69 results about "Eb virus" patented technology

The invention relates to a detection kit for epithelial-mesenchymal transition in EB virus infected thymoma and application, the detection kit comprises a quantum dot labeled antibody E-Cadherin and a quantum dot labeled antibody Vimentin, a quantum dot is coupled with a specific antibody, a thymoma paraffin section sample is dyed through the quantum dot and the specific antibody conjugate, and the EB virus infected thymoma is obtained. The conjugate can be specifically connected with an EMT related antigen expressed in the slice, so that the quantum dots can be used for qualitative or quantitative detection of the EMT-generated thymoma cells. The quantum dots are used for replacing fluorescent dye, direct marking of tissue slices can be achieved, local positioning of epithelial cells and mesenchymal tissues in the thymoma microenvironment is achieved, number detection and position detection can be achieved, and EMT condition evaluation is facilitated.

The invention belongs to the technical field of antibodies, and discloses a monoclonal antibody for recognizing EB (Epstein-Barr) virus gp350 protein and application of the monoclonal antibody. The invention provides an anti-EB virus gp350 protein monoclonal antibody or an antigen binding fragment thereof, the anti-EB virus gp350 protein monoclonal antibody comprises 1A12 and 2E4, the 1A12 has high affinity for the gp350 protein (KD (M) = 3.415 E-10), the 2E4 has high affinity for the gp350 protein (KD (M) = 4.851 E-9), the two monoclonal antibodies or the antigen binding fragments thereof can significantly inhibit infection of EBV on epithelial cells and B cells, and the anti-EB virus gp350 protein monoclonal antibody or the antigen binding fragment thereof can be used for preparing anti-EB virus gp350 protein anti-EB virus gp350 protein anti-EB virus gp350 protein anti-EB virus gp350 protein anti-EB virus gp350 protein anti-EB virus. The kit can be used for detecting the existence or level of the gp350 protein in a sample, detecting EB virus, diagnosing diseases caused by EB virus infection, preventing EB virus infection and / or treating and / or preventing diseases caused by EB virus infection.

The invention discloses an anti-tumor molecular preparation of targeted ceramide kinase and application of the anti-tumor molecular preparation, and relates to the technical field of biology, the molecular preparation is a microRNA micromolecule EBV-miR-BART17-5p derived from EB virus coding, and the molecular preparation is applied to targeted down-regulation of expression of ceramide kinase genes and inhibition of activation of PI3K / AKT / NF-kappa B signal channels. The nucleotide sequence of the EBV-miR-BART17-5p simulant is UAAGAGGACGCAGGCAUACAAG, the nucleotide sequence of the EBV-miR-BART17-5p simulant The nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA, and the nucleotide sequence of the inhibitor is CUUGUAUGCCUGCGUCCUUUA. The compound is used for inhibiting proliferation, migration and invasion of gastric cancer cells and is further applied to preparation of drugs for treating gastric cancer.

The invention belongs to the technical field of biological genetic engineering, and particularly relates to a mouse model construction scheme capable of reproducing a key phenotype of hemophagocytic syndrome, which comprises the following steps: inserting a loxP-STOP-loxP-LMP1 conditional expression cassette into a Rosa26 safe port site in a fixed point manner to obtain an Lmp1cKI mouse strain; and hybridizing the mouse with an Ncr1-Cre transgenic mouse of NK cell specific expression Cre recombinase. In a double transgenic offspring (Lmp1Ncr1-Cre), STOP fragments are cut off by Cre enzyme, and continuous high expression of EB virus LMP1 protein in NK cells is driven. The model does not need chemical induction or immune intervention, and typical hemophagocytic syndrome phenotypes, namely serum IL-6, TNF-alpha and IFN-gamma, spontaneously appear within 7-9 days after young rats are born; the body weight is reduced and the survival rate is obviously reduced; the proportion of lymphocytes is sharply reduced; and NK cells are depleted. The invention provides a stable and reliable tool for hemophagocytic syndrome pathogenesis research, drug screening and treatment evaluation.

The present invention discloses a monoclonal nano antibody for recognizing Epstein-Barr virus gp42 protein, its application and monoclonal nano antibody library, and relates to the technical field of phage display of nano antibodies. The monoclonal nano antibodies EBV-gp42-1023, EBV-gp42-1024 or EBV-gp42-1025 provided by the present invention, and related biomaterials, pharmaceutical compositions or detection products, have very high affinity and specificity for Epstein-Barr virus gp42 protein, and can be widely used in detecting the expression of Epstein-Barr virus gp42 protein, or detecting the occurrence and development process of Epstein-Barr virus-induced tumors, or evaluating the efficacy of drugs for treating Epstein-Barr virus-induced tumors, or treating Epstein-Barr virus-induced tumors.

The invention provides an organ transplantation susceptible virus nucleic acid detection primer probe composition and a kit, and belongs to the technical field of biological detection. The primer probe composition comprises an upstream primer, a downstream primer and a fluorescent probe sequence, wherein the upstream primer and the downstream primer are designed for human cytomegalovirus, JC virus, BK polyoma virus, EB virus, human herpes virus type 6, human herpes virus type 8, human parvovirus B19, torque teno virus, new coronavirus and hepatitis E virus respectively; an upstream primer, a downstream primer and a fluorescent probe sequence of an internal standard are designed aiming at a human housekeeping gene RNaseP. The kit can effectively distinguish 10 viruses, ensures high accuracy, specificity and sensitivity, can complete detection in a short time to obtain a result, and can be transported and stored at normal temperature.

The invention relates to a novel PfAgo protein-mediated EB (epstein-barr) virus detection system, belongs to the technical field of novel virus detection, and aims to solve the problems that early diagnosis of EB viruses is crucial to control and prevention of IM (infantile malnutrition) diseases, and traditional PCR (polymerase chain reaction) has the advantages of being independent of expensive instruments and inconvenient in result reading. Expression and purification of the PfAgo protein; a PfAgo mediated EB virus detection system; preparing plasmids; evaluating specificity and sensitivity; and processing data. The novel PfAgo protein-mediated detection system established in the invention provides a rapid, reliable and sensitive tool for novel field detection and clinical diagnosis of EB virus.

The invention discloses an EB (Epstein-Barr) virus antigen with chimeric design and application thereof. The EB virus chimeric antigen provided by the invention is reasonably designed on the basis of structural biology, gL, gH and gp42 proteins of the EB virus are connected through a linker, and the chimeric designed antigen stably presents antigen epitopes of the three proteins at the same time, so that the production amplification process and quality control can be simplified while the vaccine immunogenicity is improved. The EB virus chimeric antigen can be used independently or in combination with other antigens, has high immunogenicity when being used as a vaccine or a vaccine component, can induce an immunized animal to generate a high-level neutralizing antibody, can be used for preparing a vaccine for preventing or treating EB virus infection, and can also be used as a reagent for detecting EB virus.

The invention relates to a detection kit for nasopharynx cancer diagnosis and screening, which comprises an immunochromatography detection card, and the immunochromatography detection card comprises a reagent for detecting EB virus antigen and antibody through a colloidal gold labeling method. The invention also relates to application of the detection card and the EB virus antigen-antibody in preparation of a detection kit or a detection card for nasopharynx cancer diagnosis and screening.

Provided are an engineered EB virus nuclear antigen 1 (EBNA1) and a coding molecule thereof, a vector and mammalian cell expression system comprising the EBNA1 and the coding molecule thereof, and a target polypeptide recombined by the aforementioned contents. Also provided are methods of making the engineered EBNA1, and encoding molecules, vectors, and mammalian cell expression systems thereof, and methods of using the same for recombinant expression.

The invention discloses an NbE7 single-domain antibody, an NbE7-TAT fusion single-domain antibody and application of the NbE7 single-domain antibody and the NbE7-TAT fusion single-domain antibody, the NbE7 single-domain antibody is used for being specifically combined with an EB virus nuclear antigen, the NbE7 single-domain antibody is composed of a framework region FR and a complementary determining region CDR, and the complementary determining region CDR comprises a CDR1 shown in SEQ ID NO.1, a CDR2 shown in SEQ ID NO.2 and a CDR3 shown in SEQ ID NO.3. The NbE7 single-domain antibody is used for being specifically combined with an EB virus nuclear antigen. The NbE7-TAT fusion single-domain antibody is a fusion protein of an NbE7 single-domain antibody and a TAT peptide fragment of an HIV-1 virus. The NbE7 single-domain antibody and the NbE7-TAT fusion single-domain antibody provided by the invention provide a new thought for the development of drugs for treating EBV latent infection and EB virus related tumors.

Disclosed in the present invention is a use of an MP1 gene copy number variation detection reagent in preparation of an NK / T cell lymphoma prognosis kit. The present invention further provides a detection kit comprising the LMP1 gene copy number variation detection reagent, a use thereof, and an NK / T cell lymphoma prognosis method. In the present invention, a copy number variation event of LMP1 gene in an EB virus genome is used as a novel prognosis marker, which has a good prediction value for the overall survival and progression-free survival prognosis of an NK / T cell lymphoma patient, and can realize more accurate and effective prognostic assessment for the NK / T cell lymphoma patient.

The invention relates to a primer probe, a kit and a detection method for detecting EB (Epstein-Barr) virus DNA (Deoxyribose Nucleic Acid), and belongs to the technical field of virus detection. The primer probe comprises a forward primer, a reverse primer, a forward primer, a reverse primer and a reverse primer, wherein the forward primer is CTACGCTGCCTAGAGGTTT; the reverse primer is AGACAACCACACACCGCGTC, and the reverse primer is The fluorescent probe is AGGAGACGTGTGGCTGTAGC, the 5'end of the fluorescent probe is marked with a report fluorophore FAM, and the 3 'end of the fluorescent probe is marked with a quenching group NFQ-MGB. The kit comprises the primer probe, and the qPCR detection method of the kit can track and quantitatively detect EB virus DNA in a sample and has the advantages of being high in accuracy, high in specificity, good in repeatability and the like.

The invention provides an application of alkannin in treatment of nasopharyngeal carcinoma infected by EB (Epstein-Barr) virus. A large number of studies find that compared with nasopharyngeal carcinoma cells not infected with EB viruses, alkannin is more sensitive to the nasopharyngeal carcinoma cells infected with the EB viruses, and IC50 is lower. The shikonin can better inhibit the proliferation and migration ability of nasopharyngeal carcinoma cells infected by EB virus, and promote the apoptosis of the nasopharyngeal carcinoma cells. In addition, the in-vivo anti-tumor curative effect of the shikonin on the nasopharyngeal carcinoma cell xenotransplantation tumor model infected by the EB virus is obviously superior to that of the nasopharyngeal carcinoma cell xenotransplantation tumor model not infected by the EB virus. After treatment with alkannin, the tumor growth ability of the nasopharyngeal carcinoma cell xenotransplantation tumor model mouse infected by the EB virus is obviously weaker than that of the nasopharyngeal carcinoma cell xenotransplantation tumor model mouse not infected by the EB virus. In addition, alkannin has no obvious side effect when used for treating nasopharyngeal carcinoma caused by EB virus, and is high in safety.

The present invention discloses a crRNA for detecting Epstein-Barr virus based on microdroplet digital analysis, wherein the crRNA is selected from one or more of the crRNAs shown in nucleotide sequences such as SEQ ID NO: 1 to SEQ ID NO: 11. The quantitative detection kit for Epstein-Barr virus nucleic acid constructed using the crRNA of the present invention does not require a DNA amplification step in the process of detecting Epstein-Barr virus, thus avoiding the result bias and possible contamination risk generated during the amplification process; and the result collection is completed using a fluorescent microscope, which is convenient and fast, and is suitable for rapid detection at the screening site. In addition, the quantitative detection kit for Epstein-Barr virus nucleic acid can achieve absolute quantification of the single-copy Epstein-Barr virus DNA level, without the need for internal reference correction and the establishment of a standard curve, thus avoiding the error caused by the use of different standards, and compared with the traditional qPCR detection method, the screening results have significant advantages.

The invention discloses an EB (Epstein-Barr) virus quantitative method based on polydisperse gel microsphere flow analysis, which comprises the following steps: mixing a sample reagent with an agarose solution to generate polydisperse agarose liquid drops; the agarose liquid drops are placed in an isothermal environment for incubation, nucleic acid amplification is carried out, and polydisperse agarose gel microspheres are obtained; after nucleic acid amplification is completed, the agarose gel microspheres are cooled and solidified, and the agarose gel microspheres are obtained; carrying out demulsification and dyeing treatment on the agarose gel microspheres; performing flow cytometry analysis on the dyed agarose gel microspheres to obtain a forward scattering light signal and a lateral scattering light signal; according to the forward scattering light signal and the lateral scattering light signal, respectively obtaining the volume size and granularity difference of the polydispersed agarose gel microspheres, and combining with a multi-volume nucleic acid calculation formula to obtain an EB virus quantitative result of the sample reagent. The EB virus quantitative method provided by the invention has the advantages of being universal in laboratories, simple and convenient to operate, friendly in resources and the like.

The application belongs to the technical field of antibodies, and discloses a monoclonal antibody Fab5 for recognizing EB virus gB protein and application thereof. The monoclonal antibody or antigen-binding fragment thereof has high affinity to the gB protein and can significantly inhibit the infection of EBV on epithelial cells and B cells, and the epitope of the Fab5 binding to the gB is determined through structural analysis. The antibody can be used for detecting the presence or level of the gB protein in a sample, detecting the EB virus, diagnosing diseases caused by the EB virus infection, preventing the EB virus infection and / or treating and / or preventing diseases caused by the EB virus infection.

The present invention discloses an application of a substance for detecting the methylation levels of EBNA-LP 30069bp, EBNA-3A 53968bp, A73 157064bp, BALF5 15437bp and BNRF1 2422bp sites in the genome of a sample to be tested in the preparation of a product for identifying or assisting in identifying chronic active EB virus infection and infectious mononucleosis. The present invention can detect the methylation levels of the above gene sites by using the detection substance to perform early identification of CAEBV and IM.

The present invention discloses an intelligent virtual staining method and device for Epstein-Barr virus-related tumor pathology slice images, and relates to the field of image intelligent processing technology. The method comprises: obtaining H&E images of in vitro tissue slices of Epstein-Barr virus-positive cells, performing EBER in situ hybridization on the slices after elution and staining, and then scanning them into slice images, performing image registration on the above two images, and obtaining training images after marking Epstein-Barr virus-positive cells; then obtaining images of in vitro tissue slices of Epstein-Barr virus-negative cells as comparison images, and training a virtual staining model that can intelligently distinguish and virtually stain Epstein-Barr virus-positive cells in H&E slice images based on the training images and the comparison images. The present invention can reduce the complexity of the operation process of artificial intelligence processing slice image technology, improve the intelligence level of artificial intelligence processing slice image technology, and replace the biological marker method with intelligent virtual staining, which has great scientific significance, social value and economic benefits.

The invention relates to the technical field of biology, in particular to an anti-EB (Epstein-Barr) virus Rta protein antibody as well as an antigen binding fragment and application thereof. The invention provides an antibody capable of specifically recognizing EB (Epstein-Barr) virus Rta protein or an antigen binding fragment thereof, the antibody or the antigen binding fragment thereof comprises complementary determining regions VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 and VLCDR3, and the amino acid sequences of the complementary determining regions are respectively as follows: GFTFSSSYG, ISSSRYT, ARHLLSGTSSFDC, KSLHSNGNTY, YMS and MQSLEYPFT. The antibody or the antigen binding fragment thereof can be used as a positive control and a calibrator in a nasopharyngeal carcinoma in-vitro diagnostic kit, so that the problem of batch-to-batch difference existing in nasopharyngeal carcinoma positive serum is avoided, and the production cost of the nasopharyngeal carcinoma detection kit is reduced.

The invention discloses an intelligent virtual staining method and device for an EB virus related tumor pathological section image, and relates to the technical field of intelligent image processing, and the method comprises the steps: obtaining the Hamp of an in-vitro tissue section of an EB virus positive cell; e image, performing EBER in-situ hybridization on the section after eluting and dyeing the section, then scanning the section into a section image, performing image registration on the two images, and marking EB virus positive cells to obtain a training image; obtaining an image of an in-vitro tissue slice of the EB virus negative cell as a comparison image, and training an intelligent Hamp according to the training image and the comparison image; and E, distinguishing EB virus positive cells in the slice image, and performing virtual staining by using a virtual staining model. According to the method, the complexity of the operation process of the artificial intelligence slice image processing technology can be reduced, the intelligent degree of the artificial intelligence slice image processing technology is improved, a biological marking method is replaced with intelligent virtual dyeing, and the method has good scientific significance, social value and economic benefits.

The invention relates to a kit for early differential diagnosis of EBV-HLH and a method for auxiliary diagnosis of EBV-HLH. The kit comprises an EBV nucleic acid detection reagent and a miRNA-375 detection reagent. The kit provided by the invention is used for combined detection of EBV-DNA and miRNA-375 in a detection sample, and when an EBV-DNA detection result is greater than 5000 copies / mL and a miRNA-375 detection CT value is less than 35, suspected EBV-HLH is diagnosed. The invention not only provides a specific diagnostic index for EB infected diseases, but also serves as a reliable auxiliary diagnostic tool for EBV-HLH and other EB virus infection related diseases. When the kit provided by the invention is used for identifying and diagnosing EBV-HLH, the sensitivity and the accuracy are higher.

The present application belongs to the field of medicine, and particularly relates to an EBNA1 inhibitor. The small molecule inhibitor recorded in the present application is proved by surface plasmon resonance (SPR) analysis to interact with EBNA1 in vitro and have high affinity, significantly inhibit the function of EBNA1 at the cell level, significantly down-regulate the copy number of the Epstein-Barr virus (EBV) genome of PBMC of a nasopharyngeal carcinoma patient in vitro, have good biological safety in mice, provide a new treatment strategy for patients with EB virus positive tumors, and have far-reaching clinical significance and popularization.

The invention discloses a 5E2-12 monoclonal antibody and application thereof, the 5E2-12 monoclonal antibody is specifically combined with EB virus nuclear antigen and comprises VHCDR1-3 of a heavy chain variable region and VLCDR1-3 of a light chain variable region, the amino acid sequences of VHCDR1, VHCDR2 and VHCDR3 are respectively shown as SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, and the amino acid sequences of VLCDR1, VLCDR2 and VLCDR3 are respectively shown as SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6. The invention further discloses a preparation method of the 5E2-12 monoclonal antibody. The invention also provides an antibody fragment of the 5E2-12 monoclonal antibody. The 5E2-12 monoclonal antibody provides a potential choice for research and development of clinical medicines for diagnosing and treating EBV latent infection and EB virus related tumors.

The invention belongs to the technical field of tumor detection, and particularly relates to a probe composition for nasopharyngeal carcinoma MRD detection, a kit and application, the probe composition for nasopharyngeal carcinoma MRD detection comprises the following probes, the sequences of the probes are SEQ IN NO.1-106; according to the targeted probe capture technology, the probe is designed according to the whole genome sequence of the EB virus, so that all EB virus sequences in a sample are captured, and the detection sensitivity and reliability are improved.

The invention relates to a preparation method of an EB (Epstein-Barr) virus capsid antigen-magnetic bead complex, which comprises the following steps: adding 0.5-2M of PB buffer solution and EB virus capsid antigen into magnetic beads, uniformly mixing at 15-30 DEG C, and standing for 2-3 hours; wherein the EB virus capsid antigen is a VCA-P18 antigen and / or a VCA-P23 antigen; adding a confining liquid, and uniformly mixing at 15-37 DEG C for 1-3 hours; removing supernate, and adding a magnetic bead diluent for resuspension; the magnetic bead diluent comprises about 0.1 M of a Tris-HCl buffer solution, Casein of which the mass volume ratio is 0.2%-1.0%, MAK33 of which the mass volume ratio is (10-30) [mu] g / mL, and TW20 of which the mass volume ratio is 0.3%-0.8%.

Provided herein are compositions comprising an EB virus envelope protein (e.g., glycoprotein 350 (gp350)) and a saponin adjuvant, and methods of inducing an immune response against EB virus using the above compositions.

The invention belongs to the technical field of medical biology, and particularly relates to an EBV (Epstein-Barr Virus) neutralizing antibody-specifically-immune plasma high-throughput screening method and application thereof. EB virus envelope glycoprotein gp350 is selected as a screening target antigen, EBV specific plasma containing a high-titer EBV neutralizing antibody is rapidly screened in a high-throughput mode and used for preparing EBV specific human immune globulin, the titer of the EBV neutralizing antibody is obviously higher than that of listed intravenous gamma-C products, and the content of the EBV neutralizing antibody is about 4-8 times that of the EBV neutralizing antibody with the same concentration. The method provided by the invention can realize large-scale collection of EBV specific plasma through rapid high-throughput screening, reduces the workload of plasma screening, is suitable for large-scale production of EBV specific human immune globulin, and has a good application prospect.

The present invention relates to the field of biomedicine. Provided are a T-cell receptor, and a preparation method therefor and the use thereof. The T-cell receptor EBV-TCR comprises a TCRα chain variable region and a TCRβ chain variable region; the TCRα chain variable region comprises peptide fragments CDRα1, CDRα2 and CDRα3; the TCRβ chain variable region comprises peptide fragments CDRβ1, CDRβ2 and CDRβ3; and the amino acid sequence of the CDRα3 is as set forth in SEQ ID NO. 7, and the amino acid sequence of the CDRβ3 is as set forth in SEQ ID NO. 3. The TCR has a high specificity and can significantly activate the release of cytokines when binding to T-cells, thus providing a theoretical and experimental basis for developing a TCR-T therapy targeting an EB virus antigen.

The present application relates to a detection kit for the diagnosis and screening of nasopharyngeal carcinoma. The detection kit comprises an immunochromatography detection card, and the immunochromatography detection card comprises a reagent for detecting an EB virus antigen-antibody by means of a colloidal gold labeling method. The present application further relates to the use of the detection card and the EB virus antigen-antibody in the preparation of a detection kit or detection card for the diagnosis and screening of nasopharyngeal carcinoma.