hormones such as testosterone, estrogen, etc.

[0045] A "pathological condition" or "pathological stress" refers to a state that deviates from normal functioning and is considered harmful to an organism, e.g., a disease, syndrome or disorder. Cells of a disease or disorder (also referred to herein as "diseased cells") may include, but are not limited to, cells of a tumor (e.g. , solid tumors such as bladder, bone, brain (e.g., glioblastoma or neuroblastoma) , breast, cervical, colon, endometrial, esophageal, gastric, liver (e.g. , hepatocellular carcinoma) , lung, ovarian, pancreatic, prostate, renal, skin, testicular, and thyroid carcinomas and sarcomas; hematologic malignancies such as leukemias, lymphomas, and myeloma; melanoma, retinoblastoma, and neuroblastoma) , neurodegenerative disorder such as Alzheimer’s disease, autism spectrum disorders, autoimmune disorders (e.g., rheumatoid arthritis, lupus) , cardiovascular disease, male infertility, psychiatric disorders (e.g., bipolar disorder, depression, schizophrenia) , Rett syndrome, and Fragile X syndrome.

[0046] An "environmental condition" or "environmental stress" refers to the physical, biological, and / or atmospheric factors that surround and affect a cell, tissue or organism. Environmental stresses or conditions may include, are not limited to, a particular substance (e.g. , toxin, drug or nutrient) , temperature, humidity, pH, and the like.

[0047] In some embodiments, a cell in a first state may be a cell in a particular physiological, pathological or environmental stress or condition, as described herein, as compared to a control cell, e.g.za normal or healthy cell. Control cells may be of the same cell type, developmentalSJ0118WO PATENT stage, and / or differentiation state as cells for which they serve as a control. Normal cells are typically of the same species as cells of a first state for which they serve as a control. In some embodiments, the cells of a first state are obtained from a subject suffering from a disorder. Normal cells (cells of the second state) could be cells obtained from a subject not suffering from a disorder, e.g.fa healthy subject. In some embodiments, normal cells are cells in the same tissue or organ as cells affected by a disorder, but located outside the area affected by the disorder.

[0048] In some embodiments, a regulatory element selected for having differential cell state-specific histone H3K27- acetylation marks and / or chromatin accessibility of the system / vector and methods herein is a 635 bp genomic DNA sequence located at position 116327534 to 116328168 on human Chromosome 7 in the human genome 19 build (referred to herein as TRECS-N1) , or a fragment thereof. Suitable fragments of this 635 bp genomic DNA sequence are between about 50 bp and about 500 bp in length, e.g. , about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, or 500 bp. In some embodiments, the fragment is located between positions 116327634 to 116328168, 116327734 to 116328168, 116327834 to 116328168, 116327934 to 116328168, 116328034 to 116328168, 116328083 to 116328168, or 116328100 to 116328168 on human Chromosome 7, using the hgl9 genome build. In some embodiments, a regulatory element selected for having differential cell state-specific histone H3K27- acetylation marks of the system / vector and methods herein comprises, consists essentially of or consists of SEQ ID NO: 3.

[0049] The system / vector described herein is of use in reporting cell state in real-time. Thus, the system / vector may be used to monitor or determine a cell state, cell identity,SJ0118WO PATENT or cell type . As demonstrated herein, TRECS-N1 labels a chemoresistant, MES-like cell state in a population of host cells . When GIMEN cells were transduced with a lentiviral vector comprising TRECS-N1 (GIMEN-TRECS-N1 cells ) , and subsequently treated with A485, a global loss of H3K27ac was observed ( as evidenced by a decrease in mKate2 signal ) and the cells transitioned from a MES-like gene expression program to a more ADRN-like gene expression program. In addition, when the GIMEN-TRECS-N1 cells were treated with A485 and chemotherapy compounds , a significant increase in the sensitivity of the cells to chemotherapy agents was observed . See Table 6. Accordingly, in one embodiment described herein is a method of optically screening a compound for the ability to modify cell type or identity comprising (a) transducing or introducing into a population of host cells ( e. g. , primary mammalian (human) cells or cells of a mammalian (human) cell line ) a lentiviral vector including ( i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility; and ( ii ) a second nucleic acid encoding a second selection marker , said second nucleic acid being operably linked to a constitutive promoter; (b) selecting, from the population of host cells , a host cell (or one or more host cells ) that expresses the second selection marker ( e . g. , by optical detection or antibiotic resistance) ; (c) contacting the selected host cell of (b) with a test compound; and (d) measuring expression of the second selection marker by the cells of (c ) , e . g. , by imaging , wherein the level of expression of the second selection marker is indicative of test compound' s ability to modify cell identity . Test compounds that may screened in accordance with the method hereinSJ0118WO PATENT include, but are not limited to, small organic compounds, lipids, proteins (e . g. , enzymes ) , peptides , nucleic acids ( e . g.finhibitory RNA such as shRNA, miRNA, siRNA, etc . ) , extracts, and / or natural products . In some embodiments , the host cell is a MES cell .

[0050] In another embodiment, a method of in vivo labeling normal and / or diseased cells at a specific developmental stage or a specific stage of disease is provided . This method includes the step of transducing or introducing into a population of normal cells , diseased cells, or combination thereof a lentiviral vector including (i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility, wherein the differential cell state-specific histone H3K27 -acetylation marks and / or chromatin accessibility of the regulatory element are associated with a specific developmental stage or a specific stage of disease ; and ( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter, and optionally selecting, from the population of normal cells or diseased cells , normal cells and / or diseased cells that express the second selection marker ( e . g. , by optical detection or antibiotic resistance ) , thereby in vivo labeling the normal and / or diseased cells at a specific developmental stage or a specific stage of disease . In some embodiments, the diseased cells are cancer cells . In some embodiments, the diseased cells are neuroblastoma cells . In some embodiments , the diseased cells are a subtype of a cancer cell with a particular sensitivity to a chemotherapeutic agent ( e . g. , chemosensitive or chemoresistant ) . In some embodiments, the diseased cells are MES cells . In some embodiments, thesjonawo PATENT number of labeled normal cells and / or diseased cells in the population of cells is quantified, e . g. , by imaging or sorting of cells expressing the first selection marker . In further embodiments , in vivo labeling allows for tracking of cells as they transition between differentiation states during normal development .

[0051] A method for real-time monitoring of transcription of a cell exposed to a stress is also provided . This method includes the step of (a ) transducing or introducing into a population of cells a lentiviral vector including ( i ) a first nucleic acid encoding a first selection marker , said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility; and ( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter; (b) selecting, from the population of host cells, a host cell (or one or more host cells ) that expresses the second selection marker ( e . g. , by optical detection or antibiotic resistance) ;(c) exposing the selected host cell of (b) to a stress ; and(d) measuring expression of the second selection marker by the cells of (c) , e . g. , by imaging, thereby monitoring transcription in the cell exposed to the stress in real-time . In some embodiments, the stress is a physiological , pathological or environmental stress or condition as described herein .

[0052] In some embodiments of one or more the methods herein, the cells expressing the second selection marker may be sorted, enriched for, or isolated . In some embodiments , the cells expressing the second selection marker are sorted, enriched for, or isolated via using flow cytometry, e . g. , fluorescent activated cell sorting ( FACS) . In some embodimentsSJ0118WO PATENT flow cytometry, e.g. , FACS, may be used to separate a population of cells into 2, 3, 4, 5, or more subpopulations based on the level of the second selection marker. The populations may be further analyzed or compared using any conventional method for analyzing cells, such as gene expression profiling (e.g. , using microarrays or RNA-Seq) , analysis of chromatin marks (e.g., using ChlP-Seq or ChlP-on- Chip or CUT&RUN) , protein expression profiling, morphological analysis, etc. In some embodiments, cells that are isolated based on expression level of the second selection marker (e.g., low or absent expression, or robust expression) are further maintained (e.g. , in culture) for a period of time and analyzed again for the second selection marker.

[0053] To facilitate use of the system / vector described herein, the disclosure further provides packaged products and kits, including a vector / system described herein, packaged into suitable packaging material. The term "packaging material" refers to a physical structure housing the product or components of the kit. The packaging material may maintain the components sterilely, and may be made of material commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampules, etc. ) .

[0054] In some embodiments, a packaged product or kit includes a container, such as a sealed pouch or shipping container, or an article of manufacture, for example, to carry out an assay described herein, such as a tissue culture dish, tube, flask, roller bottle or plate (e.g., a single multi-well plate or dish such as an 8, 16, 32, 64, 96, 384 and 1536 multi-well plate or dish) .

[0055] A label or packaging insert may be included, listing contents or appropriate written instructions, for example, practicing a method of the disclosure. Instructions may be on "printed matter," e.g., on paper or cardboard within the kit,SJ0118WO PATENT on a label affixed to the package, kit or packaging material , or attached to a tissue culture dish, tube, flask, roller bottle, plate ( e . g. , a single multi-well plate or dish such as an 8 , 16, 32 , 64 , 96, 384 and 1536 multi-well plate or dish) or vial containing a component of the kit . Instructions may comprise voice or video tape and additionally be included on a computer readable medium, such as a disk ( floppy diskette or hard disk) , optical CD such as CD- or DVD-ROM / RAM, magnetic tape, electrical storage media such as RAM and ROM and hybrids of these such as magnet ic / optical storage media .

[0056] Disclosed kits can optionally include additional components , such as buffering agent , a preservative , or a reagent . Each component of the kit may be enclosed within an individual container or in a mixture and all of the various containers can be within single or multiple packages .

[0057] In some embodiments, the kit contains the vector / system described herein . In some embodiments a kit may comprise a transfection reagent , DNA modifying enzyme, a buffer solution, a cell . In some embodiments a kit may comprise instructions for use of the kit to detect or monitor expression of selection markers in cells .

[0058] The foregoing may be better understood by the following examples which are presented for purposes of illustration and are not intended to limit the scope of the invention .EXAMPLESExample 1 : Materials and Methods

[0059] Cell Lines, PDXs and Tumors . Cell lines were obtained from ATCC (CHP212 , SKNAS , Kelly, SKNFI , SKNBE2 ) , DSMZ ( Kelly, GIMEN, NGP ) . SHEP, KPNYN, and KPNSI 9S cells were a gift of Kimberly Stegmaier , Dana-Farber Cancer Institute . 9464D mouse TH-MYCN-derived neuroblastoma cells were obtained from Rimas Orentas , University of Washington . All cell lines were short tandem repeat ( STR) -tested for identity prior to use . HumanSJ0118WO PATENT cell lines were cultured in RPMI media containing 10% heat- inactivated FBS and 1% penicillin- streptomycin. 9464D cells were cultured in RPMI media containing 10% heat-inactivated FBS, 1% nonessential amino acids and 1% beta-mercaptoethanol . All cells were cultured in a humidified atmosphere at 37 °C containing 5% CO2. All cell lines were routinely validated to be free of Mycoplasma species and used within 10 passages after thawing. Publicly available, anonymized and open-access neuroblastoma PDX (n=31) and human tumor sample (n=106) processed TPM expression levels from RNA-seq data were obtained from the St. Jude Cloud, through the Center for Applied Bioinformatics at St. Jude Children's Research Hospital. (McLeod et al. (2021) Cancer Discov. 11:1082-1099) .

[0060] Chemicals . CCS1477, CCS1477 intermediate, iCBP4, A486, iCBP112, dCBP-1, SGC-CBP30, CPI-1612, B026 were synthesized by Dr. Jun Qi at Dana-Farber Cancer Institute. CLIPL6-MybLL- TIDE (Joy et al. (2021) J. Am. Chem. Soc. 143:15056-15062) and CRYBMIM (Ramaswamy et al. (2018) Nat. Commun. 9:110) were as described in the literature. NEO2734, CTB, and CTPB were obtained from MedChemExpress . A486 was obtained from the Structural Genomics Consortium (Lasko et al. (2017) Nature 550:128-132) . All other compounds used in this study were maintained by and provided by compound management center at St. Jude Children Research Hospital.

[0061] Cell Lysis and Western Blot Analysis . Whole-cell lysates and chromatin lysates were prepared as previously (Shendy et al. (2024) Nature Comm. 15:3483) . Briefly, wholecell lysates were generated after disrupting the cells with RIPA buffer (20 mM Tris pH 7.4, 150 mM NaCI, 1 mM EDTA, 1 mM EGTA, 1% Triton, 0.1% sodium dodecyl sulfate, and 0.1% sodium deoxycholate) that has protease and phosphatase inhibitors (Cell signaling) . Immunoblotting was performed using the primary antibodies: anti-H3 (Cell signaling) , anti-H3K27AcSJ0118WO PATENT(Abeam) , anti-H3K4mel (Abeam) , anti-CBP (Cell signaling) , anti-EP300 (Cell signaling) , anti-FOSLl (Abeam), anti- Vinculin (Millipore) and anti-tubulin (Cell signaling) . Fluorescent-dye conjugated secondary antibodies were antirabbit IRDye 680LT or anti-mouse IRDye 800CW se (LI-COR) , which were used prior to imaging using a LI-COR Odyssey® Imager .

[0062] Plasmids . Reporter plasmids with different sequences for endogenous loci associated with MES cell state were synthesized by Vectorbuilder Inc. The coordinates of all sequences are presented in Table 1 and the sequences of the same are presented in Table 2. The packaging plasmid (psPAX2) and envelope plasmid (pMD2.G) , as well as Cas9-blasticidin and sgRNA-puromycin vectors were obtained from Addgene.org. Plasmid IDs were: psPAX2, pMD2.G, cas9- blasticidin, sgRNA- puromycin .TABLE 1* TRECS-N1.SJ0118WO PATENTTABLE 2SJ0118WO PATENTSJ0118WO PATENTSJ0118WO PATENTSJ0118WO PATENTSJ0118WO PATENT

[0063] Len tiviral Production and Infection . Lentiviral particles were produced in HEK293T cells using TransIT®-293 reagent (Mirus Bio) according to manufacturer' s instructions . Viral supernatants were harvested after 48 and 72 hours of transfection and concentrated using Lentil-X Concentrator reagent (Takara Bio Inc) , according to the manufacturer' s instructions . The titer of the concentrated viral supernatant was determined in HOS cell line using ddPCR at the Vector Core Lab at St . Jude Children' s Research Hospital using standard protocols . Cell lines were infected with individual lentivirus particles harboring the endogenous locus associated with MES cell state 3 at a multiplicity of infection (MOI ) of 1 using polybrene at a final concentration of 1 pg / ml . All cells were at 70 - 80% confluence at the time of transfection or transduction . Cells were selected using 1 pg / ml puromycin .

[0064] Flow Cytometry Analysis and Sorting. Cell lines were trypsinized into suspension and washed twice with phosphate- buffered saline ( PBS ) . Cells were filtered through a 40-pMSJ0118WO PATENT filter and resuspended in PBS . Cells were then stained with DAPI and immediately measured on a BD LSRFortessa Cell Analyzer (BD Biosciences ) . Flow cytometry analysis was collected in BD FACSDIVA v9 . 0 . Data analysis was performed in Flow Jo (vlO . 6. 1 ) . Cells transduced with empty vector were used as negative controls for gating .

[0065] Flow cytometry sorting was performed with the BD FACSAria Cell Sorter ( BD Biosciences) . Cells were detached with trypsin, suspended at 10 million cell / ml in Accumax™ to prevent cell aggregation during sorting . Cells were stained with DAPI (ThermoScientific) at 1 : 1000 to exclude dead / dying cells . The first gating for sort was based on FSC / SSC . The second gating based on DAPI negative staining eliminated dead / dying cells . Doublet cells were eliminated by gating on SSC-W / FSC-A. Then, cells were sorted based on mKate2 fluorescence into a Top 20% subpopulation that shows the highest mKate2 signal and represents 20% of the total population and a Bottom 20% subpopulation that shows the lowest mKate2 signal and represents 20% of the total population . Empty vector transduced cells represented a negative control tube and was always analyzed to determine auto-fluorescence . All assays were performed under sterile conditions . Purity checks were performed for each collected subpopulation . Flow cytometry separated SKNAS and CHP212 cells were subj ected to molecular or phenotypic assay or alternatively, replated post-sorting in culture medium for serial assessment of fluorescence .

[0066] Cell -Trace Violet Assay. Cell trace violet (CTV) was prepared as per manufacturer ' s instructions (Thermo Fisher Scientific) . CHP212- and 9464D-TRECS-N1 or empty vector control cells were harvested with TrypLE and labelled at 37 °C for 20 minutes using 10 pM Cell-Trace Violet , per the manufacturer' s instructions . Cells were then replated forSJ0118WO PATENT analysis at day 3 or washed with PBS , filtered through a 40- pM filter and then flow analyzed on BD FACSAria Cell Analyzer (BD Biosciences ) . Cells at day 3 were similarly analyzed . Data analysis was performed using analysis was performed using FlowJo software (vlO . 6. 1 ) .

[0067] Chemosensi tivity Assay. Sorted CHP212 cells were plated immediately for drug treatment in 384 -well plates ( 1000 cells / well) and permitted to adhere overnight . The next day, cells were treated with a range of concentrations of conventional chemotherapy compounds for 72 hours, using Tecan D300e compound dispensing robotics . Cell growth was measured after 72 hours using CellTiter-Glo® reagent ( Promega ) according to the manufacturer ' s instructions . Alternatively, GIMEN or KPNSI9S cells treated with one individual dose of DMSO or A485 (5 pM - GIMEN, 1 pM - KPNSI9S ) and cultured for 7 days were then harvested and replated in 384-well plates ( 1000 cells / well) , followed by drug treatment with a range of concentrations of conventional chemotherapy compounds , in addition to either DMSO or A485 ( 5 pM) . On days 3 and 6, cell growth was measured using CellTiter-Glo® reagent ( Promega) according to the manufacturer ' s instructions and the chemiluminescence was measured using BioTek SynergyHl microplate reader ( PerkinElmer) according to the manufacturer ' s protocol .

[0068] Cell Staining and Fluorescent Imaging. Live cells were stained with Cell Mask Green Actin Tracking Stain ( Invitrogen) at lx concentration and Hoechst 33342 (Thermo Scientific) at 1 pg / mL in culture media . Cells were incubated for 30 minutes with Cell Mask Green Actin Tracking Stain and for 15 minutes with Hoechst 33342 at 37°C . All images were collected on a Ni kon Eclipse Ti through a Plan Apo VC 60X / 1 . 2 WI objective onto an Andor Zyla 5. 5 sCMOS camera . Illumination was provided by an EXFO X-Cite Series 120PC metal halide lamp . For the BlueSJ0118WO PATENT channel , an image with 100 ms exposure time was collected through a Semrock DAPI-1160B-NTE-ZERO filter cube . For the Green channel , an image with 500 ms exposure time was collected through a Semrock FITC-3540CNTE-ZERO filter cube . For the Red channel, an image with 1000 ms exposure time was collected through a Chroma Red#l FISH filter cube ( 49306 ) .

[0069] RNA Purifica tion and Library Prepara tion for RNA-seq. Immediately after sorting, CHP212 , SKNAS and 9464D cells were lysed in TRI zol® (Ambion) acid-guanidinium-phenol based reagent . GIMEN, SHEP, and KPNSI9S cells were plated and treated with either DMSO or A485 ( 5pM - GIMEN, IpM - KPNSI 9S , 5pM - SHEP ) and lysed using TRI zol® reagent on day 7 of treatment . Snap-frozen 9464D tumors were dissociated using a Qiagen Tissuelyser homogenizer in TRI zol® reagent . RNA was extracted using chloroform and purified using PureLink® RNA mini kit ( Invitrogen) with on-column DNase treatment to obtain DNA-free total RNA and quantified using the Quant-iT® RiboGreen® RNA assay (ThermoFisher) and quality checked by the 2100 Bioanalyzer RNA 6000 Nano assay (Agilent ) or 4200 Tapestation® High Sensitivity RNA ScreenTape® assay (Agilent) prior to library generation . Libraries of CHP212 and GIMEN samples were prepared from total RNA with the TruSeq® Stranded Total RNA Library Prep Kit according to the manufacturer' s instructions ( Illumina ) . Libraries of SKNAS samples were prepared from total RNA with the Illumina Stranded Total RNA Library Prep Kit according to the manufacturer' s instructions ( Illumina) . Libraries were analyzed for insert size distribution using the 2100 BioAnalyzer High Sensitivity kit (Agilent ) , 4200 TapeStation® D1000 ScreenTape® assay (Agilent ) , or 5300 Fragment Analyzer NGS fragment kit (Agilent) . Libraries were quantified using the Quant-iT® PicoGreen® ds DNA assay (ThermoFisher) or by low pass sequencing with a MiSeq® nano kit ( Illumina ) . Paired end 100SJ0118WO PATENT cycle sequencing was performed on a NovaSeq® 6000 or NovaSeq® X Plus (Illumina) .

[0070] CUT&RUN Sequencing. CUT&RUN sequencing was performed by standard methodology and using reagents from Epicypher Inc. H3K27ac (Millipore) , H3K4mel (Abeam) , and IgG (Epicypher) antibodies were used. Briefly, 500,000 live cells per sample were permeabilized and processed by CUT&RUN according to the CUTANA® CUT&RUN protocol. Samples were internally controlled by spiking with exogenous E. coli DNA was added according to the input cell number, as per the manufacturer's protocol. DNA was quantified using the Quant-iT® PicoGreen ds DNA assay (ThermoFisher) . Libraries were prepared with HyperPrep™ Library Preparation Kit (Roche) with modified PCR conditions: Step 1, 98°C for 45 seconds; Step 2, 98°C for 15 seconds; Step 3, 60°C for 10 seconds; Step 4, 72 °C for 1 minute; Repeat steps 2-4 twelve times for > 10 ng input, 13 cycles for input between 5 and 10 ng, and 15 cycles for input < 5 ng) ; Step 4, 72 °C for 1 minute. Libraries were analyzed for insert size distribution, then libraries were sequenced on a NovaSeq® 6000 with 10 million paired-end 75-bp reads per sample.

[0071] ATAC Sequencing. Assay for Transposase Accessible Chromatin using sequencing (ATAC-seq) was performed as previously described (Corces et al. (2017) Nature Meth. 14:959-962) . Briefly, 50,000 cells for each sample were washed with 50 pL cold PBS once. Pellets were resuspended in 50 pL cold Omni-ATAC lysis buffer (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 0.1% TWEEN® 20, 0.01% digitonin) and incubated on ice for 3 minutes, then mixed with 1 mL Omni- ATAC wash buffer (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.1% TWEEN® 20) , Nuclei were pelleted by centrifugation and resuspended in 50 pL Omni-ATAC transposition reaction mixture (25 pL Nextera TD buffer, 16.5 pL PBS, 0.1% TWEEN® 20, 0.01% digitonin, 2.5 pL Tn5 transposase) and incubated at 37 °CSJ0118WO PATENT for 30 minutes. DNA was purified using Quick-DNA MicroPrep column purification kit (Zymo Research) . The libraries were generated by PCR amplification with the cycle numbers determined by qPCR side-reactions as previously described. DNA libraries were purified with Quick-DNA MicroPrep column purification kit (Zymo Research) . The quality of the libraries was assessed with TapeStation and the DNA contents were quantified by Qubit. The libraries were sequenced on Illumina NextSeq® 600 (paired-end, 75-bp reads) .

[0072] CBP and EP300 Knockout Cell Lines. GIMEN cells were stably transduced with lenti-cas9 vectors and selected using 5 pg / mL blasticidin (Invitrogen) . Stable expression of Cas9 was established by western blot analysis of protein lysates using Cas9 antibody (Cell Signaling) . sgRNAs targeting individual genes were subcloned by standard methodologies within pLKO.5 -puromycin. sgRNA sequences were ch2 .2 (ggtgtgcgtatgaagcagtg; SEQ ID NO: 9) , LACZ (aacggcggattgaccgtaat ; SEQ ID NO:10) , EP300-1 (atacgaggcccatagcccat ; SEQ ID N0:ll) , EP300-2 (gtacgactaggtacaggcga; SEQ ID NO:12) , CBP-1 (gcagccgtggaagcaggagg; SEQ ID NO: 13) , CBP-2 (ggtagcctatgctaagaaag; SEQ ID NO:14) , as described (Durbin et al. (2022) Cancer Discov. 12:730-751) . Following infection of pLKO.5-puromycin-sgRNA lentivirus, cells were cultured for 5 days in the presence of 1 pg / mL puromycin (Invitrogen) prior to assay of genome-wide RNA via RNA-seq as described above.

[0073] High-Content Imaging Screen. 2039 compounds from a "Mechanism of Action" compound library (St. Jude Children's Research Hospital) curated by the Department of Chemical Biology and Therapeutics at dispensed into 384-well plates with optically clear bottoms ( PerkinElmer, PDL-coated CellCarrier-384 Ultra) using an Echo 655T Liquid Handler (Labcyte) . For initial screens, compounds were used at 10 pM.SJ0118WO PATENTFor focused secondary screens, compounds were used at the following doses: 40 pM, 13 pM, 4.4 pM, 1.48 pM, 0.49 pM, 0.16 pM, 0.054 pM, 0.018 pM, 0.0061 pM, 0.002 pM. Cells were seeded at the compound-dispensed plates and incubated at 37 °C with 5% CO2 in a humidified cell culture incubator for seven days. After incubation with the compounds, the cells were washed three times with PBS using ELx405 plate washer (BioTek) , followed by fixation with 4% paraformaldehyde (Electron Microscopy Sciences) . Hoechst 33342 (10 pM) (Invitrogen) in PBS was the nuclear counterstain, treated for 15 minutes at room temperature. Cells were washed three times with PBS. Using an automated robot system, Hoechst and mKate2 signals of the cells in the 384-well plates were imaged using CV8000, a confocal microscopy-based high-content screening system (Yokogawa) . Four images per well were captured. After image acquisition, Columbus, an image analysis software (PerkinElmer) , was used to segment each cell in the images based on Hoechst and mKate2 signals, and to measure the signal intensity of mKate2 per cell. The obtained results were then normalized and analyzed using Genedata Screener software (Genedata) .

[0074] In Vivo A485 Treatment Experiments . All animal studies were approved by the St. Jude Children's Research Hospital Animal Care and Use Committee and conducted in accordance with guidelines from the NIH Office of Laboratory Animal Welfare. Subcutaneous allografts were established bilaterally in six- to eight-week-old C57BL / 6NJ mice by injecting 5><1069464D cells transduced with TRECS-N1 or empty vector suspended 1:1 in 50% LDEV-free Matrigel® matrix. As an internal negative control, one additional mouse per group was implanted with control (empty vector) containing 9464D cells. Tumor growth was monitored weekly using electronic calipers. When tumors reached approximately 200 mm3, mice were randomly assigned toSJ0118WO PATENT two treatment groups: Vehicle (n = 3) or A485 (75 mg / kg daily; n=3) . A485 was prepared in DMSO and diluted in 10% hydroxypropyl p-cyclodextrin (Sigma-Aldrich) in sterile water for injection. Mice received daily intraperitoneal injections of either vehicle or A485 (75 mg / kg) for four consecutive days, followed by sacrifice and tumor harvest two hours after the final dose.

[0075] Bulk RNA-seq Analysis . Raw FASTQ sequences were aligned using HISAT2 (version 2.1.0) (Kim et al. (2015) Nat. Methods 12:357-360) in paired-end mode using default parameters to version hgl9 of the human genome genome or mmlO of the mouse to which the sequences of the External RNA Controls Consortium (ERCC) synthetic spike-in RNAs and mkate2 gene sequence (derived from Shcherbo et al. (2009) Biochem. J. 418:567-574) had been added as extra pseudochromosomes. Expression per gene was quantified using htseq-count [PMID 25260700] with parameters "htseq-count -i gene_id stranded-reverse -f bam -m intersection-strict," and version 87 of the canonical GRCh37 gene list or version 6 of canonical GRCm38 gene list from RefSeq to which ERCC coordinates and mkate2 pseudocoordinates were added. TPM (Transcripts Per Million) expression was then computed for each gene.

[0076] The standard TPM-normalization strategy was: normterm = sum of (readcount * readlength / exonlength) across all genes. TPM = readcount * readlength / exonlength * le6 / normterm. Exon lengths per gene were calculated by collapsing all exons from all transcripts with the same gene name into a single set using bedtools merge. Per gene read counts were used as input for differential expression analysis by DESeq2 with default parameters (Love, et al. 2014) Genome Biol. 15:550) . For statistical analysis, ERCC probe expression values were excluded. Significantly differentially expressedSJ0118WO PATENT genes had absolute linear fold-changes >= 1.5 and adjusted p value <= 0.05.

[0077] For analysis of publicly available data from the Cancer Cell Line Encyclopedia, processed gene expression values were retrieved from depmap.org, using the 24Q4 data release (Ghandi et al. (2019) Nature 569:503-508; Dharia et al. (2021) Nat. Genet. 53:529-538) .

[0078] Ortholog Mapping from Mouse to Human Genes. Mouse gene symbols (GRCm38.p6) were converted to their corresponding human orthologs using the Ensembl BioMart tool. To perform the conversion, the "Ensembl Genes 102" dataset was selected, and "Mouse genes (GRCm38.p6)" was chosen as the reference species. In the left-hand panel, the "Filters" section was accessed, and within the "MULTI SPECIES COMPARISONS" category, the "Homolog filters" option was enabled, with "Orthologous human genes" selected from the dropdown menu. Next, in the "Attributes" section, the "Homologs" category was opened, and under "HUMAN ORTHOLOGS," fields such as "Human gene stable ID," "Human gene name," and "Orthology type" were selected to capture relevant ortholog information. Results were viewed using the "Results" tab and exported in tab-delimited format for use in downstream analyses. The converted names to the list of MES or ADRN signature genes by direct string identity detection .

[0079] Gene Set Enrichment Analysis (GSEA) for Bulk RNA-seq. To refine the gene list for GSEAPreranked (Subramanian et al. (2005) Proc. Natl. Acad. Sci . USA 102:15545-15550) , only genes in the top half based on their normalized mean expression values across samples (basemean from DESeq2 analysis) were selected. Logs fold changes (Log2FC) derived from the above DESeq2 analysis were then used to rank retained genes. GSEAPreranked analysis was conducted using the "fgsea" andSJ0118WO PATENT"clusterProfiler" packages in R. The analysis utilized the following specific parameters:TERM2GENE: Our input gene set list combined the "epithelial to mesenchymal" hallmark gene set from "h . all . v2023.1. Hs . symbols . gmt" gene sets, as well as the MES and ADRN signature gene sets (van Groningen et al. (2017) Nature Genet. 49:1261-1266) to align with the study's focus on particular cellular phenotypes. eps : Set to zero to ensure computational stability and prevent any potential division by zero errors. nPermSimple: 10,000 permutations. pvalueCutof f : reporting p value cutoff of 1.GSEA results were visualized using the "ggplot2" package.

[0080] Scoring Samples by MES, ADRN, and Combined Signatures . TPM values were used to summarize global gene expression patterns and their associations with specific cell states using established signature gene lists. MES (mesenchymal) and ADRN (adrenergic) classification gene lists were obtained from prior research, and we reproduced their analytical strategy (van Groningen et al. (2017) Nature Genet. 49:1261-1266) . Briefly, to calculate MES and ADRN scores, all genes were first ranked by their TPM values in descending order. The ranks of ADRN or MES signature genes were extracted from this list of per gene ranks. The median TPM rank of MES genes among all genes was used to define MES scores for each sample, and the median rank of ADRN genes among all genes was used to define ADRN scores for each sample. These MES and ADRN scores were subsequently transformed and used to create heatmaps to visualize and compare samples. For heatmap visualization, the MES and ADRN scores for each sample were separately normalized. The MES scores were normalized to a range between 0 and 1 using the following formula:SJ0118WO PATENT, MES score-min(MES score)MESnormalizea - - - max(MES score)-mm(MES score)This transformation ensures that the minimum MES value is mapped to 0 and the maximum MES value is mapped to 1 .[00811 Applying the same logic, the ADRN scores were normalized to a scale of 0 to 1 using the following formula :.. . .IDRN score-minMDTJN score)ADRNnormahzed = - — — - - — V- — „ — ~ max(XDRN score)-min(XDKN score)

[0082] A single combined RGB color column based on the MES and ADRN values was calculated from transformed scores .The RGB color in R for each sample was generated as :RGBcojor= rgb(RGBMES, 0,RGBADRNmaxColorValue — 255)The "pheatmap" and "ggplot2" packages were used to generate the heatmap from the normalized data and RGB data as detailed above .

[0083] CUT&RUN-Seq Analysis . Paired-end CUT&RUN-seq reads were initially aligned to the E. coli reference genome(version Escherichia coli K 12 MG1655) using Bowtie (version 1 . 2 . 2 ) ( PMI D: 19261174 ) in paired-end mode with the parameters -k 1 — best and — un to retain unmapped reads . The remaining non-E . coli reads were then mapped to the human reference genome (hgl9 ) using Bowtie with the parameters -p 5 -k 2 -m 2 — best . Transformations of the mapped read files , including Samtools sort -n, Bedtools bamToBed -bedpe, a manual conversion from BEDPE to BED3, and Bedtools bedToBam, were employed to generate BAM files containing CUT&RUN-seq fragments from each aligned read-pair . For visualization purposes, the reference genomes were partitioned into 50-bp windows using Bedtools makewindows , and fragment coverageSJ0118WO PATENT across these windows was calculated using Bedtools intersect — c . The coverage was normalized per million mapped fragments , then converted into bedGraph format using bedGraphToBigWig, further into wiggle format via bigWigToWig, and ultimately visualized in the IGV (version 2 . 17 . 4 ) (Robinson et al . ( 2023 ) Bioinforma tics 39 (1 ) : btac830 ) browser for human samples aligned to hgl 9.

[0084] To identify regions of significant enrichment in CUT&RON-seq reads, MACS1 . 4 ( PMID : 18798982 ) was employed . Prior to peak-calling, reads pairs from each paired-end alignment overlapping with the ENCODE-def ined Problematic Regions list (Amemiya et al . (2019) Sci . Rep . 9 : 9354 ) for the hgl9 genome were excluded . The remaining reads were then used for peak-calling against each sample' s corresponding IgG control , processed identically . The parameters --keep- dup=auto and -p le-9 were specified. To assess differences in binding peak coverage at a uniform set of regions of interest , peaks identified separately in each sample were merged using Bedtools merge . Individual read coverage was quantified using Bedtools intersect -c, and coverage in each sample was normali zed to the sample' s corresponding millions of mapped reads (RPM) for comparative analysis .

[0085] To investigate the differences in coverage of enhancer regions between A485 and DMSO treatments in the GIMEN cell line, peaks separately identified in these conditions as above were collapsed. To focus on enhancers instead of a mixture of enhancers and promoters , the putative promoter region for each transcript was defined in the canonical GRCh37 gene list as ±2 kb from the Transcription Start Site (TSS ) . Merged collapsed peaks overlapping these promoters were excluded using Bedtools subtract . Bedtools closest -t first was used to annotate each peak with the nearest gene name based on the TSS from the canonical GRCh37 gene list . Read coverage forSJ0118WO PATENT each sample in the remaining collapsed enhancers was quantified with Bedtools intersect -c. Differential enhancer peak binding between A485-treated and DMSO-treated GIMEN cell lines was determined using DESeq2 with default settings (Love et al. (2014) Genome Biol. 15:550) . Raw reads from three A485- treated samples and three DMSO samples served as input for DESeq2 analysis. The resulting DESeq2 log2FC (A485 / DMSO) values were displayed on the y-axis.

[0086] ChlP-Seq Analysis . H3K27ac ChlP-Seq data were collected from 50 neuroblastoma (NB) data sets, including 30 distinct cell lines categorized as either ADRN or MES cell states. The raw ChlP-Seq reads were aligned to the hgl9 version of the human reference genome using Bowtie (version 1,2.2) (Langmead & Salzberg (2012) Nat. Methods 9:357-359) in singleend mode, with the parameters -p 20 -k 2 -m 2 — best, and -1 set according to the read length. Before peak-calling, reads from each alignment that overlapped with the ENCODE-def ined Problematic Regions list (Amemiya et al. (2019) Sei. Rep. 9:9354) for hgl9 were discarded. WIG files for visualization were generated using MACS1.4 (Li (2013) arXiv 1303.3997) with the parameters -w -S --space=50 — nomodel --shiftsize=200. Fragment coverage was normalized per million mapped fragments using normalize_WIG_to_RPM.pl, and the resulting WIG files were converted to BigWig format using wigToBigWig -clip for visualization in the IGV (version 2.17.4) (Robinson et al. (2023) Bioinformatics 39 (1) : btac830) browser in hgl9. Regions with statistically significant enrichment were identified using MACS vl .4 (Zhang et al. (2008) Genome Biol. 9:R137) with corresponding input controls and the parameters -p le-9 — keep-dup=auto .

[0087] To assess differences in H3K27ac binding peaks at enhancer regions between MES and ADRN cell states, cell lines were first identified as ADRN-dominant ("ADRN cell lines") orSJ0118WO PATENTMES-dominant or intermediate ("MES cell lines") using RNAseq data from the Cancer Cell Line Encyclopedia (Ghandi et al. (2019) Nature 569:503-508) , combined with published gene signatures of these states (van Groningen et al. (2017) Nature Genet. 49:1261-1266), and cross-referenced to prior published assignments (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2 : 114-128; Boeva et al. (2017) Nature Genet. 49:1408-1413) . Peaks called separately in each sample were first merged using Bedtools merge. For each transcript in the canonical GRCh37 gene list, the putative promoter region was defined as ±2 kb from the TSS, and sections of H3K27ac peaks that overlapped with these promoters were removed using Bedtools subtract. Bedtools closest -t first was used to annotate each peak with the nearest gene name based on the TSS from the canonical GRCh37 gene list. Read coverage for each sample was then quantified using Bedtools intersect -c. Differential H3K27ac binding between MES and ADRN cell lines was identified using DESeq2 with default parameters (Love et al. (2014) Genome Biol. 15:550) .

[0088] Visualizing Chromatin Coverage. For default ChlP-Seq, CUT&RUN, or ATAC-seq coverage visualization at single loci in genome browsers, single-end alignments filtered against the Problematic Regions list were used. With these BAM files as input, MACS vl .4 was used with parameters -w -S -space = 50 - nomodel -shiftsize = 200 to artificially extend reads to 200 bp and to calculate their density in 50-bp bins. Read coverage was normalized per million mapped reads, and the resulting WIG files were converted to BigWig format using wigToBigWig -clip for visualization. For coverage analysis specifically higher- resolution single-bp coverage tracks at the genomic source of the reporter using ChlP-Seq, CUT&RUN or ATAC-seq, redundant reads that resemble PCR duplicates, i.e., with the sameSJ0118WO PATENT position, were removed from each sample. For single-end ChIP datasets (GIMEN: GSM2664325, SHEP: GSM3676075, BE2C : GSM1680107, and Kelly; GSM1532401) , reads were artificially extended to be 200 bp in the direction of their alignment using bedtools slop. For pairedend datasets (ATACseq: GIMEN, SHEP, Kelly (GSM2486172 ) , BE2C (GSM2486171) , and CHP212; 9 CUT&RUN: CHP212) , BAM files containing fragments were constructed using Samtools sort, Bedtools bamToBed -bedpe, manual conversion from BEDPE to BED3, and Bedtools bedToBam. The genome was partitioned into 50 bp windows or 1 bp windows using bedtools makewindows. Coverage of each fragment or extended read dataset in each of these window sets was calculated using Bedtools intersect -c. The coverage was normalized per million mapped, duplicate-removed reads, then converted into bedGraph format using bedGraphToBigWig, further into wiggle format via bigWigToWig, and ultimately visualized in IGV (version 2.18.1) (Robinson et al. (2023) Bioinformatics 39) .

[0089] ATAC-Seq Coverage Tracks Generation . Paired-end ATAC- Seq reads were initially aligned to the hgl9 reference genome using Bowtie (Langmead & Salzberg (2012) Nat. Methods 9:357- 359) (version 1.2.2) in paired-end mode with the parameters - p 20 -k 2 -m 2 --allow-contain — best. BAM files containing ATAC-Seq fragments were computationally generated from each aligned read-pair using a series of tools: Samtools sort, Bedtools bamToBed -bedpe, manual conversion from BEDPE to BED3, and Bedtools bedToBam. For visualization, the reference genomes were divided into 50-bp windows using Bedtools makewindows, and fragment coverage across these windows was calculated using Bedtools intersect -c. The coverage was normalized per million mapped fragments, then converted into bedGraph format using bedGraphToBigWig, further into wiggle format via bigWigToWig, and visualized in the IGV (versionSJ0118WO PATENT2.17.4) (Robinson et al. (2023) Bioin forma tics 39 (1 ) : btac830 ) browser for hgl9.

[0090] ATAC-seq Analysis . Paired-end ATAC-Seq reads were adapter-trimmed by trim_galore (version 0.4.4; Zenodo: 10.5281 / zenodo .7598955) with parameters — paired -nextera. Remaining paired-end reads were aligned to the hgl9 reference genome using Bowtie (version 1.2.2) (Langmead et al. (2009) Genome Biol. 10:R25) in two modes, with the output of each used for specified downstream analyses: (1) paired-end mode with the parameters -k 2 -m 2 — allow-contain - best and -1 set according to the read length, or (2) single-end mode with the parameters -k 2 -m 2 — allowcontain -best -1 set according to the read length. The paired-end mode BAM was further used for ATACseq peak calling. Reads overlapping the ENCODE-def ined Problematic Regions list (Amemiya et al. 92019) Sci . Rep. 9:9354) for the hgl9 genome were excluded before peaks calling by intersectBed -v . ATAC-seq peaks were identified using MACS vl .4 (Zhang et al. (2008) Genome Biol. 9:R137) with parameters — nomodel -p le-9 for each sample.

[0091] Micro-C Analysis . For micro-C analysis, GIMEN, KPNSI9S, KPNYN and SKNBE2 cells were obtained while 70-80% confluent and viably frozen. Samples were processed for micro- c analysis at Cantata Biosciences. Micro-C libraries were prepared using the Dovetail® Micro-C Kit according to the manufacturer's protocol. Briefly, chromatin was fixed with disuccinimidyl glutarate (DSG) and formaldehyde treatment. Cross-linked chromatin was then digested in situ with micrococcal nuclease (MNase) . Following digestion, the cells were lysed with SDS to extract the chromatin fragments and the chromatin fragments were bound to Chromatin Capture Beads. Next, the chromatin ends were repaired and ligated to a biotinylated bridge adapter followed by proximity ligation of adapter-containing ends. After proximity ligation, theSJ0118WO PATENT crosslinks were reversed, the associated proteins were degraded, and the DMA was purified and then converted into a sequencing library using Illumina-compatible adaptors. Biotin-containing fragments were isolated using streptavidin beads prior to PCR amplification. The library was sequenced on an Illumina platform to generate 250 million 2 x 150 bp read pairs. Four libraries were constructed for each cell line, for a total of 1000 million reads / sample .

[0092] Analysis of sequencing reads was performed by Cantata Biosciences. Briefly, reads were aligned to the hg38 reference genome using bwa mem (Li (2013) arXiv 1303.3997) , converted into quantifiable read pairs using pairtools parse (Open2C et al. (2024) PLoS Comput. Biol. 20 :el012164) ) with parameters - min-mapq 40 -walkspolicy 5unique and -max-inter-align-gap 30, sort, dedup, and split, and converted to BAM files using samtools. The contact matrix was generated from the resulting pairs file using Juicer Tools (Durand et al. (2016) Cell Syst. 3:95-98) and visualized in GenomePaint (Zhou et al. (2021) Cancer Cell 39:83-95) .

[0093] Motif Enrichment Analysis . To identify the positions of likely transcription factor (TF) motif hits within the sequence of the endogenous reporter locus (635 bp, chr7: 116327534-116328168) , FIMO v5.5.4 (Grant et al. (2011) Bioinformatics 27:1017-1018) was employed with the parameter - -thresh le-3 and the reference motif database CIS-BP 2.00 database97. A list of TFs associated with either the MES or ADRN lineage was compiled from literature (van Groningen et al. (2017) Nat. Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Boeva et al. (2017) Nat. Genet. 49:1408-1413; Thirant et al. (2023) Nat. Commun . 14:2575; Durbin et al. (2018) Nat. Genet. 1240-1246) . The motif hits predicted by FIMO whose Alias or ID matched a gene in the signature TF list were extracted from hits of all TFs from theSJ0118WO PATENT reference library for display . To determine whether specific motif hits are enriched in ATAC peaks within state-specific enhancers , statespecific enhancers were defined by sorting DESeq2 log2 (MES / ADRN ) results from the analysis of 50 NB ChlP- seq analysis as above . The top 2 . 5% of sites ( 4029 peaks ) were identified with high H3K27ac coverage specifically in MES lines as MES-biased enhancers and the top 2 . 5% with high H3K27ac coverage specifically in ADRN lines as ADRN-biased enhancers . The collapsed union of ATAC peaks from GIMEN, SHEP, Kelly (GSM2486172 ) , and BE2C (GSM2486171 ) using Bedtools merge were used to identify open chromatin regions within the H3K27ac collapsed peaks . ATAC peaks were identified within MES-biased enhancers using bedtools intersect with parameters -wa -f 1 . 0 , and ATAC peaks within ADRN-biased enhancers similarly . The genomic sequence were extracted from these ATAC-seq peaks and motif enrichment analysis was performed on the sequences using SEA, with a threshold set to 100000 , CISBP 2 . 00 database97 as the reference binding profiles , and using sequences of ATAC peaks within ADRN enhancer regions as controls . Inversely, motif enrichment within ATAC peaks in ADRN enhancers was analyzed, using MES enhancer regions as the control .

[0094] Single-Nucleus RNA-seq Analysis . The analyzed publicly available and anonymi zed patient cohort (Cohort 1 ) was composed of 15 stage M neuroblastoma patients with matched pre- and post-treatment samples, from a high-risk cohort at the Children' s Hospital of Philadelphia (CHOP) (Grossmann et al . (2024 ) Cancer Discov. 14 : 2387-2406 ) . This cohort included a total of 68 samples profiled by the lOx Genomics platform : 30 samples obtained from diagnostic biopsies ( timepoint "D" (diagnostic ) ) and 38 samples from post-treatment surgical resections (timepoint "P" (post-treatment) ) . All samples underwent standard lOx Genomics single-nucleus RNA-seqSJ0118WO PATENT protocols and were subjected to stringent quality control and filtering prior to classification into malignant and nonmalignant cell types. Raw sequencing data and most processed outputs (FASTQ, BAM, and Seurat objects) are publicly available via the Human Tumor Atlas Network (HTAN) . Here, the fully integrated Seurat object was obtained from the original authors, comprising 248,591 high-quality nuclei representing both malignant and nonmalignant cell populations across 20 patients and two timepoints (diagnosis and surgery) . All analysis was carried using custom code under R version 4.4.2 as well as Seurat 5.2.0. Data integration and cell-type annotations were performed by the original authors, as reported in (Grossmann et al. (2024) Cancer Discov. 14:2387- 2406) . A subcohort of 15 stage M neuroblastoma patients ("cohort 1") was focused on. Using metadata provided in the original study, patients with unmatched timepoints (CHOP11 and CHOP19) were excluded as were those with stage L2 disease (CHOP2, CHOP4, CHOP5) . Two Seurat subsets were created: one containing all annotated cell types, and another containing only malignant cells as defined by the original authors. Prior to dimensionality reduction, data were normalized, variable features were identified, and scaled. Principal component analysis (PCA) was conducted, and the top 15 principal components (selected based on variance explained and the elbow plot) were used as input for UMAP via Seurat's RunUMAP ( ) function. Cell types were visualized using DimPlot(), with coloring and labeling according to the celltype . pruned annotation. In the malignant-cell-only subset, UMAP was recomputed after re-normalization and re-scaling, given the substantial shift in expression distributions following the exclusion of nonmalignant cells. Cells were 11 grouped by timepoint (D, P) , and sample names (patient ID and timepoint)SJ0118WO PATENT were overlaid to aid visual interpretation of cluster structure and temporal dynamics .

[0095] Single-nucleus RNA-seq Gene Set Enrichment Analysis . A custom geneset of common mKate2high genes was derived by identifying those genes upregulated in mKate2high SKNAS and CHP212 cells ( adj usted p-value relative to mKate21ow<0 . 05) , followed by overlapping these gene sets . A preranked gene set enrichment analysis was then performed using the fgsea package (vl . 22 . 0 ) in R. Within the malignant-cell-only subset of Cohort 1 , an additional metadata column timepoint was used to set cell identities , distinguishing diagnosis (D) from posttreatment ( P) cell populations . Differential expression analysis between P ( case group) and D (control group) was performed using Seurat ' s FindMarkers ( ) function with the MAST test, which accounts for gene dropout and sparsity by modeling both detection rate and expression level in a two-part hurdle model . To support preranked enrichment analysis , no thresholds or filters were applied to the DEG results . Genes were ranked by avg__log2FC, which reflects both the direction and magnitude of differential expression and avoids ranking complications associated with extremely small and often tied adjusted p- values in singlenuclei data . The full ranked list was used as input for fgsea ( ) with parameters minSi ze = 15 and maxSi ze = 500 . The custom Common Mkate2 High Genes set was used as the test gene set . Enrichment was visualized using plotEnrichment ( ) and custom plots generated with ggplot2 .

[0096] FOSL1 shRNA . FOSL1 shRNAs ( TRCN0000019540 , TRCN0000019541 ) or control vectors plasmids were obtained from Dharmacon and transfected into packaging 293T cells to prepare lentiviruses , as above . GIMEN cells transduced with TRECS-N1 with blasticidin as a selection marker were used for creating FOSL1 knockdown cell lines . Following lentiviral transduction of shFOSLl or shControl viruses , cells were selected using 1SJ0118WO PATENT pg / mL puromycin ( Invitrogen) . Flow cytometry and western blotting were performed 14 days after infection .

[0097] RNAscope to mKa te2. Tumors were excised, divided and fixed in 10% Neutral Buffered Formalin . Fixed tumor samples were processed using the HistoCore PEGASUS Tissue Processor (Leica Biosystems, Deer Park, IL) . Processed tissues were embedded in paraffin and sectioned at a thickness of 4 pm using a HistoCore AUTOCUT fully automated rotary microtome (Leica Biosystems , Deer Park, IL) . Tumor sections were stained with hematoxylin and eosin ( H&E) using the HistoCore SPECTRA ST Stainer (Leica Biosystems , Deer Park, IL) . In si tu hybridization ( ISH) to detect mKa te2 mRNA was performed using the Ventana DISCOVERY ULTRA automated Stainer ( Roche Diagnostics Corporation ( Indianapolis , IN ) . H&E and ISH slides were coverslipped using the HistoCore SPECTRA CV Coverslipper (Leica Biosystems, Deer Park, IL) . The following reagents were from Advanced Cell Diagnostics, Inc (ACD, Newark, CA) : RNAscope™ 2 . 5 VS Probe - Vector-mKate2 , RNAscope™ 2 . 5 VS Positive Control Probe_Hs-PPIB, Homo sapiens Peptidyl prolyl isomerase B mRNA, RNAscope™ 2 . 5 VS Negative Control Probe_dapB, Bacillus subtilis strain SMY dihydropicolinate reductase B mRNA, RNAscope™ VS Universal AP Reagent Kit . DISCOVERY mRNA Sample Prep Kit and DISCOVERY mRNA RED Detection Kit were obtained from Roche Diagnostics Corporation ( Indianapolis , IN) . H&E and mKa te2 ISH were reviewed by a board certified veterinary anatomic pathologist using an Olympus BX46 microscope ( Evident Scientific, Waltham, MA) and representative images were acquired using a Spot Insight Color Mosaic microscope camera ( Spot Imaging, Sterling Heights , MI ) . Positive mKa te2 dots were scored according to published criteria from Bio-Techne, Table 3 .SJ0118WO PATENTTABLE 3

[0098] Sta tistical Analyses . Analyses are as noted in prior methods sections . However, for analyses not otherwise specified, data were analyzed using one-or two-sided ANOVA with post hoc Tukey tests , two-sided Student' s t tests or one- or two-sided Fisher' s exact tests as appropriate for multipleSJ0118WO PATENT or pairwise comparisons. Statistical significance was defined as p<0.05 unless otherwise stated.Example 2 : An Endogenous Non-coding Element Reporter System Identifies Cell State in Real-Time[00991 Pediatric high-risk neuroblastoma (NB) cells exist in one of two epigenetically controlled cell states termed "adrenergic" (ADRN) or a rarer state termed "mesenchymal" (MES) (Shendy et al. (2022) Cell Rep. Med. 3:100632; van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Boeva et al. (2017) Nature Genet. 49:1408-1413) . These states are characterized by distinct enhancer landscapes, marked by differential acetylation of histone H3 on lysine-27 (H3K27ac) , and different transcriptomes (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Boeva et al. (2017) Nature Genet. 49:1408- 1413) . In contrast to the more prevalent ADRN cell, the MES cell state is more similar to neural crest cells, the presumed cell of origin of neuroblastoma. Further, the MES cell state is relatively resistant to common chemotherapies used in NB, and may be enriched after chemotherapy exposure and at patient relapse (van Groningen et al. (2017) Nature Genet. 49:1261- 1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Sengupta et al. (2022) Nat. Cancer 3:1228-1246; Boeva et al. (2017) Nature Genet. 49:1408-1413) . At relapse, NB tumors are marked by resistance to conventional therapies and exceptionally poor patient survival. Given these high-risk features, new methods were sought to interrogate the high-risk MES cell state. First, to understand the distribution of these states in commonly used cell lines, xenograft models, and primary tumors, previously defined transcriptional signatures of the ADRN and MES cell states (van Groningen et al. (2017)SJ0118WO PATENTNature Genet. 49:1261-1266) were used to calculate separate ADRN and MES signature scores, as well as their score ratios, in 106 primary neuroblastoma tumors. The majority of NB tumors exhibited a dominantly ADRN cell state signature, with few showing mixed or dominantly MES transcriptional signatures. Since the MES transcriptional signature may also be influenced by infiltrating immune cells or tumor-associated fibroblasts that cannot be separated from tumor cells in whole tumor RNA- seq (Chapple et al. (2024) Genome Biol. 25:161) , similar analyses were performed in 31 patient-derived xenografts (PDXs) and 32 human tumor cell lines, which demonstrated that similar to primary tumors, the majority were ADRN-dominant , with few showing mixed or dominantly MES transcriptional signatures. These data are consistent with previous observations that NB tumors are composed of variable numbers of cells in these two cell states (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Boeva et al. (2017) Nature Genet. 49:1408-1413; Chapple et al. (2024) Genome Biol. 25:161; Patel et al. (2024) bioRxiv 16:2024.01.07.574538; Jansky et al. (2021) Nat. Genet. 53:683-693; Dong et al. (2020) Cancer Cell 38:716-733; Kildisiute et al. (2021) Sci . Adv. 7 (6) : eabd331) . These states are also reflected in inter- and intra-tumoral heterogeneity at the single-nuclei level (Chapple et al. (2024) Genome Biol. 25:161; Patel et al. (2024) bioRxiv 16:2024.01.07.574538; Jansky et al. (2021) Nat. Genet. 53:683- 693; Dong et al. (2020) Cancer Cell 38:716-733; Kildisiute et al. (2021) Sci. Adv. 7 ( 6) : eabd331 ) , reinforcing the observation that even within dominantly ADRN NBs, there is variability in MES scores.

[0100] Cells in the ADRN or MES state have been hypothesized to interconvert under genetic or chemical perturbation (Shendy et al. (2022) Cell Rep. Med. 3:100632; van Groningen et al. (2017) Nature Genet. 49:1261-1266; Boeva et al. (2017) NatureSJ0118WO PATENTGenet . 49:1408-1413; Thirant et al. (2023) Nat. Comm. 14:2575; Shi et al. (2020) Science Advances 6:1-12) . These studies, however, have required endpoint analyses, such as RNA10 seq, or ChlP-seq, which limit the interpretation of state plasticity, stability, and dynamics. Further, cell state is defined by the expression of hundreds to thousands of genes, and prior studies have focused on the expression of individual markers that may not be expressed in all cells found in a specific state. Thus, given the differences in epigenetic landscapes between these different states, a genome-derived reporter was designed that reflected the MES cell state using gene signatures, rather than individual-gene expression, for use in live NB cells. To do so, transcriptomic data from 32 human NB cell lines, coupled with ADRN and MES gene signatures, were used to categorize NB cell lines as dominantly ADRN, dominantly MES, or mixed / intermediate . In parallel, H3K27ac data from 28 NB cell lines were used to identify cis-regulatory elements that showed differential activity in ADRN- or MES- biased cells. To avoid the identification of individual biomarker genes with this approach, H3K27ac peaks overlapping gene promoters were removed. Thus, 161,161 H3K27ac-marked peaks genome-wide were ranked, 19,007 of which were preferentially associated with cell lines dominantly in one state or the other (10,085 MES-associated; 8,922 ADRN- associated; Log2fold difference (MES / ADRN) >|2|) . This analysis indicated that many non-promoter peaks proximal to MES or ADRN signature genes were state-biased in this analysis. However, many additional non-promoter peaks were also identified that were state-biased and not associated with MES or ADRN gene loci.

[0101] To find regions that were active only in the MES state, the top 30 loci most selectively enriched in MES-dominant NB cell lines were selected and filtered for those with (1)SJ0118WO PATENT abundant H3K27ac signal in all examined MES-dominant cell lines, (2) minimal or no signal in all examined ADRN-dominant cell lines, and (3) size 30 <1000bp making them suitable for molecular cloning. By this approach, the top-ranked locus identified was found in an intron of the MET gene (coordinates - hgl9 chr7: 116327534- 116328168) (Table 4) .TABLE 4SJ0118WO PATENT

[0102] Since H3K27ac marks regions of chromatin associated with active cis-regulatory elements , these peaks were also examined using ATAC-seq of SKNBE2C (highly ADEN) or GIMEN (highly MES) cells to identify regions of chromatin accessible to transcription factor binding . This approach highlighted that the 635bp locus identified in the MET gene intron was inaccessible, H3K27ac-marked chromatin in GIMEN cells , but not SKNBE2C .

[0103] This locus was marked by state-selective chromatin acetylation in several highly MES cell lines including GIMEN, GICAN and SHEP, as compared with highly ADRN cell lines , such as SKNBE2C, Kelly and SHSY5Y . Minimal acetylation of this locus was observed in human embryonic stem cells . However, consistent with the reported transcriptional and epigenetic similarities between MES state NB cell lines and human fetal neural crest cells (Boeva et al . (2017 ) Na ture Genet . 49 : 1408- 1413) , acetylation of this locus was observed in neural crest cells . This suggests that this locus may become acetylatedSJ0118WO PATENT during normal neural crest cell lineage commitment , and also that this acetylation may be lost during neuroblastoma cell state changes from a MES-li ke to an ADRN-like cell . Intriguingly, it was observed that cell lines with mixed ADRN- MES transcriptomes, including SKNSH, SKNAS , SJNB12 and CHP212 45 demonstrated intermediate levels of acetylation at this locus , indicating either the presence of an intermediate cell or that these cell lines represent heterogeneous mixtures of ADRN- and MES-like cells .

[0104] It was subsequently determined whether this genome- derived locus could be used to label live cells in the MES state . A lentiviral reporter vector was developed that contained individual nominated genome-derived sequences , upstream of a weak, minimal CMV promoter(ggcgtttactatgggaggtctatataagcagagctcgtttagtgaaccgtcagatc;SEQ I D NO : 1 ) , which drives expression of the pH-stable , long half-life, far-red fluorophore, mKate2 ( FIG . 1 ) . The lead candidate endogenous locus , and separately several other predicted MES-associated loci (Table 1 ) , were cloned into this reporter vector backbone and lentiviral particles were prepared for transduction into NB cell lines . Based on gene expression signatures, the most MES-dominant cell line was GIMEN , followed by KPNSI9S , whereas several ADRN-dominant cell lines were identified, including SKNBE2 , Kelly and KPNYN . Using these lines as positive and negative controls , respectively, lentiviral reporter viruses or empty vector controls lacking the genome-derived loci were stably transduced into GIMEN cells at a multiplicity-of-infection of 1 . Following antibiotic selection, a population of cells containing integration of the reporter were obtained . The lead reporter candidate cloned into this lentiviral plasmid was termed TRECS-Nl (Transcriptional Reporter Elemen t of Cell State in Neuroblastoma -1) . TRECS-Nl demonstrated strong andSJ0118WO PATENT consistently high-level expression of mKate2 in GIMEN, KPNSI 9S, and SHEP cells , detectable by flow cytometry and fluorescence imaging . In contrast , insertion into ADRN- dominant SKNBE2 , Kelly, and KPNYN cells produced little to no mKate2 fluorescence . Other candidates demonstrated either lower magnitude of fluorescence or inconsistent signal in MES and ADRN cells . These data indicated that TRECS-N1 demonstrated mkate2 fluorescence predominantly in MES cells .Example 3 : TRECS-N1 Identifies Chemoresistant MES-like Cells in Heterogenous Neuroblastoma Populations

[0105] Most NB tumors , PDXs and cell lines are ADRN-dominant , with variable levels of cells showing MES signatures . Intriguingly, there were rare fluorescent cells detectable even in highly ADRN cell lines . These observations are consistent with recent large-scale single-nuclei RNA-seq surveys demonstrating the presence of MES cells in NB tumors ( Patel et al . ( 2024 ) bioRxiv 16 : 2024 . 01 . 07 . 574538 ) , indicating that NBs contain cells in both states , even in highly ADRN- dominant models . To dissect this heterogeneity, the reporter fluorescence of TRECS-N1 in MYCN-amplif ied CHP212 and c-MYC- driven SKNAS cells , which have intermediate MES / ADRN gene expression patterns , was examined . Flow cytometry of TRECS- Nl-transduced CHP212 and SKNAS cells revealed a broad spectrum of mKate2 expression . Similar observations were made in 9464 D murine NB cells . This heterogeneity was visuali zed at the single cell level by fluorescence imaging , demonstrating a range of mKate2 expression in different cells present within even the same colony.

[0106] Next , the molecular signatures of cells labeled with TRECS-N1 were assessed . Fluorescence-activated cell sorting ( FACS ) was used to separate mKate2hl9hand mKate2lowcells inTRECS-Nl-transduced CHP212 , SKNAS and 9464 D cells , followedSJ0118WO PATENT by RNA-seq analysis. As expected, mKate2 mRNA expression was elevated in SKNAS, CHP212 and 9464D mKate2hi9hcells, compared with mKate210w. The expression of ADRN and MES signature genes in these sorted subpopulations was subsequently examined, as compared with other NB cell lines. mKate2hi9hand mKate2lowcells from CHP212 and SKNAS displayed distinct MES / ADRN scoring, with higher scores in mKate2hl9h, and lower in mKate2low, cells. Correspondingly, by gene set enrichment analysis (GSEA) , higher expression of the MES gene signature was observed in mKate2hi9hcells, and ADRN signature in mKate2lowcells. Extending these results, the "epithelial-to-mesenchymal" Hallmark geneset from the Molecular Signatures Database, which was significantly enriched in mKate2high cells, was examined compared with mKate2low(CHP212 - NES: 1.9, q- value: 2.26x106; SKNAS - NES: 2.04; q-value: 3.9xl0~7; 9464D ■ NES: 1.94; q- value: 9.3xl0-6) . The expression levels of individual MES transcripts such as COL6A3, PDGFC, and IGFBP5 and ADRN transcripts such as ASCL1, ELAVL4, and INSM2 demonstrated higher expression in mKate2hi9hand mKate210wcells, respectively. To expand on these findings, a panel of ten NB cell lines representing the range of MES / ADRN scores were selected, the cell lines were transduced with TRECS-N1 or empty vector controls, and their mKate2hi9hcell percentage was quantified (Table 5) .TABLE 5SJ0118WO PATENT

[0107] The presence of mKate2-positive cells were observed in nearly all NB cell lines, though with variable frequency. The percentage of mKate2-positive cells positively correlated with MES score, MES / ADRN ratio, and negatively correlated with ADRN score. Together, these data demonstrate that the TRECSN1 reporter identifies cells with a more MES-like gene expression pattern within heterogenous NB cell lines.

[0108] In vitro studies have shown that MES cell line and PDX subclones are relatively more resistant to conventional chemotherapy agents used to treat NB patients, compared with ADRN clones (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2 : 114-128 ; Sengupta et al. (2022) Nat. Cancer 3:1228-1246; Boeva et al. (2017) Nature Genet. 49:1408-1413; Thirant et al. (2023) Nat. Comm. 14:2575; Westerhout et al. (2022) Cancer Res. 82:484- 496) . Further, cells in the MES state are moderately enriched in post-therapy relapsed tumors, indicating that the MES cell state is relatively chemoresistant (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Sengupta et al. (2022) Nat. Cancer 3:1228-1246) . Thus, next, it was determined whether TRECS-N1 marked a relatively chemoresistant cell population. FACS was used to separate the mKate2hi«hand mKate2lowpopulations from TRECS-Nl-transduced CHP212 cells and these separate populations were treated with a panel of chemotherapy agents used in NB patients, including alkylators (thiotepa) , topoisomerase II inhibitors (etoposide, doxorubicin) , and anti-microtubule agents (vincristine) . The effects on cell growth were determined by Cell-Titer Gio® assay. CHP212- mKate2hi9hcells were relatively more chemoresistant thanSJ0118WO PATENTCHP212-mKate2lowcells to multiple chemotherapeutics with distinct mechanisms of action ( FIG . 2 ) . These data demonstrate that the TRECS-N1 reporter system identifies a MES-like population marked by relative chemoresistance from within heterogenous NB cells .

[0109] CHP212 and SKNAS cells are driven by paralogous but distinct oncogenes (MYCN vs . c-MYC) , that drive largely overlapping but distinct gene expression programs in NB (Westermann et al . ( 2008 ) Genome Biol . 9 : R150 ; Zimmerman et al . ( 2018 ) Cancer Discov. 8 : 320-335) . However, both cell lines contained mKate2hi9hand mKate210wpopulations . Analysis of RNA- seq data from sorted subpopulations demonstrated that mKate2hi9hor mKate2lowcells from SKNAS and CHP212 were transcriptionally similar to each other (R2=0 . 22 , p=2 . 48x10"14°) . Since TRECS-N1 integrates transcriptional and chromatin signatures , H3K27ac CUT&RUN analyses were performed to identify changes in H3K27ac deposition at active enhancer and promoter elements in sorted mKate2hi9hand mKate210Wpopulations . H3K27ac levels were dramatically elevated at the TRECS-N1 locus in mKate2hi9h, as compared with m mKate2i0W, populations ( FIG . 3 , note differences at the TRECS-N1 locus but not at the more distal CAPZA2 and ST7 loci ) . Consistent with the observed RNA-seq similarities , correlated differences in H3K27ac were also detected genome-wide between SKNAS- and CHP212-mKate2hi9hand mKate2lowcells (R2-0. 28 , p=6 . 75xl 0~308) . These data indicate that TRECS-N1 marks a population with the properties of MES cells with transcriptional and epigenetic similarities across heterogenous NB cell lines driven by different oncogenes .

[0110] To explore the clinical relevance of these observations , a publicly available single-nucleus RNA-seq dataset of NB tumors before and after induction chemotherapy was re-analyzed . The analyses were restricted to the malignantSJ0118WO PATENT cells found in the highest risk patients, who were diagnosed with stage M disease. The malignant cells in post-treatment tumors displayed a significant enrichment of mKate2hi9h, MES- like gene expression, compared with matched pre-treatment samples. Together, these data demonstrate that the TRECS-N1 reporter labels a subpopulation of cells expressing a transcriptional pattern similar to that of "persister cells" that remain after chemotherapy.Example 4 : TRECS-N1 is a functional reporter of mesenchymal transcription factor binding

[0111] The molecular mechanisms by which TRECS-N1 labels a MES-like NB cell population was assessed. The endogenous locus used in TRECS-N1 is within an intron of the MET receptor tyrosine kinase gene, which is an established driver of the epithelial-to-mesenchymal transition (Rong et al. (1994) Proc. Natl. Acad. Sci. USA 91:4731-4735; Canadas et al. (2014) Clin. Cancer Res. 20:938-950) . This indicates that expression of mKate2 and MES-like gene expression may be linked to high expression of MET. However, MET is not a member of the MES gene expression signature (van Groningen et al. (2017) Nature Genet. 49:1261-1266; Gartlgruber et al. (2021) Nat. Cancer 2:114-128; Boeva et al. (2017) Nature Genet. 49:1408-1413) , and a correlation between MET expression and mKate2 fluorescence across all tested NB models was not identified. Further, a correlation between MET expression and ADRN and MES signatures or MES / ADRN score ratio were not observed when examining NB PDXs. Thus, despite TRECS-N1 marking a MES-like cell state and being present within an intron of the MET gene, it appears unlinked to regulation of MET expression.

[0112] Enhancer elements may promiscuously regulate other genes found in the same topologically associated domain (TAD) (Bruneau & Nora (2018) Cell 175:38-40) . Thus, toSJ0118WO PATENT investigate if the endogenous locus found in the MET intron that was also used 50 in TRECS-N1 may regulate other genes within its TAD, high-resolution micro-C (Hsieh et al . ( 2020 ) Mol . Cell 78 : 539-553 ) was performed in highly MES (GIMEN, KPNSI 9S) and highly ADRN (SKNBE2 , KPNYN) NB cell lines . Four distinct TADs were observed in the region around the MET locus, where were highly similar between ADRN and MES cells . Evaluation of the expression of all genes within TADs #1-4 , including MET itself , demonstrated no significant dif ferences between ADRN-dominant and MES-dominant cell lines . These data indicate that the TRECS-N1 reporter locus does not mechanistically contribute to gene regulation within its native topological landscape .

[0113] Further, these data indicate that TRECS-N1 does not directly control expression of a specific gene that drives the MES-like cell state , but rather, is a target of mechanisms that regulate the MES cell state . If TRECS-N1 does not regulate the expression of a MES-state-driving gene, it was hypothesized that it may instead be a site of MES-specific transcription factor binding . Accordingly, a transcription factor binding site ( TFBS ) analysis was performed using the MEME suite (Machanick & Bailey (2011 ) Bioinforma tics 27 : 1696- 1697 ) , and enrichment for the binding of transcription factors associated with the MES cell state was observed, as compared with ADRN state, at this locus . It was subsequently determined whether this observation could be extended beyond the TRECS- N1 locus . To do so, the top 2 . 5% of genomic sites most specifically enriched in H3K27ac in either ADRN- and MES- dominant cell lines were identified . These sites were filtered for those with accessible chromatin in highly ADRN ( Kelly, BE2C) and / or MES (GIMEN , SHEP) cells . A TFBS analysis was performed on these sites , which revealed enrichment for MES- associated TFBS in the MES-state biased loci, and ADRN-SJ0118WO PATENT associated TFBS in the ADRN-state biased loci . Similar analysis of mKate2hi9hand 20 mKate2lowCHP212 and SKNAS cells demonstrated enrichment of MES-associated TFBS in the mKate2hi^h-biased loci and ADRN-associated TFBS in the mKate2low-biased loci . These results indicate that the reporter locus in TRECS-N1 and other genomic loci enriched for H3K27ac in specific cell states contain sites for state-specific transcription factor binding .

[0114] Several transcription factors (TFs ) are predicted to bind within the ~650bp TRECS-N1 locus . Thus , it was determined whether the entire TRECS-N1 locus or specific parts of it were required for reporter activity, to narrow the potential transcription factors involved in cell state regulation . Deletion mutants of the TRECS-N1 locus sequence were generated in similar reporter vectors , stably transduced highly MES GIMEN cells and fluorescence was quantified by flow cytometry . Benchmarking against full-length TRECS-N1 and empty vector controls , it was observed that the fluorescent signal generated by TRECSN1 in GIMEN cells could be recapitulated by an 85 bp segment of the 3 ' end of the locus sequence (nucleotides 551- 635 of TRECS-N1) . These observations were consistent with ATAC-seq data , which demonstrated elevated accessibility at the 3 ' end of the endogenous genomic locus in MES GIMEN and SHEP cells , compared with ADRN BE2C and Kelly cells . Similarly, CHP212-mKate2high cells displayed enhanced chromatin 35 accessibility and H3K27ac at this locus , compared with CHP212-mKate210Wcells . Focused analysis of this 85 bp segment of 3 ' DNA demonstrated candidate transcription factor binding sites for several TFs including FLI1 , KLF10 , EGR3 , SOX9, NFIA, NFIC and FOSL1 and 2 . TF binding motifs for FOSL1 were the most commonly enriched MES-associated TFBS in NB cell lines and SKNAS and CHP212- mKate2hi^hcells , indicating a role for FOSL1 in control of the MES cell state . To validate aSJ0118WO PATENT potential role for FOSL1, shRNA-mediated knockdown of FOSL1 was performed in GIMEN-TRECS-N1 cells, which resulted in loss of reporter fluorescence. Together, these data indicate that TRECS-N1 is an endogenous reporter of the MES cell state, likely functioning by recruitment of endogenously expressed, state-specific transcription factors to accessible regions of DNA.Example 5: TRECS-N1 sensitivity to dynamic cell state changes identifies EP300 / CBP as central epigenetic controllers of the chemoresistant MES-like cell state

[0115] During normal development, neural crest cells unidirectionally transition through cell states, prior to undergoing differentiation into a myriad number of cell types (Furlan et al. (2017) Science 357 ( 6346) : eaal3753) . In contrast, prior evidence indicates that NB cells may bidirectionally interconvert between ADRN- and MES-like states (Shendy et al. (2022) Cell Rep. Med. 3:100632; van Groningen et al. (2017) Nature Genet. 49:1261-1266; Boeva et al. (2017) Nature Genet. 49:1408-1413; Thirant et al. (2023) Nat. Comm. 14:2575; Olsen et al. (2020) bioRxiv 2020.2005.2004.077057 ) . Thus, it was determined whether TRECS-N1 labeling of individual MES-like cells within heterogenous populations reflected a stable cell identity or whether it could report dynamic cell state interconversions. To test this, SKNAS and CHP212 were sorted into mKate2hi9hand mKate2lowpopulations, and the cells were maintained in separate cell culture, with serial analyses of their mKate2 fluorescence levels over a 17- day time-course. Initial flow cytometry analysis demonstrated enrichment for mKate2hi9hand mKate210Wpopulations, but the fractions of high and low cells were unstable over time, with progressive appearance of mKate2lowcells in flow-purified mKate2hi9hcell populations, and vice versa, as soon as fourSJ0118WO PATENT days post-separation . To rule out the possibility that fluorescence shifts were due to contaminating cells in flow- separated fractions proliferating at different rates , cultures of CHP212 and 9464D-TRECS-N1 cells were labelled with Cell- Trace Violet dye and flow cytometry analysis was performed to determine the population doubling rates of mKate2hi9hand mKate2lowcells in adherent cultures . These data revealed similar doubling rates for mKate2hi9hand mKate210Wcells . These data demonstrate that population shifts in mKate2 fluorescence are not due to contaminating cells replicating at different rates , but are due to cell state instability .[001161 While prior evidence has suggested that ADRN cell populations may be either selected for or induced to form MES cells , the corresponding dynamics and mechanisms of interconversion of MES cells to ADRN cells are unknown . Since the TRECS-N1 reporter can identify changes in cell state, it was hypothesized that it could be used to guide discovery of state-modulating perturbations . To test this hypothesis, TRECS-Nl-transduced GIMEN cells were used in an image-based chemical screen, to identify protein controllers of the MES cell state . This image-based small molecule screen included 2039 compounds chosen to target a wide array of protein targets . GIMEN cells were treated with a single dose { 10 mM) of compound on day one and permitted to grow for one week, after which cells were washed, fixed and imaged for per-cell quantification of mKate2 fluorescence and change in cell number quantitated by nuclear staining . It was observed that cytotoxic compounds , such as staurosporine and the irinotecan metabolite SN-38 , resulted in ablated fluorescence and reduced cell viability, whereas metabolite control compounds , such as the NKCC1 / 2 inhibitor furosemide and L-glutamine, had no effect on either fluorescence or viability .SJ0118WO PATENT

[0117] To identify compounds that specifically cause cell state changes without affecting viability, those compounds that caused loss of fluorescence (>40% reduction in per-cell mKate2 signal) but minimal changes in viability (±25% changes in cell number) were identified. Of the 2039 compounds tested, 17 (0.83%) compounds demonstrated these effects. These compounds were significantly enriched for those targeting the EP300 / CBP histone acetyltransferase (HAT) epigenetic proteins (Fisher's exact test p=3.0501xl0-6, fold enrichment relative to the total screen of ~48X) . Further, of these targets, EP300 / CBP proteins were the only ones inhibited by >1 compound, and, when ranked by magnitude of effect on mKate2 fluorescence, they were ranked #1-4 (FIG. 4) . Focused imagebased screening of these 17 compounds in multi-point doseresponse analysis for seven days in GIMEN-TRECS-N1 cells confirmed that EP300 / CBP-targeted compounds, including the top-ranked A485, remained the most potent agents at decreasing mKate2 signal without reducing cell number. The effect of the top-ranked compound A485 in GIMEN and an additional highly MES cell line, KPNSI9S was confirmed by conventional fluorescence microscopy. Similar effects were observed in 9464D cells. These data indicated that the EP300 / CBP chromatin regulatory proteins are controllers of the MES-like cell state, independent of effects on cell growth.

[0118] EP300 and CBP are paralogous, multi-domain-containing HAT enzymes that post-translationally catalyze the acetylation of susceptible lysine residues on target proteins, including establishing the H3K27ac modification on chromatin (Dancy & Cole (2015) Chem. Rev, 115:2419-2452) . Prior evidence has implicated EP300 and CBP in the control of cell state changes, by altering enhancer and promoter marks genome-wide, causing changes in gene expression (Sen et al. (2019) Mol. Cell 73:684- 698; Fauquier et al. (2018) Sci . Rep. 8:12629; Raisner et al.SJ0118WO PATENT(2018) Cell Rep. 24:1722-1729; Sen et al. (2019) Mol. Cell 73:684-698; Ebrahimi et al. (2019) Nat. Chem. Biol. 15:519- 528; Welti et al. (2021) Cancer Discov. 11:1118-1137; Nicosia et al. (2023) Cancer Cell 41:2136-2153) . EP300 and CBP can be targeted using inhibitors directed to their highly homologous domains, including the HAT, bromodomain, and KIX domains, as well as PROTAC degraders (Dancy & Cole (2015) Chem. Rev. 115:2419-2452; Lasko et al. (2017) Nature 550:128-132; Welti et al. (2021) Cancer Discov. 11:1118-1137; Michaelides et al. (2018) ACS Med. Chem. Lett. 9:28-33; Wimalasena et al. (2020) Mol. Cell 78:1086-1095; Joy et al. (2021) <J. Am. Chem. Soc. 143:15056-15062; Ramaswamy et al. (2018) Nat. Commun. 9:110; Vannam et al. (2021) Cell. Chem. Biol. 28:503-514; Durbin et al. (2022) Cancer Discov. 12:730-751) . The transcriptional effects of domain-specific or paralog-specific targeting of EP300 and CBP are context-dependent and may be distinct from each other (Shendy et al. (2024) Nature Comm. 15:3483; Zucconi et al. (2019) Biochemistry 58:2133-2143) . The four EP300 / CBP- targeted compounds that caused loss of mKate2 signal without major loss of cell number were either HAT (A485) or bromodomain inhibitors (CPI-637, GNE-272, GNE-049) . Therefore, to explore the role of EP300, CBP or both in this phenotype, a panel of active and control compounds that target individual domains of EP300 / CBP (Bromodomain, HAT domain, KIX domain) , or degrade both EP300 / CBP proteins were assembled and a targeted doseresponse image-based screen was performed in TRECS-Nl- transduced highly MES GIMEN and KPNSI9S cells over seven days. As before, profound loss of mKate2 fluorescence was observed, without effects on cell growth, with A485 treatment. Loss of fluorescence was observed with multiple distinct inhibitors of both EP300 / CBP HAT and bromodomains, as well as with PROTACs targeting both EP300 and CBP, but not KlX-domain targeting compounds or inactive compound controls. Together, these dataSJ0118WO PATENT indicated that combined EP300 / CBP inhibition using HAT or bromodomain inhibitors is required to reduce mKate2 fluorescence without causing changes in cell number .

[0119] Since EP300 / CBP-inhibition reduced mKate2 fluorescence, and TRECS-Nl-driven fluorescence was associated with the MES-like state, it was hypothesized that EP300 / CBP inhibition would cause loss of the molecular signature and phenotypic properties of the MES cell state . A perturbation of this type , driving cell state changes from a relatively chemoresistant MES-like to a more chemosensitive ADRN-like state , would be potentially therapeutically valuable . Thus , the molecular consequences of A485 treatment on MES cells was examined . GIMEN cells were treated with either 5 mM A485 or DMSO for seven days and RNA-seq was performed. Comparison of A485 and DMSO-treated RNA-seq profiles demonstrated profound global changes in the expressed transcriptome . Specific analysis of ADRN and MES gene signatures by GSEA demonstrated that treatment with A485 caused transcriptional changes consistent with partial loss of a MES-like , and minor gain of a more ADRN-like gene expression program. As previously, a GSEA analysis of the MSigDB "Epithelial-to-mesenchymal transition" Hallmarks geneset demonstrated that A485 caused loss of this signature ( comparison DMSO to A485 - NES : -2 . 026, q-value : 9 . 8xl0-18) . Similarly, A485 treatment of KPNSI 9S and SHEP MES cells caused loss of MES-like gene expression programs .

[0120] To confirm that direct targeting of EP300 / CBP were responsible for the observed changes in cell state, CRISPR- cas 9-mediated knockouts were performed using sgRNAs targeting EP300 (EP300-1 , EP300-2 ) , CBP (CBP-1 , CBP-2 ) or non-targeted controls (LACZ , ch2 . 2 ) in GIMEN cells , followed by RNA-seq analysis . Western blot analysis demonstrated loss of the relevant protein species following lentiviral transductionSJ0118WO PATENT with the sgRNA . Individual knockout of either EP300 or CBP was sufficient to cause loss of MES , with minimal effect on ADRN, gene signatures . Generally, the effects of EP300 or CBP knockout were quite distinct . Specific evaluation demonstrated that individual knockout of either EP300 or CBP led to some overlapping and yet additional distinct changes in expression of gene members of the MES signature . These data indicate that both EP300 and CBP contribute to the maintenance of the MES cell state .

[0121] EP300 and CBP catalyze the acetylation of H3-K27 , and A485 is a potent inhibitor of this activity (Las ko et al . ( 2017 ) Nature 550 : 128-132 ) . To understand the kinetics of A485-driven transcriptional reprogramming and its relationship to EP300 / CBP 40 activity, the effects of A485 on the H3K27ac mark was examined over time . Treatment of GIMEN cells with a single dose of A485 resulted in loss of H3K27ac, which recovered by day seven of treatment . Similar changes were observed in the H3K4mel enhancer mark, without changes in total levels of histone H3, indicating that A485 induces loss of enhancer marks, which recover by day seven . Since A485 induced global transcriptional reprogramming without significant effects on cell viability, corresponding changes in enhancers were examined using CUT&RUN before treatment and after recovery from A485 treatment . Cells treated and recovered from A485 demonstrated a genome-wide redistribution of enhancer signal, marked by H3K27ac and H3K4mel . Integrating enhancer marks and transcriptional output , it was observed that genes that were transcriptionally downregulated after recovery from A485 treatment were associated with reduced H3K27ac and H3K4mel , and genes transcriptionally upregulated after recovery from A485 treatment were associated with enhanced H3K27ac and H3K4mel signal . Consistent with the finding that A485 caused transcriptional reprogramming of cellSJ0118WO PATENT state , the H3K27ac and H3K4mel marks associated with the gene members of the ADRN and MES signatures were examined . Loss or gain of expression of MES or ADRN genes, respectively, was associated with corresponding loss or gain of H3K27ac and H3K4mel enhancer marks . Together, these data indicate that targeting EP300 / CBP using A485 causes suppression of EP300 / CBP catalytic activity in MES cells , resulting in epigenetic reprogramming marked by distinct placement of the H3K27ac and H3K4mel enhancer marks , with corresponding transcriptional changes . These transcriptional changes are associated with loss of a MES-like and partial gain of an ADRN-like state in GIMEN cells .

[0122] It was subsequently determined whether these molecular changes in cell state , driven by EP300 / CBP inhibition, were associated with increased sensitivity to chemotherapeutic agents . Epigenetic and transcriptional reprogramming of GIMEN or KPNSI9S cells was induced by treating once with A485 to reprogram cells , followed by chemosensitivity assays . GIMEN and KPNSI9S cells treated with A485 were more sensitive to a variety of chemotherapies , including anthracyclines (doxorubicin, thiotepa ) and topoisomerase inhibitors (topotecan, etoposide) , with a reduction in IC50 of 1 . 8 -7 . 5 fold (Table 6 ) .SJ0118WO PATENT

[0123] These findings were not universal , however, since A485-treated GIMEN and KPNSI9S cells showed no differences from DMSO-treated cells in response to 4 ' - hydroxycyclophosphamide . Thus, transient inhibition of EP300 / CBP is sufficient to drive a cell state change to a less MES state , marked by reduced TRECS-N1 signal and both transcriptional and epigenetic reprogramming, which enhances sensitivity to multiple chemotherapeutic agents used in the management of high-risk NB .

[0124] Subsequently, it was determined whether EP300 / CBP inhibition could enforce loss of the MES state in an in vivo setting that more faithfully models human NB . To do so, the intermediate but ADRN-dominant murine 9464 D-TRECS-N1 cell line was allografted into immunocompetent C57B1 / 6 mice and these tumor-bearing mice were treated with A485 or vehicle control for four days . An RNAscope™ assay was optimized to detect mKa te2 expression in tumor cells and this assay was performed on tumor samples from mice treated with either A485 or vehicle control . Treatment with A485 profoundly reduced detectable mKate2 expression by RNAscope™ assay . Consistent with these observations, RNA-seq analysis of tumor material also demonstrated reduced MES signatures . Together, these data indicate that EP300 / CBP inhibition is sufficient to suppressMES-like signatures in vivo .

Claims

SJ0118WO PATENTWhat is claimed is :1 . A lentiviral vector for real-time monitoring of cell state comprising( i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility ; and( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter .2 . The lentiviral vector of claim 1 , wherein the first selection marker is a fluorescent protein .3 . The lentiviral vector of claim 1 , wherein the minimal promoter is a cytomegalovirus promoter .4 . The lentiviral vector of claim 1 , wherein the regulatory element is an enhancer .5 . The lentiviral vector of claim 1, wherein the second selection marker comprises a puromycin resistance protein or blasticidin resistance protein .

6. The lentiviral vector of claim 1, wherein the constitutive promoter comprises a phosphoglycerate kinase promoter .7 . A method of identifying a cell-state-specific regulatory element in a cell comprisingSJ0118WO PATENT(a ) detecting a genomic region in the cell that is preferentially marked by histone H3K27-acetylation and / or chromatin accessibility when the cell is in a first state as compared the cell in a second state ;(b) introducing said genomic region preferentially marked by histone H3K27-acetylation and / or chromatin accessibility into a lentiviral vector comprising(i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and the cell-state-specific regulatory element , and( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter;(c) introducing the lentiviral vector into a population of host cells ;(d) selecting, from the population of host cells , a host cell that expresses the second selection marker ; and( e) determining whether the first selection marker is expressed by the host cell of (d) when the host cell is in the first state as compared the second state, thereby identifying the cell-state-specific regulatory element .8 . The method of claim 7 , wherein the first state and the second state comprise a first tissue or type and a second tissue or type, a first developmental stage and / or differentiation stage and a second developmental stage and / or differentiation stage, or a first physiological , pathological or environmental stress or condition and a second physiological , pathological or environmental stress or condition .SJ0118WO PATENT9 . A method of optically screening a compound for the ability to modify cell identity comprising(a ) introducing into a population of host cells a lentiviral vector comprising( i ) a first nucleic acid encoding a first selection marker, said f irst nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27-acetylation marks and / or chromatin accessibility; and(ii) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter;(b) selecting, from the population of host cells , a host cell that expresses the second selection marker;( c) contacting the selected host cell of (b) with a test compound; and(d) measuring expression of the second selection marker by the cells of (c) , wherein the level of expression of the second selection marker is indicative of test compound' s ability to modify cell identity .

10. A method of in vivo labeling normal and / or diseased cells at a specific developmental stage or a specific stage of disease comprising introducing into a population of normal cells , diseased cells, or combination, thereof a lentiviral vector comprising :(i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cel l state-specific histone H3K27-acetylation marks and / or chromatin accessibility, wherein the cell statespecific histone H3K27-acetylation marks and / or chromatinSJ0118WO PATENT accessibility of the regulatory element are associated with a specific developmental stage or a specific stage of disease ; and( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter , thereby in vivo labeling the normal and / or diseased cells at a specific developmental stage or a specific stage of disease .11 . The method of claim 10 , wherein the diseased cells are cancer cells .12 . The method of claim 10 , the number of labeled normal cells and / or diseased cells in the population of cells is quantified .

13. A method for real-time monitoring of transcription of a cell exposed to a stress comprising :( a) introducing into a population of cells a lentiviral vector comprising( i ) a first nucleic acid encoding a first selection marker, said first nucleic acid being operably linked to a minimal promoter and a regulatory element selected for having differential cell state-specific histone H3K27 -acetylation marks and / or chromatin accessibility; and( ii ) a second nucleic acid encoding a second selection marker, said second nucleic acid being operably linked to a constitutive promoter;(b) selecting, from the population of host cells , a host cell that expresses the second selection marker(c ) exposing the selected host cell of (b) to a stress ; andSJ0118WO PATENT(d) measuring expression of the second selection marker by the cells of (c) , thereby monitoring transcription in the cell exposed to the stress in real-time .14 . The method of claim 13 , wherein the stress is a physiological, pathological or environmental stress .

15. A kit comprising the lentiviral vector of claim 1 .

Images