An antibiotic peptide and its coded sequence and use
A coding sequence and antimicrobial peptide technology, applied in the direction of antibacterial drugs, peptide sources, applications, etc., can solve the problems of fish quality and taste decline, environmental pollution, and affect the quality of aquatic products
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0024] Example 1: Acquisition of cDNA of antimicrobial peptides of grouper
[0025] The inventors used the SMART cDNA library construction kit from Clontech Company to construct the cDNA library of grouper white blood cells, randomly selected clones for sequencing, and compared the measured sequence with the Genbank sequence using the BLAST program to obtain the cDNA of the antimicrobial peptide .
[0026] 1. Extraction of total RNA from leukocytes of grouper
[0027] Healthy grouper (about 600 g in weight) was intraperitoneally injected with 0.4 ml of polyI:C (purchased from Amersham Pharmacia) at a concentration of 2 mg / ml. After 72 hours, blood was drawn from the tail vein and added to four times the volume of normal saline containing heparin. This suspension was slowly added on the surface of Ficoll-Paque Plus Lymphocyte Separation Medium (purchased from Amersham Pharmacia) with twice the suspension volume. After equilibration, centrifuge at 400×g for 30 min at room tem...
Embodiment 2
[0087] Embodiment two: the solid-phase chemical synthesis of antimicrobial peptide and the mensuration of minimum bactericidal concentration
[0088] 1. Solid-phase chemical synthesis of antimicrobial peptides:
[0089] According to the sequence of amino acid residues 1 to 25 of sequence 2 in the sequence listing, entrust Shenzhen Hanyu Biotechnology Co., Ltd. to synthesize the polypeptide, and amidate the C-terminus. After synthesis, it is purified to a purity of 85%.
[0090] 2. Determination of minimum bactericidal concentration
[0091] Different bacteria were cultured in nutrient broth based on shaking overnight at 37°C. Dilute overnight bacteria to about 2×10 5 Colony forming units per milliliter (CFU ml -1 ). Take 25 μl of bacterial solution and the antimicrobial peptide solution (400 μg / ml to 0.5 μg / ml) synthesized above diluted with 1 mmol / L acetate buffer solution (pH4.0) of different concentrations in equal volumes and place them in the wells of a 96-well cell ...
Embodiment 3
[0107] Example 3: Recombinant expression of grouper antimicrobial peptide in prokaryotic expression vector
[0108] A pair of primers were synthesized according to the two-terminal sequences of polynucleotides 152-226 in sequence 1 in the sequence listing and the multiple restriction sites of the prokaryotic expression vector pTRX, the sequences of which are as follows:
[0109] Upstream primer, 5'CGG GGTACCGACGACGACGACAAA TTT ATC TTC CAC ATC ATT 3', where the single underlined part is the KpnI restriction site, and the double underlined part is the enterokinase cleavage site.
[0110] Downstream primer, 5'CGG GCGGCCGC TCA GGC AAA AGC TTT CTC 3', where the single underlined part is the NotI restriction site.
[0111] PCR amplification and gene cloning were carried out according to conventional methods. The PCR product is about 150bp. Cloning the target gene (the nucleotide sequence of Sequence Table 1 or the 152-226 polynucleotide) into the prokaryotic expression vector...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com