GS (glutamine synthetase) gene specific identification crRNA and application thereof

A specific and genetic technology, applied in DNA/RNA fragments, application, genetic engineering, etc., can solve problems such as low efficiency and complicated knockout process, and achieve high transfection efficiency, reduced number of clones, and improved efficiency

Active Publication Date: 2016-09-21
苏州晟济药业有限公司
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This patent can only knock out the sixth exon of the GS gene, which is inefficient and complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GS (glutamine synthetase) gene specific identification crRNA and application thereof
  • GS (glutamine synthetase) gene specific identification crRNA and application thereof
  • GS (glutamine synthetase) gene specific identification crRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Construction of CRISPR-Cas9 expression system for GS gene

[0065] The GS gene of Chinese hamster ovary cells contains 7 exons, of which exons 2-7 code for the expression of GS protein ( figure 1 ), which play a vital role in normal function. The crRNA sequences were designed for exons 2-7 of the GS gene. Using these crRNA sequences and Cas9 protein can render the expressed GS protein non-functional. The partial sequence of exons 2-7 of GS is as follows (exons are marked with an underline "_____"):

[0066] SEQ ID NO.17:

[0067] TGCCTCTTACGCAATTCCTGCAGGGGACCCCCTTCAGAGTAGATGTTAATGAAATGACTTTTGTCTCTCCAGAGCACCTTCCACC ATGGCCACCTCA GCAAGTTCCCACTTGAACAAAAACATCAAGCAAATGTACTTGTGCCTGCC CCAGGGTGAGAAAGTCCAAGCCATGTATATCTGGGTTGATGGTACTGGAG AAGGACTGCGCTGCAAAACCCGCACCCTGGACTGTGAGCCCAAGTGTGTA GAAG GTGAGCATGGGCAGGAGCAGGACATGTGCCTGGAAGTGGGCAAGCAGCCTGAGATTTGACCTTCCTTCTGTTTTGTTTGCAAAGTCTTTCAAAAGCAGGTCTCTTCAGGCCTCAGTCAGTCACCCGTAAGCTGCCGAGTAGTCTGGAGG

[0068] SEQ ID ...

Embodiment 2

[0081] Example 2: Knockout and verification of GS gene in CHO-K1 cells

[0082] The designed crRNA and Cas9 protein expression vectors were transfected into CHO-K1 cells acclimated by CD medium, and a total of 16 kinds of transfection or transfection combinations from A to P were designed.

[0083]CHO-K1 cells were purchased from ATCC, and the cells were cultured using DMEM / F12 basal medium, supplemented with 5% fetal bovine serum. The expanded CHO-K1 cells were cultured in suspension in CD CHO medium, supplemented with glutamine and HT additives.

[0084] After the cells were adapted to suspension culture, the crRNA and Cas9 protein expression vectors were transfected into the cells. After 48 hours of transfection, Puromycin was added to the cell culture medium, and after 4 days of culture, the surviving cells were selected for subcloning culture. After the subcloned cells grew out, the cells were transferred to medium containing L-Gln and medium without L-Gln for culture. ...

Embodiment 3

[0090] Example 3: GS gene-deficient cell expression antibody experiment

[0091] Antibody expression transfection experiments were performed on the selected GS KO1 and GS KO2 cells, and wild-type CHO-K1 cells were used as control hosts. KJ015 was transfected into GS KO1, GS KO2, and CHO-K1 cells by exactly the same method. 48 hr after transfection, 25 μM MSX was added as selection pressure. After 2 weeks of static culture, clones grew out, and the number of grown clones and the 25 clones with the highest antibody expression in 24 hours were compared, and the results are shown in Table 3. The differences in the number of clones grown among the three were small, and the expression levels of GS KO1 and GS KO2 host clones were significantly higher.

[0092] table 3

[0093]

[0094]

[0095] Cells with better expression levels were amplified and cultured, and expression products were collected, and the quality of expressed antibodies was analyzed using IEC as a key qualit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of cell and gene engineering, genetic modification and therapeutic recombinant protein industrial production, and particularly relates to GS (glutamine synthetase) gene specific identification crRNA and application thereof. DNA (deoxyribonucleic acid) sequences identified by the GS gene specific identification crRNA are selectively DNA sequences shown as one of sequences SEQ ID NO.1-SEQ ID NO.8. The GS gene specific identification crRNA and the application have the advantages that GS genes of diversified cells can be specifically identified by the GS gene specific identification crRNA, the GS gene specific identification crRNA is wide in applicability, and integral procedures can be implemented easily and efficiently; the target protein expression quantities of cells without the GS genes can be greatly increased on the basis of imported exogenous carriers as compared with wild host cells, and accordingly required-to-be-inputted labor, material resources and financial resources for screening protein expression cell strains can be reduced; the GS genes are knocked out, and accordingly the industrial production cost can be reduced; the cells without the GS are used as host target gene expression cells, other chemical substances can be omitted in procedures for producing the cells, and accordingly the production safety can be improved.

Description

technical field [0001] The invention belongs to the field of cell genetic engineering, genetic modification and industrialized production of therapeutic recombinant protein, and specifically relates to crRNA specifically recognizing GS gene and its application. Background technique [0002] Mammalian cells are currently the main tool for the production of complex protein drugs for therapeutic use, and Chinese Hamster Ovary Cells (CHO) are the most commonly used host cells, and have been widely used in industrial production. In the CHO cell-based protein expression system, dihydrofolate dehydrogenase (Dihydrofolate Reductase, DHFR) and glutamine synthetase (Glutamine Synthetase, GS) are the two most commonly used selection genes. Among them, the GS system is gradually becoming the most widely used expression screening system because of its ease of use and stability. GS is a key enzyme (critical enzyme) in the L-glutamine synthesis pathway, and its absence will cause the cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/12
CPCC12N15/113C12N15/85C12N2015/8518C12N2800/107C12N2810/85
Inventor徐云霞王征
Owner苏州晟济药业有限公司