A double-stranded RNA targeting long non-coding RNA and its application
By synthesizing targeted long non-coding double-stranded RNA, the problems of schistosome growth and development and female egg laying were solved, effective inhibition of Schistosoma japonicum and reduction of host pathological damage were achieved, and a new anti-schistosomal drug target was provided.
Patent Information
- Application Number
- CN202210896586.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-28
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2042-07-28
AI Technical Summary
The existing technology has insufficient research on the functions of long non-coding RNA in schistosomes and lacks effective anti-schistosomal drug targets, resulting in severe pathological damage to schistosomes, especially the host liver damage caused by female worms laying eggs, which is difficult to effectively control.
A targeted long non-coding double-stranded RNA (dsRNA) is designed and synthesized, the nucleotide sequence of its positive strand is shown in SEQ ID NO: 1, and is used to inhibit the growth and development of Schistosoma japonicum and the laying of eggs by female worms in vivo and in vitro, and to reduce pathological damage to the host liver. The drug forms include injections, oral preparations, etc.
It significantly inhibits the growth and development of Schistosoma japonicum and the egg-laying of female worms, reduces the number of worm eggs, and alleviates pathological damage to the host liver. Its effectiveness has been verified through animal experiments.
Smart Images

Figure CN116064516B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology and biomedicine technology, and in particular to a targeted long non-coding double-stranded RNA for inhibiting the growth and egg laying of schistosomes and applications thereof. Background Art
[0002] Schistosomiasis, a zoonotic parasitic disease caused by the schistosome Schistosoma japonicum, is recognized by the World Health Organization as the second most neglected tropical disease worldwide, after intestinal helminthiasis. Approximately 229 million people are infected worldwide. In my country, the main strain prevalent is Schistosoma japonicum, concentrated in the middle and lower reaches of the Yangtze River. The pathological damage and transmission of schistosomiasis are primarily caused by the large number of eggs produced by female worms after the male and female worms have embroiled and matured. Therefore, in-depth research on the reproductive development of Schistosoma japonicum can provide new insights into the development of vaccines and drugs against schistosomiasis.
[0003] At present, several teams, including the applicant, have conducted in-depth research on important protein-coding genes in the reproductive development of Schistosoma japonicum. However, there are fewer studies on various types of non-coding RNA (miRNA, lncRNAs, snoRNA, etc.) and their roles in the reproductive development of Schistosoma japonicum. In recent years, a large number of studies have shown that long non-coding RNA (lncRNAs) are major players in gene regulation and can play a key role in the development and reproduction of multiple species, involving the regulation of tissue and organ development, sex determination and gonadal development, sex hormone response, meiosis, gametogenesis and other important biological processes. Therefore, the applicant speculates that lncRNAs-mediated transcription and post-transcriptional regulation may play a key role in the process of Schistosoma japonicum from male and female embracing to reproductive maturity.
[0004] Due to a lack of technical means, functional studies of lncRNAs in schistosomes are relatively scarce. Currently, bioinformatics approaches are primarily used to identify potential lncRNAs that may regulate coding genes based on co-expression correlation networks. Kim et al. collected samples from the sporocyst stage of schistosomes and performed transcriptome sequencing, identifying 711 sporocyst-specific lncRNAs. They also constructed a lncRNA-mRNA co-expression network and identified hub lncRNAs with potential regulatory capabilities. Maciel et al. used a weighted gene co-expression network to analyze lncRNAs and mRNAs across all life cycles of Schistosoma mansoni and calculated a tissue-specific and stage-specific modular network. These results demonstrate that lncRNAs in schistosomes are expressed in a stage-specific manner and exhibit co-expression patterns, providing a reference for studying the regulatory functions of lncRNAs. Furthermore, excitingly, functional exploration of schistosome lncRNAs has also yielded some promising results. Silveira et al. knocked down the SmLINC156349 gene in Schistosoma mansoni in vitro using RNA interference, resulting in impaired adhesion, motility, and mating, a 20% reduction in viability, a 33% reduction in female egg production, and defects in egg development. These results demonstrate the enormous potential of characterizing lncRNAs as potential anti-schistosomal therapeutic targets and the importance of further studying the regulatory mechanisms of lncRNAs in schistosomes. Summary of the Invention
[0005] In response to the shortcomings of the existing technology, the present invention aims to provide a double-stranded RNA targeting long non-coding RNA, which can inhibit the growth and development of schistosomes, reduce the production of worm eggs, and effectively alleviate pathological damage to the host liver. It is also the first time to confirm that long non-coding RNA (Long non-coding RNA) can be used as a target for anti-schistosomal drugs.
[0006] To solve the above technical problems, the present invention provides a long non-coding double-stranded RNA targeting and its application, characterized in that the nucleotide sequence of the sense strand of the double-stranded RNA is as shown in SEQ ID NO: 1.
[0007] The present invention also provides the use of the double-stranded RNA in preparing anti-schistosoma drugs.
[0008] Specifically, the schistosoma is Schistosoma japonicum.
[0009] Specifically, the double-stranded RNA has an effect of inhibiting Schistosoma japonicum egg laying in vitro.
[0010] Specifically, the double-stranded RNA inhibits the growth and development of Schistosoma japonicum in vivo.
[0011] Specifically, the double-stranded RNA reduces the pathological damage of Schistosoma japonicum to the host liver in vivo.
[0012] Specifically, the dosage form of the drug is injection, oral preparation, buccal tablet, spray, suspension, capsule, tablet, pill or granule.
[0013] Specifically, the drug further includes one or more of a pharmaceutically acceptable carrier, diluent or excipient, and also includes a Schistosoma japonicum dsRNA NONSJP003385 solution prepared with physiological saline as a solvent.
[0014] The present invention provides a targeted long non-coding double-stranded RNA. Animal experiments have shown that the RNA has a good inhibitory effect on the developmental stage of schistosomes, can effectively inhibit the growth and development of the worms and the laying of eggs by female worms, and can reduce pathological damage to the host. It has great application value and prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] In order to more clearly illustrate the technical solution of the present invention, the following briefly introduces the drawings required for use in the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0016] Figure 1 The statistics of the number of eggs laid by Schistosoma japonicum by dsRNANONSJP003385 in vitro;
[0017] Figure 2 Schematic diagram of the statistical results of the recovery rate and worm length of Schistosoma japonicum after injection of dsRNA NONSJP003385 at the worm development stage after infection establishment;
[0018] Figure 3 To observe the development of female and male worms before and after interference under a stereomicroscope;
[0019] Figure 4 The development of the reproductive system of Schistosoma japonicum after injection of dsRNA NONSJP003385 at the developmental stage after infection is established;
[0020] Figure 5 HE staining and Masson staining of mouse liver after injection of dsRNA NONSJP003385 at the worm development stage after infection establishment. DETAILED DESCRIPTION
[0021] The following is a clear and complete description of the technical solutions of the present invention in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0022] Example 1. Preparation of double-stranded RNA
[0023] 1. Amplification of target gene
[0024] (1) Amplification of target gene NONSJP003385
[0025] Primers were designed based on the sequence of non-coding RNA NONSJP003385 in the Schistosoma japonicum long non-coding RNA annotation library (note: unpublished data). The amplification length was 458 bp. A T7 promoter sequence was added to the 5' end of the primer. The primer sequence (5'-3') is as follows:
[0026] F:TAATACGACTCACTATAGGGAGATAGATTATGGCAGCTACTTG; (SEQ ID NO: 3)
[0027] R:TAATACGACTCACTATAGGGAGAACCTTGTGGAGCCTAGAA; (SEQ ID NO: 4)
[0028] The PCR amplification program was as follows: 94°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 10 min; and 4°C for a final cycle. cDNA from the target band was recovered by gel excision and verified by sequencing.
[0029] The nucleotide sequence of the amplified fragment of the NONSJP003385 gene is shown in SEQ ID NO:5.
[0030] (2) Amplification of the control gene GFP
[0031] Primers were designed based on the sequence of a laboratory-constructed GFP (Green fluorescent protein) vector plasmid. The amplified length was 451 bp. A T7 promoter sequence was added to the 5' end of the primer. The primer sequences (5'-3') are as follows: F: TAATACGACTCACTATAGGGAGAAGTCAGTGGAGAGGGTGAAG; (SEQ ID NO: 6) R: TAATACGACTCACTATAGGGAGAACTAGTTGAACGGATCCATC; (SEQ ID NO: 7)
[0032] The PCR amplification program was as follows: 94°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 10 min; and 4°C for a final cycle. cDNA from the target band was recovered by gel excision and verified by sequencing.
[0033] The nucleotide sequence of the amplified GFP gene fragment is shown in SEQ ID NO:8.
[0034] 2. Synthesis and purification of dsRNA
[0035] (1) Synthesis of dsRNA of the above two genes using the High Yield Transcription Kit. The in vitro transcription system is as follows:
[0036] Element Addition amount 10 x T7 reaction buffer 2μL T7 enzyme mix 2μL ATP 2μL UTP 2μL GTP 2μL CTP 2μL cDNA 0.5 μg Nuclease-free water Fill to 20 μL
[0037] Two sets of dsRNA synthesis systems were prepared using the two DNA templates mentioned above, respectively. The above system mixtures were shaken and mixed, and incubated in a 37°C water bath overnight.
[0038] (2) Purification step
[0039] as follows:
[0040] 1) Transfer the overnight product from a 37°C water bath to a 75°C water bath for 5 minutes to terminate the reaction;
[0041] 2) Add 1 μL of TURBO DNase, mix thoroughly by pipetting, and incubate in a 37°C water bath for 15 min.
[0042] 3) Add 115 μL of nuclease-free water and 15 μL of NH4Ac and mix thoroughly by pipetting with a pipette;
[0043] 4) Add 150 μL of isopropanol, shake to mix, centrifuge briefly, and precipitate at -20°C for 1 h;
[0044] 5) Centrifuge at 13,000 rpm, 4°C for 15 min;
[0045] 6) Discard the supernatant and add 700 μL of 75% ethanol to wash the pellet. Centrifuge at 12,000 rpm at 4°C for 5 min. Aspirate as much ethanol as possible with a pipette tip. Leave the tube uncovered at room temperature for 15 min to allow the ethanol to evaporate completely.
[0046] 7) Add 30 μL of nuclease-free water to dissolve the dsRNA, shake to mix, centrifuge briefly, and denature in a 65°C water bath for 15 min.
[0047] 8) Measure dsRNA concentration using Nano Drop 2000;
[0048] 9) The products were verified by RNA electrophoresis. The two dsRNAs were named dsRNA NONSJP003385 and dsRNA GFP, respectively, and stored at -20°C.
[0049] 10) The nucleotide sequence of the sense strand of the synthesized dsRNA NONSJP003385 is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 2.
[0050] 11) The nucleotide sequence of the sense strand of the synthesized dsGFP is shown in SEQ ID NO: 9, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 10.
[0051] Example 2: Double-stranded RNA interference experiment
[0052] 1. Double-stranded RNA interference in vitro
[0053] Six-week-old Kunming mice were transcutaneously infected with 200 cercariae per mouse and then housed in a suitable environment. On day 30 post-infection, mice were dissected and Schistosoma japonicum was collected by portal vein perfusion. The mice were then cultured in 24-well plates and divided into control and experimental groups, with six wells per group and six pairs of Schistosoma japonicum per well. The culture medium was changed every two days. The control medium was supplemented with dsRNA (GFP) fragments of GFP, while the experimental medium was supplemented with dsRNA NONSJP003385 at a concentration of 10 μg / mL. After seven days of culture, three Schistosoma japonicum wells in each group were randomly sampled for RNA extraction and qPCR to verify target gene knockdown. Any remaining eggs in the remaining three wells were removed, and fresh culture medium was replaced without dsRNA NONSJP003385. Culture was continued for three days for subsequent egg counts (see [1]). Figure 1 ), the method for calculating eggs is the number of eggs / number of male and female pairs.
[0054] 2. Double-stranded RNA interference in vivo during the developmental stage of the parasite after infection is established
[0055] Six-week-old Kunming mice were infected with 60 cercariae per mouse through the abdominal skin and divided into a control group and an experimental group, with four mice in each group. At 14, 18, 22, 26, 30, and 34 dpi, 10 μg of dsRNA NONSJP003385 was injected via the tail vein of each mouse in saline (200 μL). The control group was injected with dsRNA GFP (Green Fluorescent Protein), while the experimental group was injected with dsRNA NONSJP003385. On day 38 post-infection, the mice were dissected and perfused through the portal vein to collect Schistosoma japonicum from each mouse for phenotypic observation. The livers of the mice were collected to observe the presence of worm eggs and liver fibrosis (see [1]). Figure 2 ).
[0056] 3. Effects of interference experiments
[0057] (1) Evaluation criteria
[0058] 1) Insect count and insect length measurement
[0059] The number of all male and female worms flushed out of each mouse by portal vein perfusion was counted. After removing the female and male worms used for total RNA extraction, the remaining worms were anesthetized and fixed in 1 mL of AFA fixative at room temperature for 24 h. The worms were then photographed and their lengths were measured using Image J software.
[0060] The statistical method for the number of embracing pairs and the number of non-embracing males and females is as follows:
[0061] Total number of insects = number of embracing pairs × 2 + number of unembraced males + number of unembraced females
[0062] Embracing rate = number of pairs of embracing insects / (number of pairs of embracing insects + minimum number of unembraced male and female insects)
[0063] 2) Alum carmine staining
[0064] Alum-carmine staining of AFA-fixed worms was performed to observe the development of the gonads of both male and female worms. Samples stained with alum-carmine staining can also be used for observation under a laser confocal microscope, using an emission wavelength of 488 nm, which is the excitation wavelength for carmine.
[0065] 3) Paraffin-embedded liver tissue sections
[0066] ① Obtain fresh liver tissue from the same part of the mouse and fix it in 4% paraformaldehyde for at least 24 hours. Remove the tissue from the fixative, trim it, and then place it in a dehydration box;
[0067] ② Dehydration is carried out in sequence in the dehydrator;
[0068] ③Embed the wax-soaked tissue in an embedding machine;
[0069] ④ Use a paraffin microtome to slice the wax block to approximately 4 μm thickness. Flatten the tissue over 40°C water, then place it on a glass slide and place it in a 60°C oven. Once the water is dried and the wax is melted, remove the slide and store it at room temperature. Perform hematoxylin and eosin (HE) and Masson staining.
[0070] (2) Double-stranded RNA interference effect in vitro
[0071] Mature male and female worms were cultured in vitro, and dsRNA NONSJP003385 was designed to interfere with the expression of the target gene NONSJP003385 in vitro. After 7 days of interference, the difference in the number of eggs laid by the experimental and control groups was observed, and the worms were collected to extract RNA for qPCR detection of changes in gene expression. The results showed that compared with the control group, the expression of the target gene NONSJP003385 in both female and male worms in the experimental group was significantly decreased (e.g., Figure 1 A, P-value < 0.05), and the average number of eggs laid by each pair of adults in the experimental group was also significantly reduced (e.g. Figure 1 B, P-value < 0.05). These results indicate that dsRNA interference significantly knocked down the expression of non-coding RNA NONSJP003385 in Schistosoma japonicum, and that interference with this gene may play an important role in the egg-laying process of Schistosoma japonicum.
[0072] (3) Double-stranded RNA interference effect in vivo
[0073] 1) Inhibit the growth and development of schistosoma japonicum
[0074] Starting from the 14th day after infection, the NONSJP003385 gene of Schistosoma japonicum in mice was interfered with, and the worms were collected on the 38th day after infection. The length and number of male and female worms were statistically analyzed and found that compared with the GFP control group, the length of male and female worms after NONSJP003385 gene interference was significantly shortened (P-value < 0.05), and the worm load of male worms was also reduced (e.g. Figure 2 A, B), similar results were observed under stereomicroscope (such as Figure 3 A, B). This indicates that interference with the NONSJP003385 gene can affect the growth and development of both male and female Schistosoma japonicum worms, while also having a certain worm-reducing effect on male worms.
[0075] In addition, the two groups of insects were stained with alum carmine to observe the differences in the reproductive systems of male and female insects before and after interference. Observation results under fluorescence microscopy and laser confocal microscopy showed that compared with the control group, the testicles of male insects with NONSJP003385 gene knockdown were smaller, the ovaries of female insects were smaller, and a large number of immature oocytes were present. The yolk gland was morphologically atrophied, and the yolk gland cells were arranged in a disordered manner (such as Figure 4 A, B). These results indicate that NONSJP003385 plays an important role in the normal development of the reproductive systems of male and female insects.
[0076] 2) Reduce pathological damage to the host liver
[0077] Liver samples from the control and experimental groups were collected, sliced, and then stained with HE and Masson's staining to observe the deposition of worm eggs in the liver and the granuloma fibrosis. HE staining results showed that compared with the GFP control group, the amount of worm eggs in the NONSJP003385 group was reduced, the accumulation of worm eggs was alleviated, the number of granulomas was significantly reduced, and the size of granulomas was reduced. Masson's staining results showed that after NONSJP003385 interference, the liver fibrosis of mice was significantly alleviated, and the degree of inflammatory cell infiltration and the range of fibrous tissue proliferation were significantly lower than those in the control group (such as Figure 5 These results indicate that interference with the NONSJP003385 gene affects the female insect's egg-laying process, reduces the number of eggs laid, and effectively alleviates liver pathological damage in the host.
[0078] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A double-stranded RNA targeting long non-coding RNA, characterized in that The nucleotide sequence of the sense strand of the double-stranded RNA is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of the double-stranded RNA is shown in SEQ ID NO:
2.
2. Use of the double-stranded RNA according to claim 1 in the preparation of anti-schistosomal drugs.
3. The use according to claim 2, characterized in that: The schistosoma is Schistosoma japonicum.
4. The use according to claim 3, characterized in that: The double-stranded RNA is used in inhibiting Schistosoma japonicum egg laying in vitro.
5. The use according to claim 3, characterized in that: The double-stranded RNA is used in inhibiting the growth and development of Schistosoma japonicum in vivo.
6. The use according to claim 3, characterized in that: The double-stranded RNA is used in vivo to reduce the pathological damage of Schistosoma japonicum to the host liver.
7. The use according to claim 2, characterized in that: The dosage form of the medicine is injection.
8. The use according to claim 2, characterized in that: The drug further comprises one or more pharmaceutically acceptable carriers, diluents or excipients.
Citation Information
Patent Citations
Image expander
JP1988003385A
siRNA of schistosoma japonicum SjELAV-like 2 genes and application thereof
CN108795934A
SiRNA of schistosoma japonicum katsurada SjGST gene and application of siRNA
CN111705057A