383results about "Screening process" patented technology

Embodiments disclosed herein provide methods, including computer-implemented methods, for designing guide sequence which may be incorporated into custom, large scale guide sequence libraries. The methods require only a list of target genes as input and utilize on target and off target scores to generate an optimal set of guide sequences for a set of target genes. In certain embodiments, the methods may also utilize multi-tissue RNA-sequencing data and / or protein annotation to design targets to genes that are highly expressed and / or contain a functional protein domain. The invention further comprises guide libraries, cells comprising said guide libraries. Computer-implemented embodiments further improve computer system function by reducing excessive user wait time through the use of data structures that reduce search from linear to logarithmic time.

The present disclosure provides a modified oligonucleotide sequence and its application. A series of siRNAs are designed based on the angiotensinogen (AGT) messenger ribonucleic acid (mRNA) sequence, and are alternately modified and modified using a specific set of modification templates. The results of cell and animal experiments show that some alternately modified and specifically template-modified oligonucleotide sequences can significantly inhibit the expression of the AGT gene, and can be used for developing drugs for treating related diseases such as hypertension.

The present invention relates to methods and compositions for editing a polynucleotide, e.g., a polynucleotide comprising a SNP associated with a disease or disorder.

A genetic prime editing screening platform to identify functional variants related to human health and disease, is configured substantially to annotate genome with nucleotide resolution with actionable disease prediction and treatment for personalized medicine.

The present invention relates to an oligonucleotide comprising from 10 to 25 nucleotides wherein at least one of said nucleotides is modified, and the oligonucleotide hybridizes with the pre-mRNA of the neurociliin 1 (NRP1, CD304) of SEQ ID NO. 366 (GRCh38p13Chr 1033177492-33336262-1) or with the mRNA of the NRP1 of SEQ ID NO. 367 (RefSeq ID NM003873.6). The invention also relates to a pharmaceutical composition comprising the oligonucleotide. The pharmaceutical composition and the oligonucleotide are for use in a method of preventing and / or treating cancer, ophthalmic disease, autoimmune disorder and / or immune disorder.

To provide antisense oligonucleotide sequences and methods of using the same for treating neurological diseases.SOLUTION: Provided is an oligonucleotide comprising linked nucleosides having a sequence of at least 19 contiguous nucleobases, wherein the sequence of nucleobases comprises a portion of at least 10 contiguous nucleobases that is at least 90% complementary to an equal length portion of nucleobases contained at a specified position of a specified sequence.SELECTED DRAWING: Figure 1A

Disclosed is an aptamer for binding Aspergillus niger conidia having a sequence selected from the group consisting of tcccagcgcccggagaacacgaggaacgcacctatcacac (SEQ ID NO: 1), caccaccacgacacacaaccttcccgtgcggacccagcga (SEQ ID NO: 2), ccgacatctttgtactagtacgcctccacgaaaacacact (SEQ ID NO: 3), cctgagtaactgctcgtactagttcgcctcctcgaattac (SEQ ID NO: 4), acttcgcagtctgactagtacgcctccacgaagggtttct (SEQ ID NO: 5), and ccggatgctctaccgtactagtacgactccacgaaattat (SEQ ID NO: 6). Also disclosed is the use of this aptamer for detecting Aspergillus niger.

Cas-protein-ready tau biosensor cells, CRISPR / Cas synergistic activation mediator (SAM)-ready tau biosensor cells, and methods of making and using such cells to screen for genetic modifiers of tau seeding or aggregation are provided. Reagents and methods for sensitizing such cells to tau seeding activity or tau aggregation or for causing tau aggregation are also provided.

The present disclosure relates to an isolated Cas13 protein and use thereof. The amino acid sequence of the isolated Cas13 protein comprises a sequence having ≥ 50% sequence identity with the sequence as shown in any one of SEQ ID NO: 1-SEQ ID NO: 7, and SEQ ID NO: 60. The Cas13 protein is a Cas13 enzyme with an endonuclease activity, which can be used in a CRISPR / Cas system to achieve targeting and modification of a target nucleic acid, enriching the enzymes and systems available in a CRISPR-Cas editing system.

This disclosure relates to isolated oligonucleotides comprising duplex regions targeting human FXI mRNA, and delivery systems, kits and compositions comprising the same, and methods of using the same for inhibiting or downregulating FXI gene expression and treating or preventing a disease or disorder associated with aberrant or increased expression or activity of FXI or a disease or disorder where FXI plays a role.

The invention relates to the technical field of biological medicines, in particular to a preparation method of an inhibitor targeting a MAX-PD-L1 promoter specific binding motif and a double-target inhibitor, through ChIP-seq and site-directed mutagenesis experiments, a core binding motif of MAX and a PD-L1 promoter, such as 5 '-CAC [GA] TG-3', is defined, it is ensured that the inhibitor only targets a key site of MAX-PD-L1 interaction, and the activity of the MAX-PD-L1 promoter specific binding motif is improved. The off-target effect is avoided, and a high-specificity target spot is provided for subsequent inhibitor design. The cell permeability of the DNA aptamer screened based on the specific binding motif is improved after cholesterol modification, and the affinity of the DNA aptamer is obviously higher than that of a traditional antibody. A small molecule compound virtually screened through a molecular docking model is optimized through hydrogen bond and hydrophobic interaction, and then the binding affinity with MAX is improved. After treatment with the inhibitor, the combination inhibition rate of MAX and the PD-L1 promoter is high, the transcriptional activity of PD-L1 is obviously reduced, the killing rate of T cells to tumor cells is also improved, and immune escape is effectively blocked.

Systems and methods for highly-effective CRISPR-Cas based genomic editing within human chromosome 15q11-q13 have been developed as therapeutic interventions for Angelman Syndrome (AS). Selective single guide RNA molecules (sgRNAs) that impart enhanced CRISPR-Cas editing of genomic mutations associated with Angelman Syndrome in human cells are described. The engineered sgRNAs induce activity of non-pathogenic, paternal UBE3A alleles to reduce, reverse and / or prevent the causative neurodevelopmental defects of AS in a subject in need thereof. Compositions and methods of engineered crRNAs, sgRNAs thereof and ribonucleoprotein (RNP) complexes thereof are provided for enhanced genomic engineering with increased on-off target specificity and on-target editing efficacy for treatment of AS.

The present application provides methods and compositions for treating certain neurodegenerative diseases (e.g., RGC loss-associated degenerative diseases and Parkinson's disease) using CRISPR / Cas delivered via a viral vector (e.g., AAV vector) to convert glial cells into neurons in vivo by knocking down PTB and any nPTB.

Provided herein are compositions and methods of modulating myeloid cell-mediated killing of cancer cells and modulating the activity of myeloid cell immune checkpoint inhibitors. Also provided herein are methods of screening for modulators of myeloid cell-mediated killing of cancer cells and modulators of myeloid cell immune checkpoint inhibitors.

Disclosed are methods of identifying a regulatory factor that regulates the abundance of a target RNA comprising introducing to a population of cells a plurality of single guide RNAs (sgRNAs), wherein the sgRNAs are specific for one or more nucleic acid sequences capable of encoding the regulatory factor in the population of cells; performing fluorescent in situ hybridization (FISH) on the population cells, using a probe specific to a target RNA in the population of cells; identifying cells in the population of cells that have altered abundance of the target RNA; sequencing DNA from the population of cells that have altered abundance of the target RNA; and identifying, based on the sequencing, sgRNAs that are specific to a nucleic acid sequence capable of encoding the regulatory factor that regulates abundance of the target RNA; thereby identifying a regulatory factor that regulates abundance of the target RNA.

Provided is an accurate guide RNA (gRNA) screening method for base editing of an asialoglycoprotein receptor 1 (ASGR1) gene, including the following steps: (1) gRNA design; (2) primer design; (3) in vitro transcription of gRNA; (4) cell transfection; (5) collection of cells, and extraction and polymerase chain reaction (PCR) of a genome; and (6) Sanger sequencing.

Disclosed herein are compositions comprising an oligonucleotide that inhibits the expression of MST1. The oligonucleotide includes a small interfering RNA (siRNA), as well as these compositions for use in methods of treating lung disorders

The present disclosure provides a modified oligonucleotide sequence and use thereof. A series of siRNAs were designed based on the angiotensinogen (AGT) messenger ribonucleic acid (mRNA) sequence, which were alternately modified or modified using a specific set of modification templates. The results from cell and animal experiments demonstrated that some oligonucleotide sequences with alternating modifications and specific template modifications can significantly inhibit AGT gene expression and may be used for the development of medicaments for treating hypertension and other related diseases.

The present disclosure relates to RNAi constructs, such as siRNA, for reducing the expression of the SCAP gene. Methods of using such RNAi constructs for treating or preventing liver diseases such as non-alcoholic fatty liver disease (NAFLD) are also described. In certain embodiments, the RNAi construct comprises a region having at least 15 contiguous nucleotides that differ from the antisense sequences listed in Table 1 by 3 nucleotides or less.

The present disclosure relates to polypeptides, such as fibronectin type III (FN3) domains that can bind CD71, their conjugates, isolated nucleotides encoding the molecules, vectors, host-cells, as well as methods of making and using the same.

Disclosed herein are siRNA duplexes, pharmaceutical compositions, and methods for suppressing the expression of proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9).

The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, able to inhibit xanthine dehydrogenase (XDH) gene expression. Also disclosed are pharmaceutical compositions that include XDH RNAi agents and methods of use thereof. The XDH RNAi agents disclosed herein may be conjugated to targeting ligands to facilitate the delivery to cells, including to hepatocytes. Delivery of the XDH RNAi agents in vivo provides for inhibition of XDH gene expression. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms mediated in part by XDH gene expression, such as gout and hyperuricemia.

The present disclosure relates to oligonucleotides, compositions, and methods useful for reducing GYS2 expression, particularly in hepatocytes. The disclosed oligonucleotides for reducing GYS2 expression can be double-stranded or single-stranded, and can be modified to improve properties such as stronger resistance to nucleases and lower immunogenicity. The disclosed oligonucleotides for reducing GYS2 expression can also include targeting ligands to target specific cells or organs, such as hepatocytes of the liver, and can be useful for treating glycogen storage diseases (e.g., GSDIa, GSDIII, GSDIV, GSDVI, and GSDIX) and related conditions.

An object of the present invention is to provide a double-stranded RNA that is useful as a novel anti-hepatitis B virus agent, and a pharmaceutical composition containing the above-described double-stranded RNA. According to the present invention, there is provided a double-stranded RNA that inhibits the production of a hepatitis B virus protein and that inhibits the expression of YTHDC1.

Compositions and methods for aptamer-mediated delivery of therapeutic agents. RNA aptamers identified via SELEX specifically bind and are internalized by cardiomyocytes or cardiac fibroblasts, delivering antisense oligonucleotides or other therapeutics intracellularly. This strategy offers a non-viral, targeted approach for treating cardiac diseases and may be extended to other tissues or therapeutic modalities.

The present invention relates to the field of treating inherited retinal disease (IRD). More specifically, the present invention discloses a target region which is useful to screen for compounds capable of treating inherited retinal disease and discloses specific antisense oligonucleotides (ASOs) useful to treat the latter disease. The present invention is based on the finding that the variant c.-123>T in the 5'UTR of the RDH12 gene causes an upstream start codon (uATG) resulting in insufficient RDH12 protein production and hence causes inherited retinal disease. ASOs which hybridize with a region surrounding or containing said uATG provide steric hindrance for recognition of the upstream start codon, thus redirecting the scanning ribosomes to the primary start codon which results in increased RDH12 protein production.

Compositions, methods, and systems for selecting polynucleotides for their activity as neuron-specific transcription factors are disclosed herein. [Solution] The system of the present invention may include a library of polynucleotides encoding reporter proteins and panneuronal markers, Gas proteins, and guide RNAs (gRNAs) that target putative transcription factors. A method for screening neuron-specific transcription factors is further provided.

The present disclosure relates to oligonucleotide aptamers that bind to certain small molecules including thiamine analogs and derivatives and methods of generating aptamers that bind to the small molecules. Also contemplated are riboswitches and polynucleotide cassettes comprising the aptamers disclosed herein. Further provided are methods of using said aptamers, riboswitches, and / or polynucleotide for the regulation of target genes, including therapeutic genes. Also provided herein are small molecules that are modulators of target gene expression where the target gene contains a riboswitch comprising an aptamer described herein.