Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses

A technology of syndrome virus and detection method, which is applied in the field of specific detection of largemouth bass ulcer syndrome iridescent virus, can solve problems such as indistinguishability, and achieve the effects of fast detection speed, accurate detection results and high detection precision

Inactive Publication Date: 2010-12-29
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 1999, Mao et al. designed and synthesized primers based on the conserved sequences of the capsid protein gene and DNA methyltransferase gene of vertebrate iridoviruses, and effectively identified them by the method of polymerase chain reaction (PCR). Viruses of the Ranavirus genus in the Iridoviridae family, but largemouth bass ulcer syndrome virus cannot be distinguished from other strains of the Ranavirus genus using this method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The present invention is described more specifically below in conjunction with embodiment.

[0038] (1) Design of primers

[0039] According to the sequence of the 3' non-coding region of largemouth bass ulcer syndrome virus DNA methyltransferase, primers and probes were designed and synthesized as follows:

[0040] Upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3'

[0041]Downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'

[0042] Probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3'

[0043] The expected amplified DNA fragment is 167bp.

[0044] In the above, the synthesis of primers is to use the solid-phase phosphoramidite method, the 3'-OH of the terminal nucleotide of the nucleic acid chain to be synthesized is first fixed on the polystyrene solid-phase carrier, and the 5'-OH is covered with 4, 4'-dimethoxytrityl protection, the 5'-OH of the next nucleotide is also protected by 4,4'-dimethoxytrityl, the phosphate group on the 3'-OH has -N(C 3 h 3 ) 2 and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses, comprising the following steps of: designing and synthesizing primers according to noncoding region sequences of DNA methyltransferase 3' sides of the micropterus salmoides ulcer syndrome viruses, previously amplifying 167 bp snippets: an upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3', a downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'; also synthesizing a probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3' used for fluorescence detection; and judging the content of virus particles contained in a sample according to detected CT (Computed Tomography) value through template DNA extraction and PCR amplified reaction. The invention has the advantages of fast detection and high detection accuracy.

Description

technical field [0001] The invention relates to a specific detection method for largemouth bass ulcer syndrome iridescent virus. Background technique [0002] Largemouth bass (Micropterus salmoides), also known as California bass, has the characteristics of fast growth, less disease, low temperature resistance, delicious meat and easy to catch. It has been promoted to all parts of the world since the 1970s. The output is around 100,000 tons. Since 2006, a type of ulcer syndrome has been prevalent among farmed largemouth bass in Guangdong Province from June to October every year, and it tends to get worse year by year. The skin and muscles of fish infected with the virus are festered, the spleen and kidney become enlarged, and the mortality rate of diseased fish is as high as 60%, which has caused huge losses to farmers and has posed a serious threat to the largemouth bass farming industry. In 2008, researchers in our unit successfully isolated a virus from diseased fish, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 马冬梅白俊杰邓国成李胜杰叶星于凌云陈昆慈谢俊
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com