Primer group utilizing LAMP to detect vibrio alginolyticus and rapid diagnosis kit employing primer group

Abstract

The invention relates to a primer group utilizing LAMP to detect vibrio alginolyticus and a rapid diagnosis kit employing the primer group. The primer group comprises F3: CCAGTGGCTTACTCGTTGG, B3: TTCGCGGCCATAAACTCAT, FIP; CGTTCCACTGCCCACCAAACAAGCCCAGCACTGGTATATGC, and BIP: GGCAACCAAACGGACCTTGCCCGATTGATGACGCCCTTAG, and the rapid diagnosis kit comprises the primer group, positive reference substance, LAMP reaction liquid and BstDNAPolymerase polymerase. The primer group and the rapid diagnosis kit have the advantages that the operability is high, the operation speed is high, the result is visual to judge, the detection cost is low, and the experimental device is simple, and only a common water bath kettle or other equipment capable of obtaining stable heat sources is required.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a primer set for detecting Vibrio alginolyticus by using LAMP and a rapid diagnostic kit thereof. Background technique [0002] Vibrio alginolyticus ( Vibrio alginolyticus ) is a halophilic Gram-negative bacterium that is widely distributed in estuaries and marine environments. Symptoms such as infection, gastroenteritis and sepsis seriously threaten the development of the aquaculture industry and cause huge economic losses. In recent years, due to the continuous occurrence of food poisoning incidents caused by Vibrio alginolyticus, people have further realized the pathogenicity and harm of Vibrio alginolyticus to humans, and therefore included it in the category of foodborne pathogens, becoming Food hygiene daily monitoring and quarantine objects. [0003] At present, my country lacks effective measures to prevent bacterial pathogens such as Vibrio al...

AI Technical Summary

Problems solved by technology

[0003] At present, my country lacks effective measures for the prevention of bacterial pathogenic bacteria such as Vibrio alginolyticus in aquaculture, mainly relying on the widespread use of antibiotics, which has led to the emergence of drug-resistant strains and also poses a threat to human health

In addition, the detection methods are lagging behind, and the traditional separation culture and biochemical reaction identification are still the main methods. Although the detection results are accurate, the experimental operation is cumbersome, time-consuming and laborious. It usually takes 5-7 days to complete the detection, which affects the detection time limit.

Images