Unlock instant, AI-driven research and patent intelligence for your innovation.

Vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology

A ring-mediated isothermal and hemolytic Vibrio technology, which is applied in the fields of resistance to vector-borne diseases, biological testing, and microbial measurement/inspection, and can solve the problem of complex preparation of detection kits and genetic diagnosis of Vibrio parahaemolyticus. Kits and other issues, to achieve the effect of simple identification, high specificity, and wide application

Inactive Publication Date: 2007-12-05
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in practical applications, the design of specific primers and the preparation of detection kits are very complicated, so the loop-mediated isothermal amplification technology has not yet been promoted in the fields of food, medicine, medical and health, and is used to detect parahaemolyticus in samples, and there is no genetic diagnostic kit for this technique to detect Vibrio parahaemolyticus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology
  • Vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, the preparation of kit

[0033] (1) Synthesize oligodeoxynucleic acid primers through DNA synthesizer according to the following sequence: there can be four sets of primers, one set of primers used wherein:

[0034] Outer primer 1: CCGTCAGCGTTGTGAAGC

[0035] Outer primer 2: ACCGTTGGAGAAGTGACCTA

[0036] Inner primer 1: CGTTGCTCCAGATCGTGTGGTTTTTTTCGAACGAGAACGCAGACATT

[0037] Inner primer 2: AAGTGGTTGCACTCGGTGACATTTTTTAGGGAAGCGCCATTGTG

[0038] (2) Dissolve the above primers in double distilled water and place them in the primer container;

[0039] (3) Purchase DNA polymerase Bst DNA polymerase (Large Fragment);

[0040](4) Prepare reaction solution: 80μl 10mM dNTP, 50μl 10×ThermoPol Buffer, 20μl 150mM MgSO 4 ;

[0041] (5) Prepare sample pretreatment solution: 20mM Tris-HCl [pH 8.0], 2mM EDTA, 1.2% TritonX-100;

[0042] (6) Purchase fluorescent dye: SYBR Green I is placed in the container;

[0043] (7) Extracting the genomic DNA of the Vibrio para...

Embodiment 2

[0047] Embodiment 2, the application of the genetic diagnostic reagent provided by the present invention:

[0048] Tested sample: put a little food or body fluid and other tested samples in the enrichment solution and incubate at 37°C.

[0049] 1. Pretreatment of the sample to be tested: Extract the DNA gene according to the conventional method:

[0050] 1. Take 50 μl of overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and discard the supernatant;

[0051] 2. Add 80 μl sample pretreatment solution to the centrifuge tube, and mix evenly with the bacteria obtained from the precipitation;

[0052] 3. Boil in boiling water for 10 minutes and then immediately cool for 10 minutes;

[0053] 4. Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.

[0054] 2. The reaction process of loop-mediated isothermal amplification technology:

[0055] 1. Prepare a reaction system in a 200ul PCR tub...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A subsidiary hemolytic vibrio gene quickly diagnosis reagent box which bases on ring medium conduct constant temperature augment technology and it relates to the bioinstrumentation reagent field. The reagent box is consisted by the di-p-leading object; DNA polymerase; reaction liquid; sample pre-process liquid; fluorescence dye; positive control-liquid and the six liquids lay in the container individually and the leading object has four sleeves. The merits of the reagent box are that: there is no need of the special reagent and device; high specificity; the positive rate can reach above 99.9% and the false positive rate is less 0.1%; high sensitivity; it is easy to identification; it can be identified by the eyes through observing; extensive application: it can be used in quality control with safe and quick detection of the food, medicine, equipage and their primary accessories.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a gene molecular diagnostic reagent for detecting Vibrio parahaemolyticus in a sample by a loop-mediated isothermal amplification technique. Background technique [0002] At present, the detection method of pathogenic Vibrio parahaemolyticus mainly adopts the national standard (GB / T4789.7-2003), which is based on the isolation and identification of pathogenic microorganisms, morphological identification and automatic biochemical identification. There are also reports of molecular biological detection methods such as immunological detection technology for specific proteins, nucleic acid probes, and polymerase chain reaction (PCR) technology [Food Safety Detection and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has been greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64G01N33/52C12Q1/68
CPCY02A50/30
Inventor 石磊曹以诚杜正平李心晖张晓元张珍武
Owner GUANGZHOU HUAFENG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More