Check patentability & draft patents in minutes with Patsnap Eureka AI!

Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use

A hepatitis C virus, molecular nucleotide technology, applied in the field of microbial infection immunity and inspection

Inactive Publication Date: 2009-07-15
WUHAN UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no vaccine for prevention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use
  • Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use
  • Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0069] A DNA aptamer capable of binding and inhibiting hepatitis C virus infection has the nucleotide sequence shown in SEQ ID NO. (1-29).

[0070] A method for preparing a DNA aptamer capable of binding and inhibiting hepatitis C virus infection is carried out in the following steps:

[0071] 1. Construction of random single-stranded DNA (ssDNA) library and primers. Construct a single-stranded DNA (ssDNA) library with a length of 88 bases: 5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N 30 -GGGTCAATGCGTCATA-3', wherein N represents any one of the bases A, G, T, and C, and the capacity of the library is about 10 14 ~10 15 ; Construct upstream primer: 5'-GCGGAATTC TAATACGACTCACTATAGGG AACAGTCCGAGCC-3', where the underlined part is the sequence of the T7 promoter, the primer contains a DNA restriction endonuclease EcoRI restriction site; construct a downstream primer: 5'-GCGGGATCCTATGACGCATTGACCC-3', the primer contains a DNA restriction The cleavage site of the sex endonucl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a micro-molecular nucleotide adaptor medicament for hepatitis C virus and application thereof. The DNA adaptor sequence is the nucleotide sequence represented by SEQ IN No. 1-29. The method comprises the following steps: firstly, building a random single-chain DNA library; secondly, synthesizing a double-chain DNA library; thirdly, SELEX selecting; fourthly, PCR amplifying; fifthly, cloning and detecting sequence; and sixthly, testing DNA adaptor efficiency by level tests on cells in vitro. The micro-molecular nucleotide adaptor is applied to preparing medicaments in treating hepatitis C virus and preventing hepatitis C virus infecting human cells. The DNA adaptor can be directly used as agonist and diagnostic reagent of hepatitis C virus, can be used for preventing, detecting and treating hepatitis C virus, and overcomes the defects that combined treatment with alpha interferon and ribavirin has strong side effect when alpha interferon or antivirus medicaments such as alpha interferon, ribavirin and the like which are combined are used for treating hepatitis C virus in clinic, and that hepatitis C virus has no vaccine to prevent currently.

Description

technical field [0001] The invention belongs to the field of microbial infection immunity and detection, in particular to a small molecule nucleotide sequence (or DNA aptamer) capable of specifically inhibiting hepatitis C virus (hepatitis C virus, HCV) from infecting human cells, with SEQ ID NO . The small molecule nucleotide sequence (or single-stranded DNA aptamer) shown in 1-29. At the same time, it also relates to a method for preparing a high-affinity small-molecule DNA aptamer that can specifically bind to hepatitis C virus and specifically antagonize hepatitis C virus infection. The invention is used in medicine for virus infection of human cells, and the DNA aptamer nucleotide is also used as a new clinical diagnostic reagent for detecting hepatitis C virus envelope antigen. Background technique [0002] Hepatitis C virus (HCV) was identified for the first time in 1989. Up to now, about 1.7 million people in the world have been infected with HCV. The infected peopl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68A61K31/7088A61P31/14A61P1/16
CPCC12N2310/16C12N15/115A61P31/12
Inventor 章晓联陈芳
Owner WUHAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More