Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

65 results about "Nucleotide Aptamers" patented technology

Non-equilibrium capillary electrophoresis of equilibrium mixtures (NECEEM) - based methods for drug and diagnostic development

The invention discloses a Non-Equilibrium Capillary Electrophoresis of Equilibrium Mixtures (NECEEM) method and NECEEM-based practical applications. The NECEEM method is a homogeneous technique, which, in contrast to heterogeneous methods, does not require affixing molecules to a solid substrate. The method of the invention facilitates 3 practical applications. In the first application, the method allows the finding of kinetic and thermodynamic parameters of complex formation. It advantageously allows for revealing two parameters, the equilibrium dissociation constant, Kd, and the monomolecular rate constant of complex decay, koff, in a single experiment. In the second practical application, the method of this invention provides an approach for quantitative affinity analysis of target molecules. It advantageously allows for the use of affinity probes with relatively high values of koff. In the third practical application, the method of this invention presents a new and powerful approach to select target-binding molecules (ligands) from complex mixtures. Unique capabilities of the method in its third application include but not limited to: (a) the selection of ligands with pre-determined ranges of kinetic and thermodynamic parameters of target-ligand interactions, (b) the selection of ligands present in minute amounts in complex mixtures of biological or synthetic compounds such as combinatorial libraries of oligonucleotides, and (c) the selection of ligands for targets available in very low amounts. In particular, the method of this invention provides a novel approach for the selection of oligonucleotide aptamers. The NECEEM-based method can be used for discovery and characterization of drug candidates and the development of new diagnostic methods.
Owner:KRYLOV SERGEY

Molybdenum disulfide based sensor as well as preparation method and application thereof

The invention relates to a molybdenum disulfide based sensor as well as a preparation method and an application thereof and belongs to a protein detection method in the biomedical field. According to the technical scheme, the method mainly comprises steps as follows: firstly, an MoS2-AuNP compound is prepared; a nucleotide aptamer of thrombin is synthesized; the synthesized nucleotide aptamer is added to an aqueous solution of MoS2-AuNP, Tween 80 is added, a mixed solution is obtained, reacts for 30 min at the room temperature, then is heated for 2.5 h in a water bath with the temperature of 70 DEG C and is centrifuged at the speed of 10,000 r for 15 min, and then, precipitates are dispersed in a 0.1 M PBS (phosphate buffer solution); and the sensor is prepared. The characteristic that MoS2-AuNP can quench fluorescence is sufficiently utilized, an FAM (carboxyfluorescein)-marked nucleotide aptamer sequence is combined with thrombin specificity, trace detection of thrombin can be realized in a high-sensitivity, rapid and low-cost manner through quenching and recovery of FAM fluorescence, and the actual LOD (limit of detection) of the MoS2-AuNP-nucleotide aptamer sensor to thrombin is increased to 0.4 pM due to addition of Tween 80.
Owner:镇江永晨科技有限公司

Axl receptor tyrosine kinase aptamer inhibitor for use in therapy

The present invention concerns a nucleotide aptamer having the sequence: 5′-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3′(SEQ ID NO: 1) for use in the treatment and / or prevention and / or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit.
Owner:CONSIGLIO NAT DELLE RICERCHE

Biosensing probe kit for detecting sulfadiazine on basis of nucleotide aptamer specificity, and application thereof

The invention provides a biotin-labeled sulfadiazine nucleotide aptamer. The biotin-labeled sulfadiazine nucleic acid aptamer is characterized by comprising a probe, wherein the nucleotide sequence of the probe is S-SDZ No.1. The kit and the method provided by the invention have the advantage of speediness, stability and simpleness in detection, and the prepared nucleotide aptamer is rapid in SDZ residue detection, high in sensitivity, good in repeatability and high in specificity, and has a wide application prospect in rapid detection of food safety.
Owner:CHONGQING NORMAL UNIVERSITY

EGFR aptamer inhibitor for use in therapy and diagnosis

The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and / or prevention and / or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit.
Owner:CONSIGLIO NAT DELLE RICERCHE

HER2 (Human Epidermal Growth Factor Receptor 2) protein nucleotide aptamer, complex composition and applications thereof

The invention relates to a HER2 (Human Epidermal Growth Factor Receptor 2) protein nucleotide aptamer, a complex, a composition and applications thereof, and in particular relates to an HER2 (Human Epidermalgrowth Factor Receptor-2) protein specificity combined nucleotide aptamer which has the sequence shown in SEQ ID NO:5. The invention further relates to the complex formed by combining the HER2 protein specificity combined nucleotide aptamer with a chemotherapeutic medicine or wrapping the HER2 protein specificity combined nucleotide aptamer and the chemotherapeutic medicine in a nanoparticle together, the composition comprising the complex, and anti-tumor application as well as an tumor targeted imaging application of the nucleotide aptamer, the complex and the composition.
Owner:THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI

FET Sensors With Subtractive Probes for Indirect Detection and Methods

InactiveUS20140212870A1Sensitive highRobust and repeatable quantitative detectionBioreactor/fermenter combinationsBiological substance pretreatmentsTrue positive rateElectric conductance
The present invention relates to compositions on a FET sensor for detecting wide variety of biological entities. The composition of the FET sensor comprises a linker probe having a region for binding a biological entity, and enzymatic region that can cleave or change the position of a cargo molecule bound to the linker probe. The binding of the biological entity may cause a first strand of DNA to dehybridize from a second strand of DNA resulting in a change in conductance of the FET sensor. When the conformation of the probe changes, the conductance of the FET changes. This method provides an advantage over the conventional FET biosensors that use antibodies as probes since the size of nucleotide aptamer probes is smaller, their conformation / shape is well controlled, and their charge is fixed for a wider range of solution conditions, enabling robust detection of target entities with high sensitivity and specificity.
Owner:TRIVEDI KRUTARTH

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof. The method for screening the aeromonas hydrophila aptamer comprises the following specific steps of: establishing and synthetising an aeromonas hydrophila aptamer ssDNA library to be screened and designing and synthetising a corresponding primer; taking an appropriate amount of ssDNA library for combination with the aeromonas hydrophila; separating out the ssDNA combined with the aeromonas hydrophila, performing PCT amplification with the ssDNA as a template, and performing SELEX screening on the amplification products until the corresponding aptamer is obtained. The SELEX technique is employed to screen out the high affinity oligonucleotide aptamer of the pathogenic aeromonas hydrophila; and the aptamer can be widely applied to detecting and analyzing the aeromonas hydrophila.
Owner:JIMEI UNIV

A specific oligonucleotide aptamer for the identification of T-2 toxin

This invention provides a small molecule oligonucleotide aptamer binding to T-2 toxin specifically, and the sequence of the ssDNA aptamer is SEQ ID NO: 1. Through the graphene oxide separation-based Systematic Evolution of Ligands by Exponential Enrichment, single-stranded oligonucleotide aptamer with high affinity and specific identification of T-2 toxin was obtained in vitro selection. The aptamer has a broad application prospect, which can be used for separation and enrichment of trace T-2 toxin in the sample. It can also be used as a reporter aptamer for the detection of T-2 toxin in food by means of functional groups labeling and other means.
Owner:JIANGNAN UNIV

Nucleic acid aptamer for combining human beta-microglobulin

The invention discloses a short-chain nucleotide aptamer with high specificity and high affinity of beta-microglobulin and a screening method of the aptamer. The nucleotide aptamer provided by the invention comprises DNA (deoxyribonucleic acid) segments of nucleic acids shown by any one from a sequence 1 to a sequence 10. The preparation method of the nucleotide aptamer comprises the steps of designing and synthesizing a random single-chain nucleotide library, and screening the nucleotide aptamer of the beta-microglobulin. The nucleic acid aptamer disclosed by the invention is used for identifying a combined target, so that the nucleic acid aptamer is favorable for rapid determination of the beta-microglobulin.
Owner:杭州耀洲生物科技有限公司 +1

Composition for preventing or treating valve calcification, containing dpp-4 inhibitor

The present invention relates to a composition for preventing or treating valve calcification, containing a dipeptidyl peptidase-4 (DPP-4) inhibitor. The DPP-4 inhibitor according to the present invention may include all of what can inhibit the expression of DPP-4 nucleotides or the activity of DPP-4 proteins, wherein: DPP-4 antibodies, sitagliptin, vildagliptin, saxagliptin, linagliptin, dutogliptin, gemigliptin, alogliptin, Anagliptin, evogliptin, Berberine, Diprotin, or Lupeol; DPP-4 mRNA anti-sense nucleotides, aptamers, small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA), or RNA interference (RNAi); or the like can be used.
Owner:THE ASAN FOUND +1

Aptamer for detecting aflatoxin M1, sensor, kit and application thereof

The invention discloses an aptamer for detecting aflatoxin M1, a sensor, a kit and application thereof. The aptamer for detecting aflatoxin M1 has the nucleotide as shown in SEQ ID No:1. The invention further discloses a sensor for preparing the nucleotide aptamer and a detection kit containing the sensor solution. Signal amplification is carried out by using PCR technology as signal transduction, the detection limit is greatly reduced and reaches 0.03ng / L. The nucleotide aptamer is used as an identification unit, the sensor prepared from the nucleotide aptamer is used for detecting the content of aflatoxin M1 in a sample and has high sensitivity and wide linear range when detecting the aflatoxin M1, and accurate quantitative detection can be realized.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Nucleotide aptamer-based metal probe as well as preparation method and application thereof

The invention discloses a nucleotide aptamer-based metal probe as well as a preparation method and application thereof, and relates to the technical field of biological detection. The probe is composed of a 167Er metal cation, a bifunctional polymer and a -SHC6-A10-3. 2 aptamer. The preparation method of the probe comprises the steps of chelating 167Er cations with diethylenetriamine pentaacetic acid (DTPA) in a bifunctional polymer to form a polymer-based 167Er lanthanide metal chelate MCPs (167Er), and carrying out an addition reaction on the successfully chelated MCPs (167Er) and the -SHC6-A10-3.2 nucleic acid aptamer to generate the IMC probe based on the nucleotide aptamer. The metal probe can be used as a non-invasive diagnostic imaging reagent for identifying a target substance, and is used for quantitative and positioning analysis of protein of a cell line or tissue. The nucleotide aptamer-based metal probe disclosed by the invention has the advantages of high sensitivity, accurate positioning, high dyeing accuracy and the like.
Owner:SHANGHAI JIAO TONG UNIV

Aeromonas hydrophila aptamer as well as screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer as well as a screening method and application thereof. The screening method comprises the following specific steps: building and synthetizing aeromonas hydrophila aptamer ssDNA libraries to be screened, and designing and synthesizing corresponding primers; taking appropriate ssDNA libraries to combine with the aeromonas hydrophila; obtaining ssDNA combined with the aeromonas hydrophila through separating, taking the ssDNA as a template for PCT amplification; allowing amplified products to be subjected to SELEX screening again until obtaining the corresponding aptamer. According to the method, the SELEX technology is adopted to screen out high-affinity oligonucleotide aptamer of the pathogenic aeromonas hydrophila. Therefore, the aptamer can be extensively applied for detection and analysis of the aeromonas hydrophila.
Owner:JIMEI UNIV

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.
Owner:JIMEI UNIV

Lingo-2 antagonists for treatment of conditions involving motor neurons

ActiveUS20150118241A1Promote motor neuron survivalConducive to survivalNervous disorderAntibody mimetics/scaffoldsAntigenAntigen Binding Fragment
The invention provides methods of treating diseases, disorders or injuries involving motor neuron survival and axonal growth, including amylotrophic lateral sclerosis, by the administration of a LINGO-2 antagonist. An exemplary method for promoting survival of a motor neuron, comprising contacting said motor neuron with an effective amount of a composition comprising a LINGO-2 antagonist selected from the group consisting of: (i) a soluble LINGO-2 polypeptide; (ii) a LINGO-2 antibody or antigen-binding fragment thereof; (iii) a LINGO-2 antagonist polynucleotide; (iv) a LINGO-2 aptamer; and (v) a combination of two or more of said LINGO-2 antagonists.
Owner:BIOGEN MA INC

Non-equilibrium capillary electrophoresis of equilibrium mixtures (NECEEM)—based methods for drug and diagnostic development

The invention discloses a Non-Equilibrium Capillary Electrophoresis of Equilibrium Mixtures (NECEEM) method and NECEEM-based practical applications. The NECEEM method is a homogeneous technique, which, in contrast to heterogeneous methods, does not require affixing molecules to a solid substrate. The method of the invention facilitates 3 practical applications. In the first application, the method allows the finding of kinetic and thermodynamic parameters of complex formation. It advantageously allows for revealing two parameters, the equilibrium dissociation constant, Kd, and the monomolecular rate constant of complex decay, koff, in a single experiment. In the second practical application, the method of this invention provides an approach for quantitative affinity analysis of target molecules. It advantageously allows for the use of affinity probes with relatively high values of koff. In the third practical application, the method of this invention presents a new and powerful approach to select target-binding molecules (ligands) from complex mixtures. Unique capabilities of the method in its third application include but not limited to: (a) the selection of ligands with pre-determined ranges of kinetic and thermodynamic parameters of target-ligand interactions, (b) the selection of ligands present in minute amounts in complex mixtures of biological or synthetic compounds such as combinatorial libraries of oligonucleotides, and (c) the selection of ligands for targets available in very low amounts. In particular, the method of this invention provides a novel approach for the selection of oligonucleotide aptamers. The NECEEM-based method can be used for discovery and characterization of drug candidates and the development of new diagnostic methods.
Owner:KRYLOV SERGEY

Aptamers that bind to prion protein

Compositions are provided in the form of nucleotide aptamerss that are capapble of binding PrP, and in some embodiments, differentially binding PrP isoforms. Also provided are methods for identifying PrP in a sample, and in some embodiments, either selectively removing PrP or PrP isoforms from a sample, or inactivating them within a sample.
Owner:THE OHIO STATE UNIV RES FOUND

Small-molecule nucleotide aptamer for hepatitis C virus, preparation method and use thereof

A DNA aptamer specific for HCV having a nucleotide sequence as shown in SEQIDNO.1-29, and a method of preparing the same including the steps of: (1) constructing a single-stranded DNA library; (2) constructing a double-stranded DNA library; (3) screening by SELEX; (4) amplifying by PCR; (5) cloning and sequencing; and (6) testing the effect from cellular level in vitro. The DNA aptamer can be used directly as medication and diagnostic reagent for detection, prevention, and treatment of hepatitis C. A method for detection of HCV infection is also provided.
Owner:ZHANG XIAOLIAN

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer, and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.
Owner:JIMEI UNIV

Method for colorimetrically detecting amine substances based on bimetallic nano-enzyme

The invention discloses a method for colorimetrically detecting amine substances based on bimetallic nano-enzyme, which is characterized in that the amine substances in a sample to be detected are detected by using a bimetallic nano-enzyme material modified by a nucleotide aptamer, and the enzyme material comprises UiO66-NH2, platinum nano particles and palladium nano particles are deposited on the surface to form a bimetallic nano-enzyme material, and the bimetallic nano-enzyme material is modified with a nucleic acid aptamer for identifying and capturing amine substances. In the method, the adopted nucleotide aptamer modified bimetallic nano-enzyme material has the advantages of uniform pore size distribution, reasonable framework structure design, large specific surface area, high catalytic activity and the like, and has the advantages of high sensitivity, simplicity in operation, strong anti-interference capability, wide detection range, low detection limit and the like when being used for detecting amine substances in a sample; specific detection of amine substances can be achieved, the concentration of the amine substances in a sample can be rapidly and accurately obtained under the room temperature condition, and good use value and application prospects are achieved.
Owner:HUNAN UNIV

Specific oligonucleotide aptamer for the identification of T-2 toxin

InactiveUS9856482B2High affinityAccurate and convenient to obtain high affinity of single-strandMicroorganismsMicrobiological testing/measurementGrapheneNucleotide Aptamers
This invention provides a small molecule oligonucleotide aptamer binding to T-2 toxin specifically, and the sequence of the ssDNA aptamer is SEQ ID NO: 1. Through the graphene oxide separation-based Systematic Evolution of Ligands by Exponential Enrichment, single-stranded oligonucleotide aptamer with high affinity and specific identification of T-2 toxin was obtained in vitro selection. The aptamer has a broad application prospect, which can be used for separation and enrichment of trace T-2 toxin in the sample. It can also be used as a reporter aptamer for the detection of T-2 toxin in food by means of functional groups labeling and other means.
Owner:JIANGNAN UNIV

A nucleic acid aptamer for recognizing doxorubicin-resistant breast cancer cells and its screening method and application

The invention discloses a nucleic acid aptamer for recognizing adriamycin-resistant breast cancer cells. The nucleic acid aptamer is a single-stranded DNA molecule shown in any of the following (1)-(6): (1) the nucleic acid aptamer 1 shown in the nucleotide molecule of SEQ ID No.1; (2) as shown in The nucleic acid aptamer 2 shown in the nucleotide molecule of SEQ ID No.2; (3) the nucleic acid aptamer 3 shown in the nucleotide molecule of SEQ ID No.3; (4) the nucleic acid aptamer 3 shown in the nucleotide molecule of SEQ ID No.4; Nucleic acid aptamer 4 shown in the molecule; (5) nucleic acid aptamer 5 shown in the nucleotide molecule of SEQ ID No.5; (6) nucleic acid aptamer 6 shown in the nucleotide molecule of SEQ ID No.6 . Using the nucleic acid aptamer of the present invention, the drug resistance of the tumor can be monitored in real time from the molecular response signal when the drug resistance mechanism is unknown; thus, it is beneficial to change the treatment plan in time and increase the success rate of chemotherapy.
Owner:INST OF CHEM CHINESE ACAD OF SCI

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.
Owner:JIMEI UNIV

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.
Owner:JIMEI UNIV

Fluorine-18 labeled compositions and their use in imaging of biological tissue

A method for internal imaging of biological tissue in a subject by positron emission tomography (PET) or single photon emission computer tomography (SPECT), the method comprising: (i) administering to a subject an imaging agent that includes, at minimum, at least one fluorine-18 radionuclide bound directly or indirectly to a fluorophore, and (ii) imaging internal biological tissue of the subject by PET or SPECT. In further embodiments, the method includes (i) administering to a subject an imaging agent that includes at least one fluorine-18 radionuclide bound directly or indirectly to a fluorophore, and at least one biological entity (e.g., blood cell, peptide, nucleotide, aptamer, targeting agent, antibody, or antibody fragment) bound directly or indirectly to the fluorophore; and (ii) imaging internal biological tissue of the subject by PET or SPECT. In some embodiments, the method further includes simultaneously imaging the internal biological tissue by fluorescence imaging.
Owner:CORNELL UNIVERSITY

Aeromonas hydrophila aptamer and its screening method and application

The present invention involves a moderate and screening methods and applications of aquatic monolia.Provide a screening method and application of water -adding monolithic body and the method of screening of water -only gas monolithic bodies.The specific steps of the screening method of water -enchanting monocyloburates include: to build and synthesize the SSDNA library of hydrophilic monolithium bacteria that is to be selected, and design the corresponding primer; take an appropriate amount of SSDNA library and addictionA combination of water and gas monocular bacteria; SSDNA, which is separated from the combination of water -based monolithium, is separated, and the SSDNA is used as a template for PCT amplification. The amplification product is screened again until the corresponding appropriate body.The present invention uses Selex technology to screen the high -affinity and oligonucleotide of the pathogenic monolithic bacteria, which can be widely used in the detection and analysis of hydrophobic bacteria.
Owner:JIMEI UNIV

Aeromonas hydrophila aptamer, and screening method and application thereof

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.
Owner:JIMEI UNIV