65 results about "Dihydrofolate reductase" patented technology

The present invention provides tricyclic compounds having cytostatic and cytotoxic activity in a single molecule having receptor tyrosine kinase(s), dihydrofolate reductase, thymidylate synthase and/or dihydroorotate dehydrogenase inhibitory activity, which are useful as anti-angiogenic and anti-tumor agents. Also provided are methods of utilizing these inhibitors to treat tumor cells and other proliferative diseases and disorders.

The invention relates to application of DNA (Deoxyribonucleic Acid)-PKcs in preparation of a medicine for influencing dihydrofolate reductase (DHFR) gene amplification and changing the drug resistance of tumor cells on MTX (Methotrexate) and belongs to biological medicines. The application comprises the following steps: establishing an MTX drug-resistant cell evolution model, selecting low-concentration drug-resistant (HSRs) and high-concentration drug-resistant (DMs) cells as research objects, detecting the gene amplification degree and form in the parent cells and drug-resistant cells, the DNA damage conditions and DNA-PKcs expression conditions, establishing clone which stably interferes the DNA-PKcs in the MTX drug-resistant cells aiming at the core protein DNA-PKcs in the NHEJ path, and detecting the amplification degree and form of DHFR genes in stable interference clone, the cell growth and apoptosis and change of the drug resistance.

Recombinant lentiviral vectors having a region encoding a functional β-globin gene; and large portions of the β-globin locus control regions which include DNase I hypersensitive sites HS2, HS3 and HS4 provides expression of β-globin when introduced into a mammal, for example a human, in vivo. Optionally, the vector further includes a region encoding a dihydrofolate reductase. The vector may be used in treatment of hemoglobinopathies, including β-thalessemia and sickle-cell disease. For example, hematopoietic progenitor or stem cells may be transformed ex vivo and then restored to the patient. Selection processes may be used to increase the percentage of transformed cells in the returned population. For example, a selection marker which makes transformed cells more drug resistant than un-transformed cells allows selection by treatment of the cells with the corresponding drug.

The present invention relates to a novel gene expression system comprising: a) a first nucleotide sequence encoding a fusion polypeptide of: a1) a destabilizing domain (DD) based on DHFR, and a2) a GTPcyclohydrolase 1 (GCH1) polypeptide, or a biologically active fragment or variant thereof; and b) a second nucleotide sequence encoding a tyrosine hydroxylase (TH) polypeptide, or a biologically active fragment or variant thereof. The invention also relates to use of this gene expression system together with a ligand binding to a destabilizing domain (DD) based on dihydrofolate reductase (DHFR) for treatment of diseases associated with a reduced dopamine level, such as Parkinson's disease.

The invention relates to an acetamides compound and application thereof, and discloses an N-(4-substituted phenyl ethyl) amides compound with a novel structure. An in vitro activity test experiment proves that the compound has the enzyme inhibitory activity on cysteine proteinase (FP-2) and dihydrofolate reductase (DHFR); a malaria-killing experiment result proves that the compound has an inhibition effect on wild and drug-resistant malaria protozoon.

The present invention relates to novel compounds that are inhibitors of wild type and mutant dihydrofolate reductase (DHFR) of Plasmodium falciparum, which are useful for the treatment of malaria. It also relates to processes of making and using such compounds. The antimalarial compounds of the present invention have low toxicity to a host infected with the malarial parasite, and are potent when administered in pharmaceutical compositions.

Antisense oligomers directed to bacterial cell division and cell cycle-encoding nucleic acids are capable of selectively modulating the biological activity thereof, and are useful in treatment and prevention of bacterial infection. The antisense oligomers are substantially uncharged, and contain from 8 to 40 nucleotide subunits, including a targeting nucleic acid sequence at least 10 nucleotides in length which is effective to hybridize to (i) a bacterial tRNA or (ii) a target sequence, containing a translational start codon, within a bacterial nucleic acid which encodes a protein associated with cell division or the cell cycle. Such proteins include zipA, sulA, secA, dicA, dicB, diCc, dicF, ftsA, ftsl,ftsN, ftsK, ftsL, ftsQ, ftsw, ftsZ, murC, murD, murE, murF, murg, minC, minD, minE, mraY, mraW, mraZ, seqA, ddlB, carbamate kinase, D-ala D-ala ligase, topoisomerase, alkyl hydroperoxide reductase, thioredoxin reductase, dihydrofolate reductase, and cell wall enzyme.

Sol-gel derived monolithic silica columns containing entrapped dihydrofolate reductase were used for frontal affinity chromatography of small molecule mixtures. The output from the column combined with a second stream containing the matrix molecule (HCCA) and was directly deposited onto a conventional MALDI plate that moved relative to the column via a computer controlled x-y stage, creating a semi-permanent record of the FAC run. The use of MALDI MS allowed for a decoupling of the FAC and MS methods allowing significantly higher ionic strength buffers to be used for FAC studies, which allowed for better retention of protein activity over multiple runs.

The invention relates to a Chinese hamster ovary (CHO) cell line capable of showing Rta albumen of Elzatein-Barn (EB) virus stably and efficiently, a creation method and application thereof and a cell base built by the CHO cell line, and belongs to the technical field of biology. Preservation number of the recombination cell line CHO/RTA is CGMCC6955, the CHO cell base expressing the Rta albumen of the EB virus can be used for practical production and formed by the recombination cell line CHO/RTA. The invention further provides a method for creating the CHO cell line. Dihydrofolate reductase defect type Chinese hamster ovary cells (CHO/dhfr-) serve as host cells, and the cell line capable of expressing the Rta albumen of the EB virus stably and efficiently is obtained after screening and amplification of the host cells.

The invention relates to a preparation method and pharmacological application of novel 3-methoxy-4-(N-substituted amino sulfonyl)fenalamide derivatives. The structural general formula of the derivatives is shown in a formula (I), wherein R1 and R2 are defined as the specifications. The compounds can serve as small molecular double inhibitors for Falcipain-2 and dihydrofolate reductase (DHFR), simultaneously blocks hemoglobin hydrolysis under the action of cysteine protease and inhibits the reduction activity of the DHFR, so as to inhibit multiplication of plasmodium. Therefore, the compounds can be expected to be developed into double-target-based novel antimalarial medicines.

The present invention relates to a method for assessing the sensitivity of a patient's cancer to treatment with 10-propargyl-10-deazaaminopterin and a method for selecting a patient for treatment of cancer with 10-propargyl-10-deazaaminopterin, by determining the amount of a selected polypeptide expressed by the cancer and comparing the amount with the amount of the selected polypeptide expressed by a reference cancer, wherein the polypeptide includes a member of folate pathways within cells and may include at least one of reduced folate carrier-1 enzyme (RFC-1), dihydrofolate reductase (DHFR), folylpoly-gamma-glutamate synthetase (FPGS), thymidylate synthase (TS), γ-glutamyl hydrolase (GGH), and glycinamide ribonucleotide formyltransferase (GARFT). The present invention also relates to the use of 10-propargyl-10-deazaaminopterin in the treatment of multiple myeloma.

The present invention relates to a recombinant expression vector for an animal cell containing a dihydrofolate reductase (DHFR) coding nucleotide sequence operatively linked to a DHFR promoter, to an animal cell line transformed by the vector, and to a method for preparing a target protein using the same. As compared with existing animal cell expression vectors, the vector of the present invention enables an effective screening of a cell line clone in which foreign genes are amplified together with DHFR genes even at a much lower methotrexate concentration. The present invention exhibits excellent effects in cell line preparation as high-productivity cell lines can be ensured in a short time through the use of a lower concentration of methotrexate in the process of protein production cell line establishment.

The invention discloses a raltitrexed related substance C with inhibition activity on dihydrofolate reductase and methionine synthetase, a preparation method and application thereof as an impurity control group.

The invention discloses a C829T single nucleotide polymorphism assay kit of DHFR (dihydrofolate reductase). The kit comprises a red blood cell lysate, a DNA extracting solution, a PCR (Polymerase Chain Reaction) reagent, a single-chain purification reagent and a sequencing reagent, and is characterized in that the PCR reagent comprises specific augmentation primers SEQNO.1 and SEQNO.2, whose sequences are respectively ACTAAGTGCTTCTCCAAGACC and Biotin-AATGTCAAGGACTGGCAAGAG; and the sequencing reagent comprises a specific sequencing primer SEQNO.3 whose sequence is AGTCCCCAGCACCTG.

The invention provides a vector capable of being used for expressing a foreign gene. The vector is used for tightly connecting expression of a target gene with expression of hygromycin B phosphotransferase of a screening gene. According to the vector, a technology of avianizing the expression of an amplified gene enzyme dihydrofolate reductase (DHFR) for increasing the MTX (methotrexate) screening efficiency and reducing the MTX use concentration is adopted. The invention provides a screening method for obtaining high-level expression cloning after a cell is transfected by an expression vector optimized by adopting the technology.