Application of lncRNA TCONS_00131158 in the Regulation of Goat Testosterone Synthesis and Assessment of Reproductive Potential
By detecting and regulating the long non-coding RNA TCONS_00131158, a ceRNA network was constructed, which solved the problems of assessing and regulating goat reproductive potential and testosterone synthesis, and achieved the effects of early screening of high-quality breeding rams and promoting the function of testicular interstitial cells.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2026-03-12
- Publication Date
- 2026-06-19
AI Technical Summary
The lack of effective molecular markers and methods in current technology to assess the male reproductive potential of goats and regulate testosterone synthesis affects breeding efficiency and economic benefits.
By detecting the expression level of long non-coding RNA TCONS_00131158, a ceRNA regulatory network was constructed to regulate the biological activities of miR-30c-3p and SERPINH1, and candidate substances regulating testosterone synthesis were screened. Kits and drug compositions were provided to promote the proliferation and functional maintenance of goat testicular interstitial cells.
It provides molecular markers for assessing the reproductive potential of male goats, rapidly screens candidate substances that regulate testosterone synthesis, promotes cell proliferation and functional maintenance, and improves breeding efficiency and economic benefits.
Smart Images

Figure CN122235313A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal molecular breeding technology, and in particular to the application of LncRNA TCONS_00131158 in regulating goat testosterone synthesis and assessing reproductive potential. Background Technology
[0002] Goat farming is an important part of my country's animal husbandry, and male reproductive capacity directly affects breeding efficiency and economic benefits. The testes, as the primary male reproductive organ, determine spermatogenesis quality and hormone synthesis capacity, thus influencing overall reproductive performance. In goat breeding practice, how to assess the reproductive potential of rams early and select high-quality breeding rams has always been a key concern for animal husbandry workers.
[0003] Long non-coding RNAs (lncRNAs) are a class of RNA molecules exceeding 200 nucleotides in length that do not encode proteins and are widely found in eukaryotes. Studies have shown that lncRNAs participate in gene expression regulation through various mechanisms, including chromatin modification, transcriptional regulation, and the competitive adsorption of microRNAs as endogenous RNA. LncRNAs play important regulatory roles in mammalian testicular development and spermatogenesis, but their specific functions and regulatory networks in goats remain unclear.
[0004] MicroRNAs are a class of endogenous non-coding RNAs approximately 22 nucleotides long. They primarily bind to the 3' untranslated region of target gene mRNAs, leading to mRNA degradation or translational repression. miRNAs play crucial roles in various biological processes, including cell proliferation, differentiation, apoptosis, and hormone synthesis. SERPINH1, also known as HSP47, is a collagen-specific molecular chaperone located in the endoplasmic reticulum. It is mainly responsible for the proper folding and secretion of procollagen, playing a vital role in maintaining the integrity of the extracellular matrix. Currently, systematic research is lacking on the regulatory relationships between lncRNAs, miRNAs, and SERPINH1 in goat testicular development and their effects on testosterone synthesis. Summary of the Invention
[0005] The purpose of this invention is to provide the application of LncRNA TCONS_00131158 in regulating testosterone synthesis and assessing reproductive potential in goats, thus solving the technical problem of lacking effective molecular markers and technical means for assessing male reproductive potential in goats and regulating testosterone synthesis.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides the application of a reagent for detecting the expression level of the long non-coding RNA TCONS_00131158 in the preparation of a kit for assessing the reproductive potential of male goats.
[0007] The present invention also provides the application of TCONS_00131158 in the preparation of a kit for assessing the developmental status of goat testes.
[0008] The present invention also provides a method for screening candidate substances that regulate testosterone synthesis in goats, comprising the following steps: contacting the candidate substance with testicular interstitial cells expressing TCONS_00131158; detecting the expression level or activity of TCONS_00131158; if the candidate substance significantly upregulates the expression or activity of TCONS_00131158, it is determined to be a candidate substance that promotes testosterone synthesis; if it significantly downregulates, it is determined to be a candidate substance that inhibits testosterone synthesis.
[0009] The present invention also provides a method for regulating testosterone synthesis in goat testicular interstitial cells, including regulating the biological activity of miR-30c-3p by regulating the expression level of TCONS_00131158.
[0010] The present invention also provides the use of miR-30c-3p inhibitors in the preparation of drugs that promote the proliferation of goat testicular interstitial cells or testosterone synthesis.
[0011] The present invention also provides a method for upregulating SERPINH1 expression, including overexpressing TCONS_00131158 or inhibiting miR-30c-3p.
[0012] This invention also provides the application of SERPINH1 as a target in screening candidate substances that promote goat testosterone synthesis.
[0013] The present invention also provides the use of a composition in the preparation of a product that promotes the proliferation of goat testicular interstitial cells, the composition comprising any one of the following: a vector overexpressing TCONS_00131158; or a miR-30c-3p inhibitor; or a vector overexpressing SERPINH1.
[0014] The present invention also provides the application of reagents for detecting at least two expression levels of TCONS_00131158, miR-30c-3p and SERPINH1 in the preparation of kits for assessing goat reproductive potential.
[0015] The present invention also provides a method for regulating apoptosis of goat testicular interstitial cells, the method comprising regulating the expression levels of TCONS_00131158, miR-30c-3p or SERPINH1.
[0016] The beneficial effects of this invention are: This invention provides molecular markers for assessing the male reproductive potential of goats and their applications. These markers effectively indicate the physiological state during critical window periods of testicular development, providing new detection indicators for early screening of high-quality breeding rams. The invention also provides a screening model based on these markers, which can be used to rapidly screen candidate substances that regulate testosterone synthesis, thus providing technical support for the development of drugs or feed additives that promote male reproductive function. Furthermore, this invention provides various intervention methods for regulating the function of testicular interstitial cells. These methods can effectively promote cell proliferation and maintain function, and have significant application prospects and economic benefits in livestock production practices. Attached Figure Description
[0017] Figure 1 Morphological characteristics and physiological parameters of testicular development in Qianbei Ma sheep. (A) Representative scanning electron microscope (SEM) images of testicular tissue at 0, 6, 12, and 18 months of age (0 M, 6 M, 12 M, 18 M). (B) Histological observation of testicular microstructure by hematoxylin-eosin (H&E) staining. Arrows indicate different cell types inside and outside the seminiferous tubules. (C–E) Changes in the diameter, area, and circumference of the seminiferous tubules. (F–H) Quantitative analysis of Ledich cell density, Sertoli cell density, and serum testosterone concentration at different developmental stages. Abbreviations: LC, Ledich cells; SC, Sertoli cells; SPg, spermatogonia; SPc, spermatocytes; SPt, spermatids; Sz, sperm; M, age in months. Note: Data are expressed as mean ± standard deviation (or standard error; please verify the data). Different lowercase letters (a–d) above the bars indicate significant differences between age groups (P<0.05).
[0018] Figure 2 Transcriptomic analysis for testicular development. (A) Hierarchical clustering heatmap of transcripts. (B) Principal component analysis (PCA) plot showing sample distribution. (C) Counts of upregulated and downregulated transcripts in pairwise comparisons. (D) Venn diagram showing overlapping regions of differentially expressed transcripts.
[0019] Figure 3 Functional enrichment analysis and qPCR validation of lncRNA target genes. (A) 30 most significantly enriched GO terms for target genes. (B) 20 most significantly enriched KEGG pathways for target genes. (C) Comparison of qRT-PCR validation results of selected lncRNAs with RNA-seq data. Note: Data are mean ± standard deviation. Abbreviations: GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genetics and Genomes.
[0020] Figure 4Construction and experimental validation of the ceRNA network. (A) Visualization of the lncRNA-miRNA-mRNA regulatory network. (B) GO enrichment analysis of network mRNAs. (C) KEGG pathway enrichment analysis of network mRNAs. (D–E) Dual-luciferase reporter gene assay to verify the binding of miR-30c-3p to TCONS_00131158 (D) and SERPINH13' UTR (E). Note: Data are mean ± standard deviation. **P<0.01.
[0021] Figure 5 Leydig cell identification and TCONS_00131158 vector efficiency validation. (A) Immunofluorescence identification of primary goat Leydig cells. (B–C) Validation of the efficiency of the TCONS_00131158 overexpression vector (B) and interference vector (C) by qRT-PCR. (D–E) Effect of TCONS_00131158 vector on miR-30c-3p (D) and SERPINH1 (E) expression. Note: Data are mean ± standard deviation. *P<0.05, **P<0.01. ns, no statistical significance.
[0022] Figure 6 TCONS_00131158 promotes Leydig cell proliferation and steroid production gene expression. (A) EdU proliferation assay (scale bar = 100 μm). (B) Colony formation assay. (C) Quantitative analysis of EdU-positive cells. (D) Quantitative analysis of colony number. (EF) Cell viability of the overexpression group (E) and the knockdown group (F) was detected by CCK-8 assay. (GJ) Relative mRNA expression levels of CYP17A1 (G), CYP11A1 (H), HSD17B (I), and STAR (J). Note: Data are expressed as mean ± standard deviation. *P<0.05, **P<0.01.
[0023] Figure 7 Effects of TCONS_00131158 on apoptosis and testosterone secretion. (A–B) Apoptosis detected by TUNEL staining (A) and flow cytometry (B). (C–D) Statistical analysis of apoptosis index (C) and apoptosis rate (D). (E–F) Testosterone concentrations in the overexpression group (E) and the knockdown group (F). Note: Data are mean ± standard deviation. *P<0.05, **P<0.01.
[0024] Figure 8To investigate the regulation of testicular interstitial cell function by miR-30c-3p. (A–D) Cell proliferation was assessed by EdU staining (A, C) and colony formation assays (B, D). (E–F) Cell viability of the mimic group (E) and the inhibitor group (F) was detected by CCK-8 assay. (G) Transfection efficiency of chi-miR-30c-3p was verified. (H–K) Relative mRNA expression levels of CYP17A1(H), CYP11A1(I), HSD17B(J), and STAR(K). Note: Data are mean ± standard deviation. *P<0.05, **P<0.01.
[0025] Figure 9 To investigate the regulatory role of miR-30c-3p in apoptosis and testosterone production. (A–D) Apoptosis was assessed by TUNEL staining (A, C) and flow cytometry (B, D) after transfection with the mimic or inhibitor. (E–F) Testosterone concentration in the culture supernatant of the mimic group (E) and the inhibitor group (F) was detected by ELISA. Note: Data are presented as mean ± standard deviation. *P<0.05, **P<0.01.
[0026] Figure 10 To investigate the role of SERPINH1 in promoting Leydig cell proliferation and steroid production gene expression. (A–D) Proliferation analysis was performed using EdU staining (A, C) and colony formation assays (B, D). (E–F) Cell viability was assessed using the CCK-8 assay between the overexpression group (E) and the knockdown group (F). (G–H) SERPINH1 overexpression (G) and knockdown efficiency (H) were validated. (I–L) Relative mRNA expression levels of CYP17A1 (I), CYP11A1 (J), HSD17B (K), and STAR (L). Note: Data are expressed as mean ± standard deviation. *P<0.05, **P<0.01.
[0027] Figure 11 To illustrate the regulatory role of SERPINH1 in apoptosis and testosterone production. (A–D) Apoptosis was detected by TUNEL staining (A, C) and flow cytometry (B, D) after SERPINH1 overexpression or knockdown. (E–F) Testosterone concentration in the culture supernatant of the overexpression group (E) and the knockdown group (F) was detected by ELISA. Note: Data are presented as mean ± standard deviation. *P<0.05, **P<0.01. Detailed Implementation
[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0029] Example 1. Overview This embodiment provides transcriptomic features of a critical window of goat testicular development and identifies a long non-coding RNA, TCONS_00131158, that regulates interstitial cell function and testosterone synthesis. By constructing a ceRNA regulatory network and using a dual-luciferase reporter gene assay, the target binding relationships between TCONS_00131158 and miR-30c-3p, and between miR-30c-3p and SERPINH1, were verified. In vitro cell experiments further confirmed that regulating the expression levels of TCONS_00131158, miR-30c-3p, or SERPINH1 significantly affects testicular interstitial cell proliferation, apoptosis, and the expression of steroid-related genes, thereby influencing testosterone synthesis capacity.
[0030] Materials and Methods 2.1 Laboratory Animals and Sample Collection The healthy male Qianbei Ma goats used in this invention were provided by Fuxing Livestock Co., Ltd. (Xishui County, Zunyi City, China), and their pedigree records were complete. The goats were divided into four groups according to age: 0 months, 6 months, 12 months, and 18 months (n=5 per group). Before castration, 10 mL of jugular vein blood was collected from each goat into a vacuum tube without anticoagulant. The blood sample was centrifuged at 3000×g for 15 minutes at 4°C to separate the serum, which was then stored at -80°C for subsequent hormone analysis. Castration was performed under anesthesia, and the left testis tissue was aseptically collected. The tissue processing procedure was as follows: (i) fixation with 4% paraformaldehyde for hematoxylin-eosin (H&E) staining; (ii) cutting into small pieces (<1 mm³), fixation overnight with 2.5% glutaraldehyde at 4°C for scanning electron microscopy (SEM) observation; (iii) fresh tissue for primary mesenchymal cell isolation; (iv) flash freezing in liquid nitrogen and storage at -80°C for RNA extraction. All experimental procedures were approved by the Animal Welfare Committee of Guizhou University (Approval No.: EAE-62U-2022-T055).
[0031] 2. Histological analysis and scanning electron microscopy examination For scanning electron microscopy (SEM), fixed samples were rinsed with PBS, post-fixed with 1% osmium tetroxide, dehydrated with graded ethanol, replaced with isoamyl acetate, critically dried, and finally sputter-coated with gold before observation under a Hitachi SU8010 SEM. For histological analysis, paraffin-embedded tissue sections were 4 μm thick and stained with hematoxylin and eosin (H&E). Sections were scanned using a CaseViewer 2.4 system (3DHISTECH, Hungary), and morphometric analysis (including seminiferous tubule diameter, area, and circumference) was performed using Image-Pro Plus 6.0 software. At least five non-overlapping fields of view were randomly selected for analysis from each animal.
[0032] 3. Isolation, culture and identification of primary mesenchymal cells Fresh testicular interstitial tissue was minced and digested with gentle shaking at 34°C for 15–20 minutes in DMEM / F12 medium containing type IV collagenase (0.25 mg / mL) and DNase I (0.01 mg / mL). The suspension was filtered through a 70 μm filter and centrifuged at 300 × g for 5 minutes. Leydig cells were enriched by intermittent Percoll density gradient centrifugation (20%, 40%, and 60%) at 800 × g for 20 minutes. Cells at 40–60% interface were collected, washed, and cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C under humidified conditions of 5% CO2. Cell purity was assessed by immunofluorescence assay using an anti-3β-hydroxysteroid dehydrogenase-specific antibody (3β-HSD; 1:500; Bioss). FITC-labeled goat anti-rabbit IgG (1:200; Proteintech) was used as the secondary antibody, and the cell nuclei were counterstained with DAPI. Images were captured using a fluorescence microscope (Nikon Eclipse Ti).
[0033] 4 RNA extraction and library construction Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific). RNA integrity and concentration were assessed using an Agilent 2100 Bioanalyzer (RIN≥7.0). Ribosomal RNA was removed using the Ribo-Zero Gold rRNA Removal Kit, and strand-specific libraries for long non-coding RNA (lncRNA) and mRNA sequencing were constructed for sequencing on the Illumina NovaSeq 6000 platform. The raw sequencing data generated in this invention has been stored in the NCBI Bioproject database, accession number PRJNA917820 (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA917820).
[0034] 5. Quality Control and Transcript Identification Raw reads were filtered using FASTP. Clean reads were aligned to the Caprahircus reference genome using TopHat2. Transcripts were assembled using StringTie. Identification of long non-coding RNAs (lncRNAs) was based on stringent criteria: length ≥200 nt, number of exons ≥2, and no protein-coding potential as assessed by CPC2, CNCI, and CPAT tools.
[0035] 6. Differential Expression and Functional Enrichment Differential expression analysis was performed using DESeq2 software. Transcripts with |log2 (fold change)| ≥ 1 and a false detection rate (FDR) < 0.05 were considered differentially expressed. Target prediction for long non-coding RNAs (lncRNAs) was based on cis-regulation (within 100 kb) and trans-regulation (Pearson|r| > 0.95). GO and KEGG enrichment analyses were performed using GOseq and KOBAS software, respectively (P < 0.05).
[0036] 7. ceRNA Network Construction Interactions between long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) were predicted using miRanda (score ≥150, energy ≤−20 kcal / mol) and RNAhybrid (energy ≤−20 kcal / mol). Targets of miRNAs and mRNAs were predicted using TargetScan and miRDB. The ceRNA network was constructed based on a "lncRNA-miRNA-mRNA" axis, requiring a positive correlation between lncRNAs and mRNAs (r ≥ 0.6) and a negative correlation between miRNAs and their targets (r ≤ −0.4). The network was visualized using Cytoscape v3.7.1.
[0037] 8. qRT-PCR validation Total RNA was reverse transcribed using the EvoM-MLV reverse transcription kit (for mRNA / lncRNA) or the miRNA-specific reverse transcription kit (Qingdao Biotechnology Co., Ltd.). qRT-PCR was performed using SYBR GreenMasterMix on a Bio-Rad CFX96 system. GAPDH and U6 were used as internal controls. Relative expression levels were calculated using the 2^− ΔΔCt method. Primer sequences are shown in Table S1.
[0038] GeneName Primer sequence Length (bp) Tm (°C) TCONS_00131158 F: 5′-TCCTACTCCTTAAAGCATGGC-3′ as shown in SEQ ID NO.1 R: 5′-CCCTGTATCACTGTCCATCTC-3′ as shown in SEQ ID NO.2 129 60 chi-miR-30c-3p F:CTGGGAGAGGGTTGTTTACTC as shown in SEQ ID NO.3 177 60 SERPINH1 F 5′-GAAGGTCTGGATGGGCAAG-3′ as shown in SEQ ID NO.4 R 5′-TCTGCCTTGTTCTTGTCGATG-3′ as shown in SEQ ID NO.5 132 60 STAR F 5′-CTGAGTAAAGTGATCCCTGACG-3′ as shown in SEQ ID NO.6; R 5′-GACCTTGATCTCCTTGACACTG-3′ as shown in SEQ ID NO.7. 143 60 CYP11A1 F 5′-GGTCCCACTTCTCAAAGCTAG-3′ as shown in SEQ ID NO.8; R 5′-AGTGTCTTGGCAGGAATCAG-3′ as shown in SEQ ID NO.9. 124 58 CYP17A1 F 5′-ACAATGAGAAGGAGTGGCAG-3′ as shown in SEQ ID NO.10; R 5′-ATGGCGAGATGAGTTGTGTC-3′ as shown in SEQ ID NO.11. 85 60 HSD17B4 F 5′-GTTGCTCCTTTAGTTCTTTGGC-3′ as shown in SEQ ID NO.12; R 5′-ATTGGCTGATCCTTTCCTCTG-3′ as shown in SEQ ID NO.13. 140 61 TCONS_00030176 F 5′-AAATCACTTGTAACGTGTTGGTG-3′ as shown in SEQ ID NO.14; R 5′-AGGGACTGGTTTTGGACATT-3′ as shown in SEQ ID NO.15. 226 61 TCONS_00031983 F 5′-CTACCGTCTTCCATCACTATCAC-3′ as shown in SEQ ID NO.16; R 5′-TGCCTAAAATGAATACAAATCTCCC-3′ as shown in SEQ ID NO.17. 148 61 TCONS_00030702 F 5′-GAACCCCAGTGTGGATACAG-3′ as shown in SEQ ID NO.18; R 5′-GGAAGGAGCTGAGTTTGTGC-3′ as shown in SEQ ID NO.19. 165 61 TCONS_00025437 F 5′-CGTGTGCAGCGCCTGCAGCC-3′ as shown in SEQ ID NO.20; R 5′-GACGGTGCGCCCCCCACGTC-3′ as shown in SEQ ID NO.21. 120 60 TCONS_00031568 F 5′-GGCAGTAATCACTTTCCTTCTGAC-3′ as shown in SEQ ID NO.22; R 5′-CTGTCCACACACCACCGAGG-3′ as shown in SEQ ID NO.23. 109 59 TCONS_00260219 F 5′-GGTGAAAACCAACATTGGCCTTG-3′ as shown in SEQ ID NO.24; R 5′-ACTTATGAGGGCAGGAAGCT-3′ as shown in SEQ ID NO.25. 121 60 TCONS_00183747 F 5′-TTCTTTGCCAGAAGACACATTC-3′ as shown in SEQ ID NO.26; R 5′-GCTCCTCAGAGCAGAGGAC-3′ as shown in SEQ ID NO.27. 128 59 GAPDH F 5′-TGGAGAAACCTGCCAAGTATG-3′ as shown in SEQ ID NO.28; R 5′-TGAGTGTCGCTGTTGAAGTC-3′ as shown in SEQ ID NO.29. 112 60 U6 F:TGGAACGTATCAGAGAAGATAGCA As shown in SEQ ID NO.30 25 60 2.9 Dual-luciferase reporter gene assay Researchers synthesized the wild-type (WT) and mutant (MUT) sequences of TCONS_00131158, as well as the SERPINH13′ UTR containing the putative miR-30c-3p binding site, and cloned them into the pmirGLO vector. HEK293T cells were seeded in 24-well plates and co-transfected with Lipofectamine 3000 (Invitrogen) along with a reporter plasmid (500 ng) and either a miR-30c-3p mimic or a negative control (50 nM). Forty-eight hours after transfection, luciferase activity was detected using the Dual-Luciferase Reporter Assay System (Promega).
[0039] 10. Plasmids, siRNA, and cell transfection The full-length sequence of TCONS_00131158 and the coding sequence of SERPINH1 were cloned into the pcDNA3.1 vector to construct an overexpression vector. Small interfering RNAs (siRNAs) targeting TCONS_00131158 and SERPINH1, miR-30c-3p mimics, inhibitors, and corresponding negative controls were synthesized by GenePharma Ltd. (Shanghai, China). The specific sequences of these oligonucleotides are listed in Table S2.
[0040] Name sequences (5'-3') pcDNA3.1 TCONS_00131158 F: GGCAAAGCCAGAGTAACATCCT as shown in SEQ ID NO.31 R: GGATGGGAGCAGATCAATCGATA as shown in SEQ ID NO.32 Si 1-TCONS_00131158 sense:AAGCCAGAGUAACAUCCUCUCT as shown in SEQ ID NO.33 antisense:GAGAGGAUGUUACUCUGGCUUT as shown in SEQ ID NO.34 Si 2-TCONS_00131158 sense:GCCUAGACCUUCCUGGUCCUGT as shown in SEQ ID NO.35 antisense:CAGGACCAGGAAGGUCUAGGCT as shown in SEQ ID NO.36 Si 3-TCONS_00131158 sense:GCGUGCCAUGAAUUUUUCAUCT as shown in SEQ ID NO.37 antisense:GAUGAAAAAUUCAUGGCACGCT as shown in SEQ ID NO.38 pcDNA3.1-SERPINH1 F:GGGAAGCTTGCCACCATGCGTGCCCTCTTGCTCATC (as shown in SEQ ID NO. 39) R: GGGCTCGAGCTACAACTCGTCTCGCATCTT as shown in SEQ ID NO.40 Si 1-SERPINH1 sense: GGUCACCAAGGACGUGGAG as shown in SEQ ID NO.41 antisense: CUCCACGUCCUUGGUGACC as shown in SEQ ID NO.42 Si 2-SERPINH1 sense:GGUCUCUACAACUACUAUG as shown in SEQ ID NO.43 antisense:CAUAGUAGUUGUAGAGACC as shown in SEQ ID NO.44 miR-30c-3p mimic sense: CUGGGAGAGGGUUGUUUUACUC as shown in SEQ ID NO.45 antisense: GAGUAAACAACCCUCUCCCAG as shown in SEQ ID NO.46 miR-30c-3p inhibitor GAGUAAACAACCCUCUCCCAG as shown in SEQ ID NO.47 Following the manufacturer's instructions, mesenchymal cells were transfected using the Lipofectamine 3000 transfection method at 60-70% confluence. Transfection efficiency was verified by qRT-PCR 24-48 hours later.
[0041] 11 Phenotypic testing and testosterone measurement Cell proliferation was assessed using EdU (RiboBio) and colony formation assays. Cell viability was monitored using a CellCounting Kit-8 (CCK-8). Apoptosis was assessed using TUNEL staining (Roche) and Annexin V-FITC / PI flow cytometry (BD Biosciences). To detect testosterone levels, cell culture supernatant was collected and centrifuged at 1000×g for 10 min to remove debris. Serum samples were thawed and diluted as needed. Testosterone concentration was quantified using a goat-specific ELISA kit (Cusabio, Wuhan, China) with a sensitivity of 0.1 ng / mL. Absorbance was measured at 450 nm using a microplate reader.
[0042] 12 Statistical Analysis All data are expressed as mean ± standard deviation and were derived from at least three independent experiments. Statistical analysis was performed using SPSS 21.0 software. Differences between two groups were analyzed using Student's test, and comparisons among multiple groups were performed using one-way ANOVA followed by LSD post-hoc test. P < 0.05 was considered statistically significant.
[0043] result 3.1 Testicular development characteristics of the pre-Northern Goat To clarify the developmental characteristics of the testes in Qianbei Ma sheep, this invention analyzed the morphological changes and physiological parameters of four age groups (0, 6, 12, and 18 months of age). Scanning electron microscopy (SEM) and hematoxylin-eosin (H&E) staining showed that the testicular structure exhibited progressive sexual maturation. Figure 1A, B). At 0 months of age, the seminiferous tubules are slender and loosely arranged, with no obvious lumen; however, from 6 months of age, the tubules gradually become tortuous and dense, and by 12-18 months of age, they develop a clearly defined lumen and a complete spermatogenic lineage—including interstitial cells, spermatogonia, spermatocytes, and sperm. Consistent with histological observations, quantitative analysis showed that the diameter, area, and circumference of the seminiferous tubules increased significantly with age, reaching a peak at 18 months of age. Figure 1 CE). A significant developmental pattern was observed in cell dynamics: interstitial cell density decreased significantly after 0 months of age ( Figure 1 F), while supporting cell density and serum testosterone levels increased sharply at 6 months of age and remained elevated until 18 months of age. Figure 1 (G, H), which reflects the initiation and maintenance of sexual maturity.
[0044] 2. Transcriptomic dynamics of testicular development in northern Guizhou sheep To elucidate the molecular basis of differences in testosterone levels and morphological changes at different developmental stages, this invention performed high-throughput long non-coding RNA (lncRNA) sequencing on testicular tissues from four age groups. Principal component analysis (PCA) revealed significant segregation in the transcriptome profiles. Figure 2 B): The 0-month group formed independent and significant clusters, explaining most of the variance (principal component 1: 83.36%), while the 6-month, 12-month, and 18-month groups clustered tightly. Hierarchical cluster analysis further confirmed this pattern. Figure 2 A) revealed a significant shift in expression characteristics after 0 months, followed by a relative stabilization across groups. Quantitative analysis of differentially expressed transcripts further highlighted this developmental trajectory: such as... Figure 2 As shown in Figure C, the most significant transcriptome reprogramming was observed between the 0-month and 6-month groups, with a total of 10,785 differentially expressed transcripts identified (9,074 upregulated and 1,711 downregulated). Comparisons at later time points showed a significant decrease in changes. The overlap of these differentially expressed transcripts is illustrated in the Venn diagram. Figure 2 D). The overall results indicate that the 0-6 month period is the most critical window for testicular development; therefore, the subsequent screening of key functional lncRNAs focused on the comparison between the 0-month and 6-month groups.
[0045] 3 lncRNA function prediction and key lncRNA screening To elucidate the potential biological functions of identified long non-coding RNAs (lncRNAs), this invention predicts their potential target genes based on genomic proximity and expression correlation, and performs GO and KEGG enrichment analyses. Figure 3As shown in Figure A, differentially expressed lncRNA predicted target genes in the 0 M vs. 6 M comparison were significantly enriched in key GO terms of tissue remodeling (such as “cell fate determination” and “extracellular matrix”), suggesting that lncRNAs may regulate the broad morphological differentiation observed at this stage by modulating these specific coding genes. Meanwhile, KEGG pathway analysis ( Figure 3 B) The high enrichment of LncRNAs in pathways related to environmental information processing (particularly focal adhesion and MAPK signaling) suggests that LncRNAs may be involved in establishing intercellular interaction and signal transduction networks. Based on these functional characteristics, this invention screened candidate regulators with high expression abundance (FPKM>10), significantly differential expression (|log2FC|>2), and whose target genes were enriched in the steroid hormone biosynthesis pathway. TCONS_00131158 was identified as the best candidate. To further verify the reliability of the sequencing data, this invention performed qRT-PCR validation on eight randomly selected LncRNAs (including TCONS_00131158); as shown Figure 3 As shown in C, its expression trend is highly consistent with the RNA-seq data (Pearson r>0.9), confirming the accuracy of the transcriptome analysis.
[0046] 4. Construction of ceRNA network and validation of key regulatory axes To investigate the regulatory mechanism of TCONS_00131158, this invention constructed a LncRNA-miRNA-mRNAceRNA network. This network is based on the interactions predicted by miRanda and RNAhybrid, and cross-validated with TargetScan and miRDB results. These interactions were rigorously screened by expression correlation and visualized in Cytoscape. Figure 4 A). Network topology analysis revealed miR-30c-3p as a core node, and TCONS_00131158 was predicted to bind to miR-30c-3p, potentially regulating SERPINH1. Functional annotation of the network mRNAs indicated its role in "male gonadal development" (GO). Figure 4 B) and "steroid hormone biosynthesis" (KEGG, Figure 4 Enrichment in C) supports its role in testicular maturation. Crucially, dual-luciferase reporter gene assays confirmed direct binding within this axis: co-transfection with miR-30c-3p mimics significantly reduced wild-type TCONS_00131158 compared to the negative control. Figure 4 D) and SERPNH13' UTR ( Figure 4The luciferase activity of the E) vector was significantly reduced (P<0.01), while no significant inhibition was observed in the mutant group, thus verifying the physical interaction of the TCONS_00131158 –miR-30c-3p–SERPINH1 axis.
[0047] 5. Leydig cell identification and TCONS_00131158 vector construction This invention first isolates Ledhi cells from newborn goats and verifies them using immunofluorescence staining. Figure 5 A). Subsequently, the TCONS_00131158 overexpression vector and interference vector were constructed. qRT-PCR analysis showed that the overexpression vector significantly increased its abundance (A). Figure 5 B), while the si-TCONS_00131158-1 vector exhibited the highest knockdown efficiency (B), Figure 5 C), and was therefore selected for subsequent experiments. Next, this invention examined the effects of TCONS_00131158 on miR-30c-3p and SERPINH1 expression. Overexpression of TCONS_00131158 significantly inhibited miR-30c-3p levels and upregulated SERPINH1 mRNA expression; conversely, knockdown of TCONS_00131158 led to upregulation of miR-30c-3p and a simultaneous decrease in SERPINH1 levels. Figure 5 D, 5E).
[0048] 6. Effects of TCONS_00131158 on testicular interstitial cell proliferation and steroid production gene expression This invention investigated the effect of TCONS_00131158 on Leydig cell proliferation. EdU staining results showed that overexpression of TCONS_00131158 increased the number of proliferating cells, while knockdown reduced the number. Figure 6 A, 6C). Similarly, colony formation experiments showed that TCONS_00131158 overexpression enhanced colony formation ability, while interference reduced colony number (A, 6C). Figure 6 B, 6D). The CCK-8 assay further confirmed that cell viability was significantly enhanced in the overexpression group, while it was inhibited in the knockdown group (B, 6D). Figure 6 E, 6F). Furthermore, this invention examined the expression of key steroidogenic genes. qPCR analysis showed that the transcriptional levels of rate-limiting enzymes (STAR, CYP11A1) and key steroidogenic genes (CYP17A1, HSD17B) were significantly upregulated when TCONS_00131158 was overexpressed, and downregulated when it was knocked down. Figure 6GJ). Crucially, this transcriptional reprogramming of the steroid production mechanism perfectly matches the testosterone secretion pattern observed in subsequent analyses of this invention (see GJ). Figure 7 (EF), indicating that TCONS_00131158 drives steroid production by ensuring the potent expression of these catalytic enzymes.
[0049] 7. Effects of TCONS_00131158 on testicular interstitial cell apoptosis and testosterone secretion This invention further investigated the effect of TCONS_00131158 on cell survival. TUNEL staining and flow cytometry were used to analyze and detect cell apoptosis. The results showed that, compared with the negative control group, silencing TCONS_00131158 significantly increased the apoptosis index and apoptosis rate, while there was no significant difference between the overexpression group and the control group. Figure 7 AD). This invention detected testosterone levels in testicular interstitial cells. Results showed that overexpression of TCONS_00131158 significantly increased testosterone levels at 24, 48, and 72 hours, while knockout of TCONS led to a significant decrease in testosterone levels. Figure 7 E, 7F). These findings suggest that TCONS_00131158 is crucial for maintaining the survival of testicular interstitial cells and promoting testosterone production.
[0050] Effects of 8 miR-30c-3p on testicular interstitial cell proliferation and steroid production gene expression To clarify the functional role of miR-30c-3p, this invention used mimics and inhibitors to transfect Leydig cells; qRT-PCR was used to confirm the transfection efficiency ( Figure 8 G). EdU incorporation experiments showed that miR-30c-3p mimics significantly reduced the proportion of proliferating cells, while inhibitors significantly promoted proliferation (G). Figure 8 A, 8C). Consistent with this, colony formation experiments showed that the number of colonies formed in the simulant group was less than that in the negative control group, while the number formed in the inhibitor group was significantly higher. Figure 8 B, 8D). The CCK-8 assay further confirmed that miR-30c-3p mimics inhibited cell viability in a time-dependent manner, while the inhibitors promoted cell viability (B, 8D). Figure 8 E, 8F). Furthermore, this invention examined the expression of steroidogenic genes: qPCR results showed that the abundance of STAR, CYP11A1, CYP17A1, and HSD17B transcripts was significantly downregulated under the action of miR-30c-3p mimics, and upregulated after inhibition (E, 8F). Figure 8HK). This synergistic downregulation indicates that miR-30c-3p, as a potent repressor of the steroidogenic gene network, exhibits a functional effect diametrically opposed to TCONS_00131158 (as described in Section 3.6) by limiting the enzyme activity required for efficient testosterone biosynthesis.
[0051] Effects of 9 miR-30c-3p on apoptosis and testosterone secretion of testicular interstitial cells This invention further investigated the regulatory role of miR-30c-3p in cell survival and function. Apoptosis analysis by TUNEL staining and flow cytometry showed that, compared with the control group, transfection with miR-30c-3p mimics significantly increased the apoptosis index and rate. Figure 9 AD). Conversely, inhibition of miR-30c-3p led to a significant reduction in apoptosis. This invention assesses the functional output of Leydig cells by detecting testosterone levels. The results showed that miR-30c-3p mimics significantly inhibited testosterone secretion at 24, 48, and 72 hours, while the inhibitor group showed significantly elevated hormone levels (AD). Figure 9 E, 9F). These findings suggest that miR-30c-3p promotes Leydig cell apoptosis and impairs testosterone production.
[0052] 10 Effects of SERPINH1 on testicular interstitial cell proliferation and steroid production gene expression To elucidate the biological function of SERPINH1, this invention modulates its expression level in Leydig cells. qRT-PCR validation showed that overexpression vectors significantly increased SERPINH1 mRNA levels, while RNA interference significantly decreased its expression. Figure 10 G, 10H). Phenotypic assessments using EdU staining and colony formation assays showed that SERPINH1 overexpression enhanced cell proliferation, while its silencing inhibited proliferation (G, 10H). Figure 10 AD). The CCK-8 assay further confirmed these findings, showing that SERPINH1 promotes cell survival in a time-dependent manner (AD). Figure 10 E, 10F). This invention further analyzed its effects on steroid production-related genes. The expression levels of CYP17A1, CYP11A1, HSD17B, and STAR were upregulated after SERPINH1 overexpression and downregulated after knockdown (E, 10F). Figure 10These results demonstrate that SERPINH1 is crucial for maintaining high transcriptional abundance of steroid-producing enzymes, providing a clear mechanistic explanation for SERPINH1-dependent promotion of testosterone production. Notably, the functional profile of LncRNATCONS_00131158 is consistent with that of SERPINH1 but strictly opposite to that of miR-30c-3p, a phenomenon highly consistent with the proposed ceRNA regulatory mechanism.
[0053] 11 Effects of SERPINH1 on testicular interstitial cell apoptosis and testosterone secretion This invention further evaluated the effects of SERPINH1 on cell survival and functional secretion. TUNEL staining and flow cytometry analysis revealed that, compared to the negative control group, SERPINH1 overexpression reduced apoptosis, while silencing it significantly increased the apoptosis rate. Figure 11 AD). Regarding hormone secretion, ELISA analysis showed that SERPINH1 upregulation promoted testosterone secretion at 24, 48, and 72 hours; conversely, SERPINH1 knockout significantly impaired testosterone production. Figure 11 E, 11F). These results highlight the crucial role of SERPINH1 in maintaining mesenchymal cell survival and steroid production.
[0054] discuss Testicular development is a complex and highly coordinated biological process that directly determines male reproductive efficiency. This invention characterized the morphology and transcriptome of the testes of Qianbei Ma sheep and discovered a novel TCONS_00131158-miR-30c-3p-SERPINH1 axis regulating interstitial cell function. Histological and physiological data indicate that 0 to 6 months is the most critical window for testicular maturation, characterized by rapid dilation of seminiferous tubules, establishment of the spermatogenic lineage, and a sharp increase in serum testosterone levels. This observation coincides with the onset of puberty in goats, at which time somatic cell differentiation provides the necessary microenvironment for spermatogenesis. Consistent with these phenotypic changes, transcriptome analysis showed that the most dramatic gene expression reprogramming occurred during the transition from 0 to 6 months of age. Functional annotation of differentially expressed genes highlighted cell fate determination and extracellular matrix (ECM) organization, indicating that extensive tissue remodeling is a prerequisite for functional maturation.
[0055] Long non-coding RNAs (lncRNAs) are indispensable epigenetic regulators in the male reproductive system, and their importance is increasingly attracting attention from the scientific community. This invention, based on specific expression patterns at key developmental stages, identified TCONS_00131158 as a core regulatory factor. Functional experiments validated that TCONS_00131158 plays an irreplaceable role in Sertoli cell proliferation and testosterone secretion. From a molecular mechanism perspective, lncRNAs typically function as competitive endogenous RNAs (ceRNAs). This invention reveals that TCONS_00131158 can act as a molecular sponge for miR-30c-3p. Although the miR-30 family has been extensively studied in various biological contexts, the specific regulatory role of miR-30c-3p in testicular development remains largely unreported. Experimental data show that miR-30c-3p exerts a potent inhibitory effect in Supporting cells, inducing apoptosis and downregulating the expression of key steroid-producing enzymes (CYP17A1, CYP11A1, HSD17B, STAR). TCONS_00131158 can effectively reverse these effects, thereby protecting steroid production mechanisms from miRNA-mediated inhibition.
[0056] Furthermore, this invention validates that SERPINH1 is a direct target of miR-30c-3p. SERPINH1 is a collagen-specific molecular chaperone crucial for the maturation and secretion of procollagen, which plays a key role in maintaining the integrity of the extracellular matrix (ECM). This invention observes a significant positive correlation between SERPINH1 mRNA abundance, steroid-producing enzyme transcripts, and final testosterone production. Although post-transcriptional regulation can sometimes lead to decoupling of mRNA and protein levels, the upregulation of steroid-producing genes (STAR, CYPs) in this invention is highly consistent with the significant surge in testosterone production, providing strong evidence that TCONS_00131158-SERPINH1 axis-mediated transcriptional induction is functionally executed. This is consistent with previous findings that transcriptional regulation of STAR and CYP11A1 is a major determinant of acute steroidogenic responses. Mechanistically, as a collagen-specific chaperone protein, SERPINH1 may create a favorable cellular microenvironment for efficient cholesterol transport and enzymatic reactions required for hormone production by optimizing extracellular matrix (ECM) or cytoskeleton dynamics. Therefore, TCONS_00131158-mediated upregulation of SERPINH1 constitutes a potent prosteroidogenic mechanism.
[0057] In summary, based on direct binding evidence from dual-luciferase reporter gene assays and consistent functional phenotypes observed in LncRNA, miRNA, and mRNA regulation experiments, this invention proposes a model: TCONS_00131158 acts as a molecular sponge for miR-30c-3p, relieving inhibition of SERPINH1, thereby promoting mesenchymal cell survival and testosterone biosynthesis. These findings provide new insights into epigenetic regulation during goat puberty and suggest that TCONS_00131158 could serve as a potential candidate biomarker for assessing male reproductive potential in breeding programs.
[0058] As demonstrated by the above embodiments, this invention reveals the transcriptomic characteristics of testicular development in the Qianbei Ma sheep, identifying 0 to 6 months of age as the critical stage for sexual maturation. This invention confirms that the long non-coding RNA (lncRNA) TCONS_00131158 acts as a molecular sponge for miR-30c-3p, maintaining SERPINH1 levels, which is crucial for creating a favorable environment for interstitial cell survival and steroid production. Based on these data, the TCONS_00131158 / miR-30c-3p / SERPINH1 axis is identified as a decisive driver of testicular maturation, providing a solid theoretical basis for using this lncRNA as a genetic marker in ruminant breeding.
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Application of reagents for detecting the expression level of long non-coding RNA TCONS_00131158 in the preparation of kits for assessing the reproductive potential of male goats.
2. Application of TCONS_00131158 in the preparation of a kit for assessing the developmental status of goat testes.
3. A method for screening candidate substances that regulate goat testosterone synthesis, characterized in that, Includes the following steps: The candidate substance was brought into contact with testicular interstitial cells expressing TCONS_00131158; the expression level or activity of TCONS_00131158 was detected; if the candidate substance significantly upregulated the expression or activity of TCONS_00131158, it was determined to be a candidate substance that promotes testosterone synthesis. If it is significantly downregulated, it is considered a candidate substance for inhibiting testosterone synthesis.
4. A method for regulating testosterone synthesis in goat testicular interstitial cells, characterized in that, This includes regulating the biological activity of miR-30c-3p by modulating the expression level of TCONS_00131158.
5. Application of miR-30c-3p inhibitors in the preparation of drugs that promote the proliferation of goat testicular interstitial cells or testosterone synthesis.
6. A method for upregulating SERPINH1 expression, characterized in that, This includes overexpressing TCONS_00131158 or inhibiting miR-30c-3p.
7. Application of SERPINH1 as a target in screening candidate substances that promote goat testosterone synthesis.
8. The use of a composition in the preparation of a product that promotes the proliferation of goat testicular interstitial cells, characterized in that, The composition comprises any one of the following: a vector overexpressing TCONS_00131158; or a miR-30c-3p inhibitor; or a vector overexpressing SERPINH1.
9. Application of reagents for detecting at least two expression levels of TCONS_00131158, miR-30c-3p, and SERPINH1 in the preparation of kits for assessing goat reproductive potential.
10. A method for regulating apoptosis of goat testicular interstitial cells, characterized in that, The method includes regulating the expression levels of TCONS_00131158, miR-30c-3p, or SERPINH1.