Fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses
A technology of syndrome virus and detection method, which is applied in the field of specific detection of largemouth bass ulcer syndrome iridescent virus, can solve problems such as indistinguishability, and achieve the effects of fast detection speed, accurate detection results and high detection precision
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2010-12-29
- Estimated Expiration
- Not applicable · inactive patent
Abstract
Description
technical field
[0001] The invention relates to a specific detection method for largemouth bass ulcer syndrome iridescent virus. Background technique
[0002] Largemouth bass (Micropterus salmoides), also known as California bass, has the characteristics of fast growth, less disease, low temperature resistance, delicious meat and easy to catch. It has been promoted to all parts of the world since the 1970s. The output is around 100,000 tons. Since 2006, a type of ulcer syndrome has been prevalent among farmed largemouth bass in Guangdong Province from June to October every year, and it tends to get worse year by year. The skin and muscles of fish infected with the virus are festered, the spleen and kidney become enlarged, and the mortality rate of diseased fish is as high as 60%, which has caused huge losses to farmers and has posed a serious threat to the largemouth bass farming industry. In 2008, researchers in our unit successfully isolated a virus from diseased fish, a...
Examples
Embodiment Construction
[0037] The present invention is described more specifically below in conjunction with embodiment.
[0038] (1) Design of primers
[0039] According to the sequence of the 3' non-coding region of largemouth bass ulcer syndrome virus DNA methyltransferase, primers and probes were designed and synthesized as follows:
[0040] Upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3'
[0041]Downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'
[0042] Probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3'
[0043] The expected amplified DNA fragment is 167bp.
[0044] In the above, the synthesis of primers is to use the solid-phase phosphoramidite method, the 3'-OH of the terminal nucleotide of the nucleic acid chain to be synthesized is first fixed on the polystyrene solid-phase carrier, and the 5'-OH is covered with 4, 4'-dimethoxytrityl protection, the 5'-OH of the next nucleotide is also protected by 4,4'-dimethoxytrityl, the phosphate group on the 3'-OH has -N(C 3 h 3 ) 2 and...