Supercharge Your Innovation With Domain-Expert AI Agents!

Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof

An angiogenesis and production method technology, applied in biochemical equipment and methods, botanical equipment and methods, applications, etc., can solve the problem of increasing difficulty in drug quality control, insufficient vascular specificity and selectivity, and target targets. Unclear and other problems, to achieve the effect of improving and inhibiting endothelial cell growth, improving endothelial cell growth inhibition, improving and anti-tumor effects

Active Publication Date: 2005-11-23
CHINA PHARM UNIV
View PDF0 Cites 66 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among these angiogenesis inhibitors, angiostatin and endostatin are the most eye-catching, both of which have entered clinical trials in the United States, although these vascular inhibitors present very attractive prospects , but its defects are also very obvious: so far, the targets of angiogenesis drugs, such as endostatin and angiostatin, are not clear, and their specificity and selectivity to blood vessels are not good enough, and the effect is limited, which leads to The dosage is very high. In the mouse animal model experiment, the dosage of angiostatin reaches hundreds of mg / kg body weight, and the dosage of endostatin reaches tens of mg / kg body weight. When these angiogenesis inhibitors are used in the human body, the dosage should be at least To achieve a dose of several grams / person
Such a large drug dosage will inevitably increase the possibility of toxic and side effects of this type of drug in the future, resulting in increased difficulty in quality control of this type of drug, increased production scale and production costs, and high drug prices.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof
  • Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof
  • Peptide for high performance inhibition of angiogenesis and method for preparing same and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] 1. Cloning of RGD-ED gene and construction of its prokaryotic expression vector

[0031] The base encoding the RGD-ED polypeptide sequence was synthesized as a template; an upstream primer and a downstream primer were synthesized, wherein the upstream primer added an NdeI restriction site; the downstream primer contained an Arg-Gly-Asp sequence and an XhoI site. Perform PCR amplification, the amplified product is recovered and purified by agarose gel electrophoresis, digested with NdeI and XhoI, cloned into the prokaryotic expression vector pw, positive clones are screened by PCR, and the nucleotide sequence analysis confirms that the designed mutation has occurred in the sequence .

[0032] Synthetic primer 1: 5'GGAATTCCATATG ATCGTGCGCCGTGCCGACCGC3'

[0033] Synthetic primer 2: 5'CCGCTCGAGGCAGAAGCAGTCACCACGGCA3'

[0034] Among them, primer 1 encodes the partial sequence of NdeI site and Ile-Val-Arg-Arg-Ala-Asp-Arg-Ala-Ala-Val-Pro, primer 2 encodes XhoI site and conta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a peptide for high performance inhibition of angiogenesis and method for preparing same and use, wherein high performance blood vessel production inhibiting agent RGD-ED with integration compatibility is designed, the inhibiting agent comprises polypeptide polypeptide-valine-arginine-arginine-alanine-aspartate-arginine-alanine-alanine-valine-praline, its one or two ends are connected with polypeptides containing arginine-glycine-aspartic acid sequence. The RGD-ED provided by the invention can be synthesized. The invention also discloses the expression of one RGD-ED in bacillus coli through gene engineering method, wherein the RGD-ED is prepared through the steps of inclusion body protein segregation, dissolution and renaturation, and ion-exchange chromatography segregation and purification.

Description

[0001] 1. Technical field: The present invention belongs to the technical field of bioengineering pharmaceuticals or the field of protein and polypeptide drugs. 2. Background technology [0002] Tumor angiogenesis inhibitors are a class of drugs that have attracted attention in tumor treatment in recent years. Research in this area has made some progress and is expected to become a new class of promising tumor treatment drugs in the future. The concept of tumor neovascularization was proposed by Algureza in 1947. He pointed out that an important characteristic of growing tumors is the ability to initiate the formation of new capillary endothelial cells from the host. In 1971, Folkman hypothesized that tumor growth and metastasis depend on angiogenesis, and that solid tumors can secrete tumor angiogenesis factors in the early stages to stimulate host capillary proliferation. New blood vessels can not only provide nutrients and oxygen needed by tumors and eliminate metabolites, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K7/06
Inventor 徐寒梅奚涛
Owner CHINA PHARM UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More