Sugarcane genome endogenous reference gene acetolactate synthase gene PCR (polymerase chain reaction) primer sequences and amplification method
A technology of acetolactate synthase and internal standard gene, applied in recombinant DNA technology, DNA/RNA fragments, DNA preparation, etc., can solve the problem of no research report on copy number, and achieve easy determination, strong specificity, and wide applicability. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] (1) PCR amplification of the internal standard gene acetolactate synthase gene in the sugarcane genome
[0023] Acetolactate synthase gene PCR primer sequence is: ScALS-F : CTCCCAGTGAAGGTCTTTGCG; ScALS-R : TGCTGGAATGTTGAACCCTTTT.
[0024] PCR reaction system: 1.0 U Taq DNA polymerase, 1×PCR buffer solution, 0.25 mM dNTP, 3.0 mM MgCl2, primers ScALS-F and ScALS-R Each 0.25 mM, DNA template 25 ng, the total volume of the reaction system is 25??l;
[0025] PCR amplification conditions: pre-denaturation at 95°C for 6 min; denaturation at 94°C for 30 s; annealing at 65°C for 30 s, extension at 72°C for 35 s, a total of 35 cycles, and a final extension at 72°C for 6 min.
[0026] (2) Electrophoresis detection of PCR product of sugarcane acetolactate synthase gene and analysis of product specificity and generality
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 