Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for distinguishing clade 7.2 type H5 AIV (H5 Subtype Avian Influenza Virus) from clade 2.3.4.4 type H5 AIV

A technology of real-time fluorescence quantification and primer sequence, which is applied in the field of animal epidemiology to achieve the effect of simple identification method, high efficiency and accuracy

Active Publication Date: 2017-05-31
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since the nucleotide homology rate of the HA gene sequence between clade7.2 and clade2.3.4.4 is as high as 89.7%, it is difficult to identify by conventional molecular biology methods (such as conventional RT-PCR method)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for distinguishing clade 7.2 type H5 AIV (H5 Subtype Avian Influenza Virus) from clade 2.3.4.4 type H5 AIV
  • Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for distinguishing clade 7.2 type H5 AIV (H5 Subtype Avian Influenza Virus) from clade 2.3.4.4 type H5 AIV
  • Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for distinguishing clade 7.2 type H5 AIV (H5 Subtype Avian Influenza Virus) from clade 2.3.4.4 type H5 AIV

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Virus strains:

[0037] H5 subtype influenza virus clade 7.2 branch (DK7 strain) and clade 2.3.4.4 branch (DK10 strain) were both preserved by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0038] 2. Primer design and synthesis

[0039] The primers F1 and R1 of the real-time fluorescent quantitative PCR reaction were designed according to the characteristic difference region of the hemagglutinin gene HA nucleotides of clade 7.2 and clade 2.3.4.4 H5 AIV, wherein the sequences of the F1 and R1 primers were:

[0040] Upstream primer F1: 5'- TCCGACTACAGCTTAGGGAT -3',

[0041] Downstream primer R1: 5'- ACACTTTCCATACATTCATTATC -3'.

[0042] 3. Viral RNA extraction and RT-PCR amplification:

[0043] Viral RNAs of H5 subtype influenza virus clade 7.2 (strain DK7) and clade 2.3.4.4 (strain DK10) were extracted by conventional methods. Using specific primers (H5-HAF: 5'-TGGTTACCATGCAAACAAC-3' and H5-HAR: 5'- TTACACTTTC...

Embodiment 2

[0054] Real-time fluorescent quantitative PCR detection was carried out on 69 dead duck disease materials submitted for clinical inspection, and it was found that 2 strains were positive for clade 7.2H5 AIV infection, and the positive rate was 2.89% (2 / 69); clade 2.3.4.4 H5 AIV Three strains were positive for infection, and the positive rate was 4.34% (3 / 69); co-infection of clade 7.2 and clade 2.3.4.4H5 AIV was not detected in 69 dead ducks submitted for clinical inspection.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a group of real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for distinguishing a clade 7.2 type H5 AIV (H5 Subtype Avian Influenza Virus) from a clade 2.3.4.4 type H5 AIV, and the real-time fluorescent quantitative PCR primers are designed by utilizing GC content difference existing in characteristic nucleotide sequences of HA (Hemagglutin) genes of the clade 7.2 type H5 AIV and the clade 2.3.4.4 type H5 AIV. The clade 7.2 type H5 AIV and the clade 2.3.4.4 type H5 AIV are effectively distinguished by utilizing the phenomena that both the real-time fluorescent quantitative PCR primers can be effectively amplified when real-time fluorescent quantitative PCR is carried out on the clade 7.2 type H5 AIV and the clade 2.3.4.4 type H5 AIV, but the real-time fluorescent quantitative PCR primers have melting temperature (Tm value) difference existing in melting curves generated after the real-time fluorescent quantitative PCR is carried out on the clade 7.2 type H5 AIV and the clade 2.3.4.4 type H5 AIV. By matching with a computer which is connected with a real-time fluorescent quantitative PCR instrument and utilizing analysis software of the real-time fluorescent quantitative PCR instrument, specific identification and diagnosis on infection situations of the clade 7.2 type H5 AIV and the clade 2.3.4.4 type H5 AIV can be achieved by just one group of primers. According to the real-time fluorescent quantitative PCR primers provided by the invention, an identification method is simple, and the efficiency and an accuracy rate are higher.

Description

technical field [0001] The invention belongs to the field of animal epidemiology, and in particular relates to a group of real-time fluorescent quantitative PCR primers for distinguishing clade 7.2 and clade 2.3.4.4H5 AIV. Background technique [0002] Avian influenza (AI) is an acute, highly contagious infectious disease caused by type A influenza virus that mainly affects poultry and wild birds. Infection caused by highly pathogenic H5 subtype avian influenza virus (H5 AIV) is currently listed as an animal infectious disease that must be reported by the World Organization for Animal Health (OIE), and is listed as a first-class animal disease in my country. [0003] The earliest records about influenza can be traced back to a report from Italy in 1878, followed by outbreaks and epidemics of influenza in various parts of the world. In 1996, the first H5N1 subtype HPAIV (A / Goose / Guangdong / 1 / 96 (H5N1), GS / GD / 96) was isolated in my country, followed by the H5N1 subtype avian i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/6851C12Q1/701C12Q2531/113C12Q2563/107C12Q2545/113
Inventor施少华万春和陈珍黄瑜程龙飞傅光华陈红梅傅秋玲刘荣昌陈翠腾
OwnerINST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI