Vibrio parahaemolyticus gene rapid diagnosis reagent kit of annular mediated isothermal amplification technology
A ring-mediated isothermal and hemolytic Vibrio technology, which is applied in the fields of resistance to vector-borne diseases, biological testing, and microbial measurement/inspection, and can solve the problem of complex preparation of detection kits and genetic diagnosis of Vibrio parahaemolyticus. Kits and other issues, to achieve the effect of simple identification, high specificity, and wide application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1, the preparation of kit
[0033] (1) Synthesize oligodeoxynucleic acid primers through DNA synthesizer according to the following sequence: there can be four sets of primers, one set of primers used wherein:
[0034] Outer primer 1: CCGTCAGCGTTGTGAAGC
[0035] Outer primer 2: ACCGTTGGAGAAGTGACCTA
[0036] Inner primer 1: CGTTGCTCCAGATCGTGTGGTTTTTTTCGAACGAGAACGCAGACATT
[0037] Inner primer 2: AAGTGGTTGCACTCGGTGACATTTTTTAGGGAAGCGCCATTGTG
[0038] (2) Dissolve the above primers in double distilled water and place them in the primer container;
[0039] (3) Purchase DNA polymerase Bst DNA polymerase (Large Fragment);
[0040](4) Prepare reaction solution: 80μl 10mM dNTP, 50μl 10×ThermoPol Buffer, 20μl 150mM MgSO 4 ;
[0041] (5) Prepare sample pretreatment solution: 20mM Tris-HCl [pH 8.0], 2mM EDTA, 1.2% TritonX-100;
[0042] (6) Purchase fluorescent dye: SYBR Green I is placed in the container;
[0043] (7) Extracting the genomic DNA of the Vibrio para...
Embodiment 2
[0047] Embodiment 2, the application of the genetic diagnostic reagent provided by the present invention:
[0048] Tested sample: put a little food or body fluid and other tested samples in the enrichment solution and incubate at 37°C.
[0049] 1. Pretreatment of the sample to be tested: Extract the DNA gene according to the conventional method:
[0050] 1. Take 50 μl of overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and discard the supernatant;
[0051] 2. Add 80 μl sample pretreatment solution to the centrifuge tube, and mix evenly with the bacteria obtained from the precipitation;
[0052] 3. Boil in boiling water for 10 minutes and then immediately cool for 10 minutes;
[0053] 4. Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.
[0054] 2. The reaction process of loop-mediated isothermal amplification technology:
[0055] 1. Prepare a reaction system in a 200ul PCR tub...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com