745results about "Screening process" patented technology

The specification provides methods for introducing a desired genetic change in a nucleotide sequence using a double-strand break (DSB)-inducing genome editing system, the method comprising: identifying one or more available cut sites in a nucleotide sequence; analyzing the nucleotide sequence and available cut sites with a computational model to identify the optimal cut site for introducing the desired genetic change into the nucleotide sequence; and contacting the nucleotide sequence with a DSB-inducing genome editing system, thereby introducing the desired genetic change in the nucleotide sequence at the cut site.

The invention discloses a method for detecting a diallele editing cell based on a CRISPR / Cas12a technology. The invention provides crRNA, and the nucleotide sequence of a binding target of the crRNA is SEQ ID NO.6. The crRNA is obtained by in-vitro transcription of a transcription template; the transcription template is a product obtained by annealing a single-stranded DNA (Deoxyribose Nucleic Acid) molecule as shown in SEQ ID NO.10 and a single-stranded DNA molecule as shown in SEQ ID NO.13. The invention provides crRNA of the CD71 gene, a CRISPR / Cas12a system is constructed by using the crRNA, CRISPR / Cas12a detection is performed, screening of CRISPR / Cas9 induced CD71 gene diallele editing cells is realized, and the method is simple, convenient, quick and convenient for economically and effectively screening a large number of mutant cells.

The present disclosure provides compositions for targeting trans-splicing of an mRNA precursor in a cell and methods of using the same.

Compositions and methods useful to reduce expression of INHBE gene and for treatment of INHBE-associated diseases and conditions are provided. Provided are INHBE dsRNA agents, INHBE antisense polynucleotide agents, compositions comprising INHBE dsRNA agents, and compositions comprising INHBE antisense polynucleotide agents that can be used to reduce INHBE expression in cells and subjects.

Compositions comprising aptamers capable of specifically binding to a surface protein of Clostridium difficile spore are provided. A method for detecting, enriching, separating, and / or isolating Clostridium difficile spores is provided.

The present disclosure provides engineered immune cells modified to overexpress tumor sensing enhancer proteins, thereby providing the engineered immune cells with an enhanced ability to migrate to and / or infiltrate tumors. In some examples, the tumor sensing enhancer proteins are tumor sensing receptors that specifically bind to non-chemokine receptors. The disclosure also provides methods including the provided engineered immune cells.

Embodiments disclosed herein provide methods, including computer-implemented methods, for designing guide sequence which may be incorporated into custom, large scale guide sequence libraries. The methods require only a list of target genes as input and utilize on target and off target scores to generate an optimal set of guide sequences for a set of target genes. In certain embodiments, the methods may also utilize multi-tissue RNA-sequencing data and / or protein annotation to design targets to genes that are highly expressed and / or contain a functional protein domain. The invention further comprises guide libraries, cells comprising said guide libraries. Computer-implemented embodiments further improve computer system function by reducing excessive user wait time through the use of data structures that reduce search from linear to logarithmic time.

Compositions and methods useful to reduce expression of synuclein alpha (SNCA) gene and for treatment of SNCA-associated diseases and conditions are provided. Provided are SNCA dsRNA agents, compositions or cells comprising SNCA dsRNA agents, that can be used to reduce SNCA expression in cells and subjects.

The present disclosure provides a modified oligonucleotide sequence and its application. A series of siRNAs are designed based on the angiotensinogen (AGT) messenger ribonucleic acid (mRNA) sequence, and are alternately modified and modified using a specific set of modification templates. The results of cell and animal experiments show that some alternately modified and specifically template-modified oligonucleotide sequences can significantly inhibit the expression of the AGT gene, and can be used for developing drugs for treating related diseases such as hypertension.

The present invention relates to methods and compositions for editing a polynucleotide, e.g., a polynucleotide comprising a SNP associated with a disease or disorder.

Methods and compositions for digital profiling of nucleic acid sequences present in a sample are provided.

The present invention relates to compositions, methods, strategies, and treatment approaches related to epigenetic modification of Hepatitis B virus (HBV) genes.

A genetic prime editing screening platform to identify functional variants related to human health and disease, is configured substantially to annotate genome with nucleotide resolution with actionable disease prediction and treatment for personalized medicine.

A gene-leader editing screening platform for identifying functional variations associated with human health and disease, substantially configured to annotate genomes with nucleotide resolutions, accompanied by operable disease prediction and treatment for personalized medical treatment.

The present invention relates to an oligonucleotide comprising from 10 to 25 nucleotides wherein at least one of said nucleotides is modified, and the oligonucleotide hybridizes with the pre-mRNA of the neurociliin 1 (NRP1, CD304) of SEQ ID NO. 366 (GRCh38p13Chr 1033177492-33336262-1) or with the mRNA of the NRP1 of SEQ ID NO. 367 (RefSeq ID NM003873.6). The invention also relates to a pharmaceutical composition comprising the oligonucleotide. The pharmaceutical composition and the oligonucleotide are for use in a method of preventing and / or treating cancer, ophthalmic disease, autoimmune disorder and / or immune disorder.

To provide antisense oligonucleotide sequences and methods of using the same for treating neurological diseases.SOLUTION: Provided is an oligonucleotide comprising linked nucleosides having a sequence of at least 19 contiguous nucleobases, wherein the sequence of nucleobases comprises a portion of at least 10 contiguous nucleobases that is at least 90% complementary to an equal length portion of nucleobases contained at a specified position of a specified sequence.SELECTED DRAWING: Figure 1A

The present disclosure provides compositions and methods related to multiparatopic aptamers. In particular, the present disclosure provides nucleic acid aptamers capable of binding multiple distinct epitopes on a target biomolecule, as well as corresponding methods of generating and characterizing the multiparatopic aptamers.

Disclosed is a method for preparing T cells for adoptive T cell therapy by contacting a population of activated T cells with an AT-rich interaction domain 1A (Aridla) inhibitor. Also disclosed is a kit, a population of T cells or engineered T cells produced by the method and use of the same in adoptive T cell therapy and the treatment of cancer.

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

Cas-protein-ready tau biosensor cells, CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells, and methods of making and using such cells to screen for genetic modifiers of tau seeding or aggregation are provided. Reagents and methods for sensitizing such cells to tau seeding activity or tau aggregation or for causing tau aggregation are also provided.

The present disclosure relates to an isolated Cas13 protein and use thereof. The amino acid sequence of the isolated Cas13 protein comprises a sequence having ≥ 50% sequence identity with the sequence as shown in any one of SEQ ID NO: 1-SEQ ID NO: 7, and SEQ ID NO: 60. The Cas13 protein is a Cas13 enzyme with an endonuclease activity, which can be used in a CRISPR / Cas system to achieve targeting and modification of a target nucleic acid, enriching the enzymes and systems available in a CRISPR-Cas editing system.

Provided are oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of IFNAR1 RNA in a cell or an animal, and in certain instances, reducing the amount of IFNAR1 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful to treat diseases and conditions associated with neuroinflammation, including Aicardi-Goutieres Syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation following traumatic brain injury, neuro-autoimmune disorders, Alzheimer's disease, post-operative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and ataxia telangiectasia.

Aspects of the present disclosure relate to compositions and methods useful for treating Huntington's disease. In some embodiments, the present disclosure provides interfering nucleic acids (e.g., artificial miRNAs) that target the huntingtin gene (HTT) and methods of using the same to treat Huntington's disease. Accordingly, in some aspects, the present disclosure provides isolated nucleic acids comprising or encoding a sequence set forth in any one of SEQ ID NOs: 1-22. In one aspect, described herein is an isolated nucleic acid comprising: (a) a first region comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof; and (b) a second region comprising a transgene encoding one or more miRNAs, wherein each miRNA comprises a seed sequence complementary to SEQ ID NO: 25.

The present disclosure provides single- or double-stranded interfering RNA molecules (e.g., siRNA) that target a MutS Homolog 3 (MSH3) gene. The interfering RNA molecules may contain specific patterns of nucleoside modifications and internucleoside linkage modifications, as pharmaceutical compositions including the same. The siRNA molecules may be branched siRNA molecules, such as di-branched, tri-branched, or tetra-branched siRNA molecules. The disclosed siRNA molecules may further feature a 5′ phosphorus stabilizing moiety and / or a hydrophobic moiety. Additionally, the disclosure provides methods for delivering the siRNA molecule of the disclosure to the central nervous system of a subject, such as a subject identified as having Huntington's Disease.

This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human FXI mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating FXI gene expression and treating or preventing a disease or disorder associated with aberrant or increased expression or activity of FXI or a disease or disorder where FXI plays a role.

The present disclosure provides methods and compositions for treating tauopathies, such as Alzheimer's disease or FTDP-17. The methods and compositions of the present disclosure include isolated nucleic acid molecules, rAAV vectors, and rAAV viral vectors that include polynucleotide sequences encoding artificial microRNAs (amiRNAs) that target MAPT.

The invention relates to the technical field of biological medicines, in particular to a preparation method of an inhibitor targeting a MAX-PD-L1 promoter specific binding motif and a double-target inhibitor, through ChIP-seq and site-directed mutagenesis experiments, a core binding motif of MAX and a PD-L1 promoter, such as 5 '-CAC [GA] TG-3', is defined, it is ensured that the inhibitor only targets a key site of MAX-PD-L1 interaction, and the activity of the MAX-PD-L1 promoter specific binding motif is improved. The off-target effect is avoided, and a high-specificity target spot is provided for subsequent inhibitor design. The cell permeability of the DNA aptamer screened based on the specific binding motif is improved after cholesterol modification, and the affinity of the DNA aptamer is obviously higher than that of a traditional antibody. A small molecule compound virtually screened through a molecular docking model is optimized through hydrogen bond and hydrophobic interaction, and then the binding affinity with MAX is improved. After treatment with the inhibitor, the combination inhibition rate of MAX and the PD-L1 promoter is high, the transcriptional activity of PD-L1 is obviously reduced, the killing rate of T cells to tumor cells is also improved, and immune escape is effectively blocked.

Provided are chitosan-RNA particles comprising low molecular weight chitosan and ssRNA or dsRNA, as well as compositions and cultured aquatic animals comprising the chitosan-RNA particles, and methods of use thereof in the treatment or prevention of microsporidia infection in aquaculture, the ssRNA or dsRNA is partially complementary, bound, or at least 90% identical to the mRNA target of a pathogenic microsporidium parasite in cultured fish or crustacean.