30 results about "Specific identification" patented technology

The invention discloses a controllable nanorod array SERS (Surface Enhanced Raman Scattering) chip-based digital detection device for a serous ovarian cancer exosome phenotype as well as a detection method and application thereof, and relates to the technical field of biological detection. The device comprises a controllable nanorod array module, a high-sensitivity SERS probe module, an integrated microfluidic platform module and a digital analysis module. The controllable nanorod array module is used for accurately capturing a single exosome; the SERS probe module realizes specific recognition of multiple biomarkers on the surface of the exosome by conjugating a specific antibody and a Raman reporter molecule; the micro-fluidic platform module integrates filtering, reaction and imaging functions, so that high-throughput and automatic detection is realized; and the digital analysis module completes qualitative and quantitative analysis of exosome phenotypes. The problems that a traditional detection technology cannot analyze the phenotype difference of single exosomes, the sensitivity is low and the flux is insufficient are solved, early accurate diagnosis of the serous ovarian cancer can be achieved, and the kit has wide clinical application prospects.

The application discloses a temperature-sensitive molecular imprinting sensitive film, a preparation method thereof and application thereof in a glyphosate detection sensor, and belongs to the field of optical sensing technology and environmental monitoring. The application forms an imprinting cavity which is highly complementary to a template molecule in size and spatial configuration in a polymer network, realizes specific identification of a target molecule, and solves the problems of complex sample pretreatment and long detection period of the existing glyphosate detection method. The application introduces a temperature-sensitive material PNIPAM, realizes in-situ, non-destructive and reversible release of the template molecule by temperature control, discards the traditional destructive elution mode, avoids causing serious secondary environmental pollution, avoids the problems of swelling and corrosion of the imprinting cavity caused by strong acid or organic solvent, and causes irreversible damage to the structure of the imprinting cavity, which seriously affects the reuse frequency of the sensor and the detection stability.

The invention discloses an LAMP (loop-mediated isothermal amplification) primer group, a kit and a method for detecting four quarantine viruses and application of the LAMP primer group. Belongs to the technical field of molecular biology and plant quarantine. Aiming at conserved gene regions of bean pod mottle virus, tobacco ringspot virus, tomato ringspot virus and southern bean mosaic virus, a specific target sequence is screened through bioinformatics analysis, an LAMP primer group is designed, and the nucleotide sequence of the LAMP primer group is shown as SEQ ID NO.1-22. Furthermore, the screened primer group is combined with a micro-fluidic chip technology to construct a detection kit capable of synchronously detecting the four viruses, so that the specific identification of the four target viruses is realized. The kit has the advantages of rapidness, sensitivity, specificity, simplicity and convenience in operation and the like, the sensitivity can reach 10 <-10 > Copies / mu L, and the kit is suitable for high-throughput rapid screening of quarantine viruses in imported soybeans on port sites and has important significance in guaranteeing national biosafety.

The invention belongs to the technical field of bioengineering, and discloses a specific identification primer and method for lactobacillus curvatus in human intestinal tracts and application. The identification primer comprises an upstream primer COG3825F1 and a downstream primer COG3825R1, the nucleotide sequence of the upstream primer COG3825F1 is 5 '-GTCACAACAAGACCGATTT-3', and the nucleotide sequence of the downstream primer COG3825R1 is 5 '-CTGTTTCTACAACTTGTGCT-3', and the nucleotide sequence of the upstream primer COG3825F1 and the nucleotide sequence of the downstream primer COG3825R1 are 5 '-GTCACAACAAGACCGATTT-3'. The specific COG3825 gene of the lactobacillus flexus is screened to serve as a target sequence design primer, and PCR, gel electrophoresis and qPCR verification show that the primer has extremely high specificity and sensitivity and can accurately distinguish the lactobacillus flexus from the related lactobacillus and other common intestinal bacteria under the complex micro-ecological background of the human intestinal tract; the identification method based on the primer is easy and convenient to operate and accurate in result, qualitative and quantitative detection of the lactobacillus brevis in human intestinal samples, food samples and other environment samples can be achieved, and important technical support is provided for related research, application development and micro-ecological monitoring of the lactobacillus brevis.

This invention belongs to the field of microbial technology and relates to a thermoresistant, high-esterase-producing *Changfangluode* yeast and its specific identification method. The high-esterase-producing, thermoresistant *Changfangluode* yeast (… Lodderomyces elongisporus FBKL2.9-G53, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20253046 on December 29, 2025, exhibits excellent thermostability, maintaining good growth activity and enzyme production capacity even at 45℃. Quantitative esterase analysis showed a significant thermo-enhancing effect on enzyme production, with esterase activity of 12.83 U / mL at 28℃, increasing to 14.87 U / mL at 40℃ and 20.56 U / mL at 45℃. Simulated fermentation experiments further confirmed that the strain demonstrated robust metabolic adaptability under 45℃ heat stress, with esterase activity reaching 7.44±0.35 U / mL on day 7 of fermentation, approximately 1.55 times higher than the control group at 28℃.

The present application provides a DNA barcode specific identification method of radix rehmanniae decoction pieces, and relates to the technical field of true and false identification of traditional Chinese medicine decoction pieces. The specific identification method comprises the following steps: extracting sample DNA to be detected; screening universal and specific DNA barcode genes; amplifying universal and specific DNA barcode gene fragments; amplifying the amplification product; and obtaining amplified DNA barcode sequences after sequence correction and splicing, and performing online BLAST comparison with NCBI database, so as to determine the base origin of the sample to be detected. The method provided by the present application can overcome the problem that the DNA barcode of the conventional ITS2 sequence of the decoction piece after processing is not easy to amplify, and the PCR amplification product of the present application has high quality, the molecular identification result is accurate, and the rapid identification of radix rehmanniae and radix rehmanniae preparata decoction pieces can be efficiently and high-quality solved, and the urgent need for true and false identification of radix rehmanniae decoction pieces during acceptance is solved.

The application belongs to the field of chemical detection, and relates to a Schiff base copper ion colorimetric fluorescent probe molecule and a preparation method and application thereof. The structural formula of the Schiff base copper ion colorimetric fluorescent probe molecule is: the preparation method has simple synthesis steps, and only needs to pass through one-step reaction, and has high yield. The fluorescent probe provided by the application exhibits high efficient and specific identification performance on copper ions in a PBS buffer solution system, has the advantages of good selectivity, strong anti-interference ability, fast response speed (response can be completed within 30 seconds), low detection limit (18 nM), and a wide pH value application range; colorimetric experiment results show that the probe can realize naked-eye detection on copper ions, and has wide application prospects in the fields of public safety, environmental monitoring and the like.

The invention discloses a primer group, a kit and a method for identifying deer species based on IGF1 (Insulin-like Growth Factor 1), IGF2 (Insulin-like Growth Factor 2) and RAF1 genes. The primer group comprises three pairs of specific primers aiming at IGF1, IGF2 and RAF1 genes, and the sequences of the three pairs of specific primers are respectively SEQ ID NO: 12 and 13, SEQ ID NO: 14 and 15, and SEQ ID NO: 16 and 17. In specific identification, DNA of a sample is extracted, PCR amplification is carried out by using the primer group, and then the fragment length difference of an amplification product is analyzed through agarose gel electrophoresis. By comparing specific length combinations of IGF1, IGF2 and RAF1 gene amplified fragments, the four types of cervidae animals can be accurately distinguished. According to the application, the identification system for the cervidae species based on the IGF1, IGF2 and RAF1 genes is established for the first time, and the identification system has the advantages of rapidness, accuracy, low cost and no need of sequencing, and is suitable for species source identification and market supervision of related products.

This application relates to the field of quality testing technology and provides a method for quality testing of GABA extract in peanut sprouts. It utilizes a molecularly imprinted sensor for specific identification of GABA, combined with a pre-set peanut sprout interference database and partial least squares regression to calculate impurity contribution. This method can specifically eliminate interference from complex matrix impurities in peanut sprout extracts, solving the problem of insufficient specificity in traditional methods for complex samples. The molecularly imprinted sensor is connected in series with a quartz crystal microbalance via a microfluidic channel. Capacitance changes trigger resonant frequency detection, creating a coherent process from identification to quality analysis and improving detection efficiency. By inputting corrected frequency offset, phase angle, and temperature into a recurrent neural network, the method integrates multi-dimensional detection information to achieve accurate output of GABA concentration. Compared to single-parameter detection methods, this method more comprehensively reflects the true content of GABA in the extract, providing a reliable basis for quality judgment.

The application discloses a multiplex PCR specific identification primer for a pheasant meat source component, and the nucleotide sequence of a pheasant specific primer is 5'-GTAAAGTAGGACCATGCCTCT-3'. The application further discloses a kit containing the multiplex PCR specific identification primer, and a multiplex PCR identification method for the pheasant meat source component. The pheasant specific primer provided by the application can perform PCR amplification on 12S rRNA, the amplification effect is stable, a 151bp specific band can be generated, and the pheasant meat source can be effectively identified.

The present application belongs to the field of biotechnology, and particularly relates to a biomarker for differential diagnosis of recent and long-term tuberculosis infection. The present application determines the differential proteins in blood of Mycobacterium tuberculosis recent infection and long-term infection through proteomics, and provides a diagnostic biomarker for differential diagnosis of Mycobacterium tuberculosis recent infection and long-term infection. The biomarker provided by the present application has good diagnostic efficiency whether it is used for single diagnosis or combined diagnosis, and the AUC value is greater than or close to 0.8. The biomarker can be used for more rapid, efficient, sensitive and specific identification of Mycobacterium tuberculosis recent infection, and provides a diagnostic basis for early intervention of tuberculosis.

The invention discloses application of a nanochannel membrane in specific recognition of L-Glu in a nanofluid device, and belongs to the technical field of membrane science. The nanofluid device comprises two conductance cells and an L-glutamate oxidase (GLOD) modified HGO-COOH / TOCNF nanochannel membrane arranged between the two conductance cells, electrodes are placed in the two conductance cells respectively, and the two conductance cells are filled with salt solutions with the same concentration; according to the application, after the GLOD modified HGO-COOH / TOCNF nano-channel film is soaked in liquid to be detected, volt-ampere testing is carried out, and recognition detection data of L-Glu is obtained according to the current response condition. The nano-channel membrane has good ion transmission stability when being used for a nano-fluid device, is high in recognition sensitivity and good in stability when being used for specifically recognizing L-Glu, and has considerable application value.

This invention relates to the field of biodetection technology, specifically to a primer set for identifying Fritillaria taibaiensis, a real-time quantitative PCR detection kit, and their applications. The primer set includes a first ARMS primer pair, a second ARMS primer pair, and a universal primer pair for the Fritillaria genus. The second ARMS primer introduces an artificial mismatched base near the 3' end, improving the specific recognition ability of the target site and reducing the risk of false negatives due to rare variations in the target region. Based on real-time quantitative PCR amplification using specific fluorescent probes, the relative quantitative analysis of Fritillaria taibaiensis DNA in the sample is achieved through the Ct value of the amplification curve. Furthermore, combined with amplification using universal primers for the Fritillaria genus and HRM analysis, the melting peak characteristics of the amplified product are used to determine whether other Fritillaria species are mixed in the sample, thereby achieving specific identification, relative quantitative analysis, and adulteration identification of Fritillaria taibaiensis, improving the accuracy and reliability of Fritillaria-type medicinal materials identification.

The application discloses Macrobrachium rosenbergii 5K liquid phase chip and application thereof, relates to the technical field of molecular detection of aquatic species resources, and comprises a target capture probe combination and a 6087 specific SNP site combination; the SNP sites are all located on a Macrobrachium rosenbergii reference genome HiCasm202009.chrome.fasta, and the probe combination is used for specific identification and enrichment detection of the SNP sites. Through the use of strictly screened high-quality sites, specifically designed specific probes according to target sequences and liquid phase targeted hybridization enrichment technology, efficient and accurate detection without redundant data is realized, the stability and reliability of the typing result are ensured, the detection and analysis cost is reduced, the chip can comprehensively support the multiple applications of Macrobrachium rosenbergii genotyping, species identification, pedigree reconstruction and good seed breeding, and the efficiency and standardization of Macrobrachium rosenbergii species management and precision breeding are improved.

The application provides application of a CNN2-B probe in specific identification of an atherosclerotic plaque, and relates to the technical field of fluorescent probes. ‑ The structural formula of the CNN2-B probe is as follows: the CNN2-B probe is an ONOO ‑ / lipid double response type probe, which has very weak fluorescence in the case of existing alone, can only make fluorescence sharply increase in the case of existing of lipid and ONOO ‑ , and has lipid droplet positioning function. The probe can be used in specific identification of an atherosclerotic plaque, so that the position of the atherosclerotic plaque can be more accurately judged.

The invention belongs to the field of biotechnology detection, and discloses a fluorescent quantitative PCR (polymerase chain reaction) primer probe composition for pseudorasbora parva and application. A specific upstream primer, a specific downstream primer and a TaqMan probe are designed according to a COI gene sequence in a mitochondrial DNA sequence of the pseudorasbora parva, the primer is obtained through comparison and screening, the primer has the characteristic of high specificity, the fluorescent quantitative PCR method established based on the primer can efficiently, accurately and specifically identify the pseudorasbora parva through genome DNA, the influence of subjective factors is eliminated, and the primer is high in sensitivity and high in specificity. The repeatability is good; and the method can be used for quantitatively analyzing the eDNA of the pseudorasbora parva, so that the pseudorasbora parva can be efficiently, accurately and specifically identified without damaging the pseudorasbora parva, and technical support can be provided for monitoring, protecting and managing population resources of the pseudorasbora parva which are specifically distributed in narrow areas in China.

The invention relates to a Chinese cattle multi-variety identification SNP (Single Nucleotide Polymorphism) marker combination and a liquid phase chip technology. According to the present invention, the genetic characteristics of the five Chinese cattle varieties and the 38 varieties of the six districts are deeply analyzed, the specific identification sites are screened, the unique gene identification of each variety can be accurately identified, the liquid phase chip is further developed, and the chip has characteristics of rich functional sites, good pertinence and good accuracy, can be used for variety identification and specific character identification, and can be used for identifying the variety and the specific character. Low-cost and high-throughput detection is realized, and powerful support is provided for identification, protection and development of Chinese cattle varieties.

The utility model relates to the technical field of isothermal amplification detection, in particular to a centrifugal tube adaptive to specific recognition based on colors, which comprises a first cover body, a first tube body, a second tube body and a third tube body which are sequentially arranged from top to bottom, the outer wall of the second pipe body is further sleeved with a second cover body. The first cover body is connected with the first pipe body; the first cover body is in threaded connection with the second pipe body; the second cover body is in threaded connection with the third pipe body; two discharge holes which are communicated with the two cavities in the first pipe body are formed in the side wall of the first pipe body at different heights; and the height of each discharge hole is matched with the height of the third pipe body and the threaded connection height of the first cover body and the second pipe body. The device is simple in structure and low in cost; the reaction substrate can be added without opening a cover, so that the leakage risk is avoided, and the waste of adding tools can be reduced.

This invention discloses a norfloxacin nucleic acid aptamer OUC-NOR7-2T and its application, belonging to the field of nucleic acid aptamer technology. The nucleotide sequence of the norfloxacin nucleic acid aptamer OUC-NOR7-2T is shown in SEQ ID NO.10. The application of the norfloxacin nucleic acid aptamer OUC-NOR7-2T in the identification or detection of norfloxacin is also discussed. The norfloxacin nucleic acid aptamer OUC-NOR7-2T of this invention was obtained through screening, exhibiting an affinity dissociation constant of 70.9 nM with norfloxacin. It shows no significant affinity for structural analogs of norfloxacin such as enrofloxacin, ciprofloxacin, ofloxacin, lomefloxacin, and pefloxacin, and can be used for the specific identification or detection of norfloxacin.

The invention belongs to the technical field of biological detection, and relates to a probe primer combination for detecting AdV wild type virus residues and a method and application thereof. According to the invention, two sets of primer probe combinations respectively targeting wild type adenovirus E1A-CR2 and E3 regions are designed, and dPCR is utilized to realize dual-target synchronous detection and signal distinguishing. By calculating the concentrations of linkages of two targets on the same DNA chain, false positive results caused by host cell DNA residues, incomplete E3 region knockout or single region non-specific amplification can be effectively eliminated, so that the specific recognition of the wild type adenovirus is realized. The method is convenient and rapid, can complete detection of AdV wild virus residues in a short time, and does not need expensive instruments and equipment; compared with a PCR (Polymerase Chain Reaction) method (about 1 / 107), the method has the advantages that the sensitivity is improved by 2 orders of magnitude, and the sensitivity can be improved to 0.5 / 109 or above.

The application discloses a pig SLPI monoclonal antibody and application thereof, and belongs to the field of biotechnology and cell engineering. The application immunizes mice with a His-SLPI recombinant protein, and carries out cell fusion when the serum titer reaches 1:10000 or above. On the seventh day of the fusion, indirect ELISA is carried out on cell supernatant, and positive wells with higher OD values are screened out. The purified recombinant GST-SLPI protein is used as a coating antigen, the wells are expanded and cultured, and the cells are made into single cells in single wells by using an effective dilution method. After continuous screening to obtain 100% positive wells, the supernatant of the positive cells is used for specific identification of the pig-derived SLPI protein by Western blot and IFA. One hybridoma strain B with a higher binding titer is obtained by identification, the heavy chain amino acid sequence of the SLPI monoclonal antibody produced by the hybridoma strain B is shown as SEQ ID NO. 1, and the light chain amino acid sequence is shown as SEQ ID NO. 2.

The application discloses a probe primer group, a kit and a detection method for detecting European dodder, wherein the probe primer group comprises an upstream primer Ce-rbcL-F, a downstream primer Ce-rbcL-R and a TaqMan probe Ce-rbcL-P; the nucleotide sequence of the upstream primer Ce-rbcL-F is shown as SEQ ID NO. 1; the nucleotide sequence of the downstream primer Ce-rbcL-R is shown as SEQ ID NO. 2; and the nucleotide sequence of the TaqMan probe Ce-rbcL-P is shown as SEQ ID NO. 3. The primer probe group is designed based on a specific region of the rbcL gene of European dodder, and specific identification of European dodder can be realized by combining an optimized real-time fluorescent PCR reaction system and conditions, namely, the application has the characteristics of rapidness, strong specificity, high identification accuracy, effectively solves the problem that near relatives are difficult to distinguish in traditional morphological identification, and avoids false positive misjudgment. Compared with traditional morphological identification and conventional PCR, the application also has the characteristics of high detection efficiency, short time consumption, simple operation and wide applicability, and can be applied to not only professional laboratory accurate identification, but also practical application of scenarios such as primary quarantine and field monitoring.

This invention discloses a triphenylamino Schiff base Hg 2+ The fluorescent probe is a triphenylamino Schiff base compound obtained by condensation reaction of 4-(diphenylamino)-2-hydroxybenzaldehyde and 2-aminophenol, and its chemical structure is shown in formula (I). The fluorescent probe of this invention exhibits Hg activity in DMSO:PBS (v / v = 1:1) solution. 2+ It has specific identification capabilities, high sensitivity, and strong anti-interference ability, with a detection limit as low as 0.23 μM; this invention provides a simple and rapid method for detecting Hg. 2+ Fluorescent probes have broad application prospects in the environmental and biological fields.

The invention provides a large language model training data set traceability marking method, relates to the field of model data security, and solves the problem that after a large language model training data set is stolen, it is difficult to traceably prove the original attribution of the data set. The method comprises the following steps: constructing specific identification data content, and on the basis of maintaining that an original training data set has positive influence on model training, mixing the specific identification data content into the original training data set to obtain an identification training data set; carrying out information digest algorithm processing on the identification training data set to obtain identification information, carrying out associated storage on the identification information, and publicizing the identification information in a preset range; obtaining a to-be-traced and checked large language model and publicized identification information, using the identification information as the input of the large language model, verifying the output of the large language model, and realizing the traceability of the original training data set; the intellectual property of the training data set can be effectively protected, and the safety and credibility of the training data set are improved.

The invention discloses a nucleic acid molecular probe, a system and a screening method for specifically recognizing AE echinococcosis people, and relates to the technical field of molecular probes, the nucleic acid molecular probe comprises a nucleic acid molecular probe, and the nucleotide sequence shown by the nucleic acid molecular probe is SEQ ID No.1: CGGGAAGGGTGAGTGGAGAGGTAGTAGTCAGTTGCGCGTCCCGCTAAGG. The application has the effect of realizing efficient specific recognition so as to achieve the purpose of rapidly detecting AE echinococcosis.

This invention provides Indel molecular marker primers for identifying the petiole color of non-heading Chinese cabbage, including an upstream primer qPCDF3-1F and a downstream primer qPCDF3-1R; wherein the sequence of the upstream primer qPCDF3-1F is CCTTATTATTAACGTAGCCACACT; and the sequence of the downstream primer qPCDF3-1R is ATGGGTCCGATTATCCCACG. This invention also provides the application of the above primers in identifying the petiole color of non-heading Chinese cabbage and a specific identification method. The advantages of this invention are: by designing specific Indel molecular marker primers and combining PCR amplification with electrophoresis detection, rapid and accurate identification of the petiole color of non-heading Chinese cabbage at the seedling stage can be achieved, filling the gap in relevant molecular markers in the prior art and improving the breeding screening efficiency of the petiole color trait in non-heading Chinese cabbage.

This invention discloses a goat SNP molecular marker combinatorial system, its preparation of a whole-genome liquid-phase microarray, and its applications. The goat SNP molecular marker combinatorial system comprises 50,508 SNP molecular markers, the physical locations of which are determined by sequence alignment based on the goat reference genome ARS1. The goat SNP molecular marker combinatorial system of this invention can be used for specific identification of goat breeds. Its application in preparing a goat whole-genome liquid-phase microarray allows for low-cost and large-scale genotyping of goats. Based on the principle of liquid-phase microarrays, the loci are flexible, and new functional marker loci can be added at any time. This invention provides a goat whole-genome liquid-phase microarray that can be used for goat whole-genome selection breeding, genome-wide association analysis, phylogenetic analysis, and germplasm resource mining and utilization. It provides an important tool for goat germplasm resource genotyping and molecular breeding, playing a significant role in related research.

The application discloses a bimodal sensor and a preparation method and application thereof. The bimodal sensor comprises functionalized nano-gold, which comprises nano-gold; the surface of the nano-gold is decorated with 4-mercaptobenzoic acid and thymine; and the thymine is decorated by cysteamine. The functionalized nano-gold can realize specific identification of mercury ions in substrates such as food and medicine, and then realize bimodal detection result output of colorimetry / surface enhanced Raman spectroscopy, so as to achieve the purpose of self-correction detection, improve the selectivity, accuracy and efficiency of detection, and can be applied to the detection of mercury ions in natural environment, food, medicine and cosmetics.

The invention discloses a giant magnetoresistive sensor combined with a micro-fluidic technology and a manufacturing method and application thereof, and belongs to the cross technical field of sensor technologies, micro-fluidic technologies and marine organism detection. Introduction, reaction and washing separation of a seawater sample are realized through a microfluidic channel, functional magnetic nanoparticles are introduced to carry out magnetic labeling and magnetic enrichment on target marine microorganisms, and a giant magnetoresistance chip array is used for carrying out high-sensitivity electrical detection on magnetic signals. The rapid, sensitive and specific recognition on marine bacteria, microalgae, fungi and viruses is realized. The method has the advantages of being high in seawater matrix interference resistance, high in sensitivity, small in sample dosage, capable of achieving multi-target parallel detection, suitable for on-site deployment and the like, and is suitable for the fields of marine ecological monitoring, harmful algal bloom early warning, mariculture disease monitoring, marine environment safety early warning and the like.