Fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses
A technology of syndrome virus and detection method, which is applied in the field of specific detection of largemouth bass ulcer syndrome iridescent virus, can solve problems such as indistinguishability, and achieve the effects of fast detection speed, accurate detection results and high detection precision
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0037] The present invention is described more specifically below in conjunction with embodiment.
[0038] (1) Design of primers
[0039] According to the sequence of the 3' non-coding region of largemouth bass ulcer syndrome virus DNA methyltransferase, primers and probes were designed and synthesized as follows:
[0040] Upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3'
[0041]Downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'
[0042] Probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3'
[0043] The expected amplified DNA fragment is 167bp.
[0044] In the above, the synthesis of primers is to use the solid-phase phosphoramidite method, the 3'-OH of the terminal nucleotide of the nucleic acid chain to be synthesized is first fixed on the polystyrene solid-phase carrier, and the 5'-OH is covered with 4, 4'-dimethoxytrityl protection, the 5'-OH of the next nucleotide is also protected by 4,4'-dimethoxytrityl, the phosphate group on the 3'-OH has -N(C 3 h 3 ) 2 and...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com