Unlock instant, AI-driven research and patent intelligence for your innovation.

Application method of EB virus encoded microRNA BART10

An application method and coding technology, applied in the field of tumor molecular biology, can solve problems such as inability to speculate

Inactive Publication Date: 2015-12-16
CENT SOUTH UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Explain the relationship between the expression of EBV miRNAs and recurrence and metastasis, can not be speculated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application method of EB virus encoded microRNA BART10
  • Application method of EB virus encoded microRNA BART10
  • Application method of EB virus encoded microRNA BART10

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, real-time fluorescent quantitative PCR method detection confirmed that EBV-miR-BART10 was up-regulated in nasopharyngeal carcinoma

[0038] 1. Materials and methods:

[0039] Collect 5 cases of normal nasopharyngeal epithelial tissues and 18 cases of nasopharyngeal carcinoma tissues, extract total RNA with Trizol (product of Invitrogen Company), reverse transcribe 2 μg RNA into cDNA with miScript reverse transcription kit (product of Qiagen Company), and use QuantiTectSYBRGreenPCR kit (Qiagen company product) Real-time fluorescent quantitative PCR was used to detect the expression of EBV-miR-BART10 and internal reference gene RNU6. The public primers (UniversalPrimer) of microRNA and the specific primers of EBV-miR-BART10 and RNU6 were designed and synthesized by Qiagen Company.

[0040] Real-time fluorescence quantitative PCR reaction system

[0041]

[0042] Real-time fluorescent quantitative PCR reaction steps

[0043]

[0044]

[0045] After t...

Embodiment 2

[0048] Example 2, in situ hybridization detection found that the expression of EBV-miR-BART10 in nasopharyngeal carcinoma is related to the prognosis of patients

[0049] 1. Material method

[0050] 1.1 Design and synthesis of hybridization probes

[0051] In order to detect the expression of EBV-miR-BART10 by in situ hybridization, we designed oligonucleotide probes for detecting EBV-miR-BART10 expression by in situ hybridization and positive control in situ hybridization oligonucleotide probes.

[0052] EBV-miR-BART10 probe: ACAGCCAACUCCAUGGUUAUGUA

[0053] Positive control probe (to detect the housekeeping gene GAPDH):

[0054] GAPDH probe: CAGUAGAGGCAGGGAUGAUGUUCU

[0055] The gene-specific oligonucleotide probe sequences designed above were synthesized by chemical synthesis method, and uracil in the probe sequences was labeled with biotin (bio-U) during the synthesis process.

[0056] 1.2 Oligonucleotide probe labeling kit and in situ hybridization detection reagent ...

Embodiment 3

[0117] Example 3, overexpression of EBV-miR-BART10 in nasopharyngeal carcinoma cells promotes the invasion and metastasis of nasopharyngeal carcinoma

[0118] 1. Material method

[0119] 1.1 Cell culture and transfection

[0120]The EBV-negative nasopharyngeal carcinoma cell line HNE2 was purchased from the Cell Center of Central South University. The RPMI1640 medium and fetal bovine serum used for cell culture, and the trypsin used for digesting cells were all products of Gibco, USA.

[0121] EBV-miR-BART10 is synthesized by Invitrogen Company through chemical synthesis, and the sequence is:

[0122] UACAUAACCAUGGAGUUGGCUGU

[0123] The well-growing nasopharyngeal carcinoma cell line HNE2 was divided into 2×10 5 Cells / well were seeded in a 6-well plate, and the 6-well plate was placed at 37°C, 5% CO 2 In the incubator, the transfection of EBV-miR-BART10 can be started when the cells to be cultured grow to a density of 50-70%; the transfection process is as follows:

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of EB virus encoded microRNA BART10 (EBV-miR-BART10) in preparing a prediction preparation for recurrence and metastasis of nasopharyngeal carcinoma. The research proves that the expression level of EBV-miR-BART10 in the nasopharyngeal carcinoma tissue is in positive correlation with the lymphatic metastasis and the distant metastasis of the nasopharyngeal carcinoma patient; if the expression of the EBV-miR-BART10 in the nasopharyngeal carcinoma tissue is up-regulated, the nasopharyngeal carcinoma patient with higher EBV-miR-BART10 expression have larger possibilities of recurrence and metastasis than the nasopharyngeal carcinoma patient with lower EBV-miR-BART10 expression, and the prognosis is worse, therefore, the application of the expression of the EBV-miR-BART10 in the predication of recurrence and metastasis of the nasopharyngeal carcinoma patient can provide powerful biomolecular basis for the prognosis of the nasopharyngeal carcinoma patient, and thus the application method has profound clinical significances and important popularization and application prospects.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to an in situ hybridization for detecting the expression level of microRNA BART10 (EBV-miR-BART10) encoded by Epstein-Barr virus in paraffin-embedded samples of nasopharyngeal carcinoma and the relationship between recurrence and metastasis of nasopharyngeal carcinoma Probe, detection kit and application method thereof. Background technique [0002] Nasopharyngeal carcinoma (Nasopharyngeal Carcinoma, NPC) is a common malignant tumor of the head and neck in southern my country. Due to the hidden location of the disease, it is difficult to detect early, and it is very easy to metastasize. The rate of cervical lymph node metastasis in newly diagnosed patients is as high as 80%. Radiation therapy is currently the most commonly used clinical treatment for nasopharyngeal carcinoma. 60-70% of patients can achieve good curative effect, but 20-30% of patients still have rec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6886C12Q1/705C12Q2600/118C12Q2600/158C12Q2600/178
Inventor 曾朝阳李桂源熊炜李小玲晏其佳何宝玉李夏雨张文玲廖前进石磊周鸣马健
Owner CENT SOUTH UNIV