461 results about "Carcinoma Cell" patented technology

The invention discloses a polypeptide and application thereof in preparation of a medicine for preventing and / or treating cancers. The amino acid sequence of the polypeptide is shown as SEQ ID No. 1 or SEQ ID No. 2. The cancer is at least one of breast cancer, colorectal cancer, leukemia, esophageal cancer, pancreatic cancer, brain glioma, kidney cancer, skin cancer, osteosarcoma, ovarian cancer and prostate cancer. The invention designs and synthesizes the polypeptide of a targeted staphylococcus tumor protein compound SND1-MTDH containing a nuclease structural domain 1 (SND1 and a heteromucin (MTDH), finds that the polypeptide has excellent inhibitory activity on various different types of human cancer cells for the first time, and provides an optional scheme for broad-spectrum anti-cancer drugs. The polypeptide applied in the invention is simple in synthesis process and low in production cost.

The invention relates to application of recombinant III-type humanized collagen in treatment of cervical cancer, in particular to application of recombinant III-type humanized collagen in preparation of products for preventing and / or inhibiting and / or treating cervical cancer. The amino acid sequence of the recombinant III-type humanized collagen comprises n repetitions of the sequence as shown in SEQ ID NO.1, n is an integer greater than or equal to 1 and preferably is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 20, 24 or 32, and when n is an integer greater than or equal to 2, the repetitions are directly connected. Research data shows that the recombinant III-type humanized collagen can obviously inhibit the proliferation capacity and migration capacity of cervical cancer cells, and help is provided for preparation and wide application of products for preventing and treating cervical cancer and clinical treatment of cervical cancer.

The invention discloses an application of non-therapeutic GLYR1 protein in regulating and controlling proliferation and / or migration of renal clear cell carcinoma cells, which is characterized in that the expression of GLYR1 is knocked down so as to promote the proliferation and / or migration of the renal clear cell carcinoma cells, a reagent adopted for knocking down the expression of the GLYR1 is si-GLYR1 # 1, a positive-sense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGUCGAAGA, an antisense strand of the si-GLYR1 # 1 is UCUUCGACAGCAUCUACCG, the antisense strand of the si-GLYR1 # 1 is CGGUAGAUGCUGCAUCUACCG is The kit has the characteristics of high sensitivity, strong specificity, short period and the like, is beneficial to early diagnosis and treatment of the clear cell renal carcinoma, and has the potential of becoming a novel biomarker and an effective treatment target in the clear cell renal carcinoma.

In alternative embodiments, provided are chimeric, synthetic or recombinant antibodies (Ab) against the human homologous box NKX-2. 1 (also known as NK2 homologous box 1, or thyroid transcription factor 1 (TTF-1)) protein, including articles of manufacture and kits comprising them, and methods of making and using them, including, for example, their use in the detection or diagnosis and treatment of cancer. In alternative embodiments, an anti-NKX-2. 1 (TTF-1) antibody provided herein is used with an agent for determining whether NKX-2. 1 (TTF-1) expression or activity is present, reduced or deleted; or the sensitivity of the specific binding of the Ab or the antigen (Ag) binding fragment or protein (ABP) or the monomer or dimer ABP provided by the invention with the squamous cell carcinoma cells is lower than the sensitivity of the specific binding with the adenocarcinoma cells (or binding with lower affinity), so that false positives of the squamous cell carcinoma are less, and the positive recognition of the lung adenocarcinoma is better.

The invention relates to the technical field of medical instruments, and provides a steep pulse-based ablation system and method for liver cancer cells, and the system comprises a tumor feature recognition module which is used for obtaining imaging images of the liver cancer cells and recognizing tumor features, blood supply conditions and tumor centers of the liver cancer cells; the electrode inlet setting module is used for setting a safety boundary of liver cancer cells and setting an ablation area and a focus skin surface of the liver cancer cells based on the safety boundary and tumor characteristics; the ablation effect analysis module is used for calculating the electrode depth and the electrode angle of the liver cancer cells and analyzing the coverage effect of an ablation area; the electric field intensity identification module is used for analyzing cell membrane characteristics of the hepatoma cells, identifying the electroporation effect of the hepatoma cells and identifying the electric field intensity of the hepatoma cells; and the steep pulse ablation module is used for performing ablation treatment on the liver cancer cells in combination with the electric field intensity and a pulse generator to obtain an ablation result. The invention aims to avoid heat injury of surrounding tissues and improve the ablation effect of liver cancer cells.

The invention discloses a limonin compound and application thereof in preparation of a medicine for preventing and / or treating cancers. The structure of the limonin compound is shown as a formula I or II. The cancer is at least one of breast cancer, liver cancer, gastric cancer, esophageal cancer, leukemia, pancreatic cancer, glioma, osteosarcoma, prostatic cancer, nasopharynx cancer, cervical cancer, ovarian cancer, kidney cancer and skin cancer. According to the invention, activity screening is carried out on various natural product extracts, it is found for the first time that limonin compounds with structural formulas I and II have excellent inhibitory activity on various different types of human cancer cells, and an optional scheme is provided for broad-spectrum anti-cancer drugs. Related results also show that the compound provided by the invention can inhibit migration and invasion ability of breast cancer cells, promote cell apoptosis and retard a cell cycle. The limonin compound applied in the invention is derived from mallotus oblongifolius, the source is wide, and the production cost is low.

The invention belongs to the technical field of biomedicine, and discloses an immortalized cell line for human kidney suspected cell carcinoma as well as a culture method and application of the immortalized cell line. The immortalized cell line for the human kidney suspected cell carcinoma, disclosed by the invention, is named as a human kidney suspected cell carcinoma cell line Loya a-710 (Homo sapiens), the classification name of the Latin name of the immortalized cell line is Chromophore sensor cell carcino: Loya a-710, and the preservation number of the immortalized cell line is CCTCC (China Center for Type Culture Collection) NO: C2025123. The human kidney suspected cell carcinoma cell line Loya-710 disclosed by the invention is used as an in-vitro model to rapidly grow in tissue culture, and mitochondrial mutation characteristics, a vesicle structure and a classical immunohistochemical marker of ChRCC are reserved. The invention provides a precious tool for further research on ChRCC heredity, molecules and biological characteristics, and also provides a powerful new model for mitochondrial diseases.

The invention discloses a medicine for treating renal cell carcinoma and application thereof, and belongs to the field of biomedicine, the medicine comprises a reagent capable of ubiquitination degradation of WEE1, FBXO2 overexpression can prevent proliferation and movement of renal cell carcinoma cells, and FBXO2 can reduce abundance of WEE1 through ubiquitination degradation; the interaction and ubiquitination degradation of the WEE1 are mediated by the FBA structural domain of the FBXO2; fBXO2 degrades WEE1 through ubiquitination to inhibit RCC canceration.

The invention relates to the technical field of biomedicine, in particular to a mouse intrahepatic bile duct cancer cell strain and a construction method and application thereof, the cell strain is named as mouse intrahepatic bile duct cancer cell strain KP-ICC and preserved in China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: C202574; the cell strain is derived from a KrasG12D / Tp53flox / flox C57BL / 6J mouse, a spontaneous tumor model is constructed through high-pressure hydrodynamic tail vein injection of pT3-Cre and a sleep beauty transposase plasmid, and the spontaneous tumor model is obtained through in-vitro culture, passage, monoclonal screening and tumorigenicity verification. The KP-ICC cell strain naturally has chemotherapy-immune combined treatment drug resistance and ferroptosis resistance characteristics, and can be widely applied to the fields of intrahepatic cholangiocarcinoma drug resistance mechanism research, drug resistance reversing, combined treatment drug development, drug resistance animal model establishment and the like.

The invention discloses application of a composition containing isovaleric acid and lenvatinib in preparation of anti-cancer drugs, and belongs to the technical field of biological medicines. It is found for the first time that after the isovaleric acid and the lenvatinib are combined for use, the isovaleric acid and the lenvatinib have a synergistic effect, the anti-cancer activity of the composition containing the isovaleric acid and the lenvatinib can be remarkably improved, and especially the composition has better inhibitory activity on in-vitro liver cancer cells. Animal experiments further verify that the combination of isovaleric acid and lenvatinib can synergistically inhibit the growth of liver cancer cells in mice. Therefore, the composition containing the isovaleric acid and the lenvatinib has a relatively good application prospect in the prevention and / or treatment of the hepatocellular carcinoma.

The invention discloses a 5-substituted-3-(arylaminoethyl) benzoxazolone compound and a preparation method and application thereof.The compound takes CO2 as a carbonyl source, the preparation method is simple, raw materials are easy to obtain, and the compound has a good anti-cancer effect on the activity of cancer cells and particularly has a remarkable anti-cancer effect on the cancer cells such as HCCLM3 (human hepatoma carcinoma cells) and MCF-7 (human breast cancer cells).

The invention relates to application of recombinant humanized III-type collagen in preparation of an esophageal squamous cell carcinoma inhibitor. The invention discovers that the recombinant humanized III-type collagen can significantly inhibit the proliferation of esophageal squamous carcinoma cells and prevent the generation of malignant phenotypes of esophageal squamous carcinoma cells. Therefore, the invention can be used for preparing medicines for preventing and treating esophageal squamous carcinoma.

The invention provides application of combination of tageteoside and difacitinib or ponatinib to blocking of esophageal squamous cell carcinoma progression. The tageteoside is combined with an FAK inhibitor defacitinib or an Src family kinase inhibitor ponatinib, so that the metastasis of esophageal squamous carcinoma, especially lymphatic metastasis, can be inhibited, the growth of primary focus and metastatic focus esophageal squamous carcinoma cells can be inhibited, and a synergistic anti-cancer effect is achieved.

The invention belongs to the technical field of biological medicine, and provides CKS1B serving as an immunotherapy response prediction biomarker and application of the CKS1B, and according to the application, CKS1B serves as an immunotherapy response marker, and a CKS1B inhibitor is combined with an active component to treat a model mouse. In-vitro cell experiments are adopted to evaluate the immunotherapy prediction effect of the CKS1B as a biomarker on esophageal squamous carcinoma, a Cks1b overexpression tumor mouse model, a homologous mouse model and a human immune reconstruction mouse model are established, and a CKS1B inhibitor is combined with active ingredients to treat the two models; results show that the CKS1B inhibitor combined with the active component can promote removal of esophageal squamous carcinoma cells by CD8 + T cells, inhibit interferon signal channels and antigen presentation, effectively recover immune response, inhibit tumor cell proliferation and significantly reduce tumor volume, so as to achieve the purpose of treating esophageal squamous carcinoma.

The invention discloses an eccDNAcircATP6V0A1 serving as a predictive marker of cis-platinum drug resistance of hypopharyngeal cancer and an application of the eccDNAcircATP6V0A1. The nucleotide sequence of the predictive marker eccDNA is as shown in SEQ ID NO. 3. According to the invention, a hypopharyngeal carcinoma cisplatin drug-resistant cell line model FaDu / DDP is cultured for the first time, meanwhile, a differential eccDNA expression profile and a circRNA expression profile in hypopharyngeal carcinoma cells FaDu and hypopharyngeal carcinoma cisplatin drug-resistant cells FaDu / DDP are disclosed and analyzed in a combined manner, and the eccDNA circATP6V0A1 is further screened and verified as a predictive marker of hypopharyngeal carcinoma cisplatin drug resistance through combined analysis. And a new treatment strategy diagnosis and treatment thought is provided for cis-platinum chemotherapy of hypopharyngeal carcinoma patients clinically.

The invention discloses application of circular RNA (Ribonucleic Acid) Hsacirc0006332 in diagnosis and treatment of esophageal squamous cell carcinoma, and belongs to the field of biological medicines. The application comprises the application of a reagent capable of detecting the Hsacirc0006332 or the expression quantity of the Hsacirc0006332 in preparation of a kit for diagnosing the esophageal squamous cell carcinoma, and the nucleotide sequence of the Hsacirc0006332 is SEQ ID NO. 1. The invention further discloses application of the component capable of inhibiting or blocking expression of the Hsacirc0006332 in preparation of a medicine for treating esophageal squamous cell carcinoma. The expression level of Hsacirc0006332 specific siRNAs in esophageal squamous cell carcinoma cells is changed through molecular biology means such as construction of Hsacirc0006332 specific siRNAs, and it is revealed that interference on Hsacirc000632 expression can significantly inhibit proliferation, invasion and migration of esophageal squamous cell carcinoma cells and promote tumor cell biological phenotypes such as cancer cell apoptosis. Therefore, the Hsacirc0006332 can be used as a therapeutic target to be applied to preparation, screening or treatment of esophageal squamous cell carcinoma or inhibition of esophageal squamous cell carcinoma migration invasion, and a new therapeutic method is provided for intervention or treatment of esophageal squamous cell carcinoma.

The invention provides a preparation method of a hybrid cell membrane modified nano-drug for inhibiting interment of macrophages. According to the invention, a multifunctional bionic nano-drug with a'core-shell 'structure is prepared from liver cancer cell membrane and bone marrow-derived macrophage membrane hybrid double-drug-loading carrier nanoparticles. In the application, the bionic function of macrophages is firstly realized, so that the drug is prevented from being swallowed by mononuclear macrophages in vivo, and the side effect of the drug is reduced; secondly, by utilizing the homologous targeting effect of hepatoma carcinoma cells of Hepa1-6, the aggregation of the medicine in tumors is enhanced, and the utilization efficiency of the medicine is improved; finally, the two drugs including sorafenib and Xkr8siRNA are co-delivered, so that the pharmacokinetics is simplified, and the immunotherapy effect of the liver cancer can be promoted by utilizing the inhibition of the Xkr8siRNA on the intercellular effect.

Lung fibroblast play an important role in lung cancer tumor microenvironment (TME). Senescence is involved in the pathophysiology of tumorogenesis. analyze how sPLA2 influenced lung cancer cell malignant properties. The inventors show that secreted PLA2 XIIA (sPLA2 XIIA) play a key role in lung cancer cell malignant properties. They demonstrate that sPLA2 XIIA increases the proliferation, the migration and organoid growth of both lung cancer cell lines (NCI and A549). Indeed, they shows that sPLA2 XIIA induces notably the epithelial mesenchymal transition (EMT), which is involved in the invasion of cancer cells and in the formation of metastasis. They also demonstrate that the effect of sPLA2 XIIA is mediated in particular by syndecan 1 and 4. Taken altogether, these data define sPLA2 XIIA as a circulating biomarker of poor prognosis in lung cancer and establish a requirement for sPLA2 XIIA inhibition for the treatment or prevention of cancer, especially lung cancer in the COPD patients.

Provided is an antibody fusion protein, which simultaneously targets CD24, IL4R and an integrin receptor. An in-vitro assay shows that the antibody fusion protein significantly inhibits the proliferation, migration, invasion, colony formation and adhesion of renal cancer cells, also has a comprehensive and significant anti-tumor effect on gastric cancer, colon cancer and breast cancer, and has the effect of inhibiting angiogenesis. The results of a mouse tumor model of subcutaneous transplantation of MC38-hPDL1C57BL6 / J show that the antibody fusion protein combined with the PDL1 antagonist atezolizumab can significantly inhibit tumor growth. The antibody fusion protein can be used as a potential candidate drug for treating metastatic renal cell carcinoma, PDL1-overexpressing cancer, ophthalmic diseases and inflammation or autoimmune diseases.

The present invention relates to lipid nanoparticle (LNP) compositions, as well as diagnostic or therapeutic polynucleotides, such as TERT mRNA, that can be delivered in a formulation together with the LNP compositions to various tissue and cell types in the whole body of a mammal, such as, for example, TNP mRNA. Comprising stem cells, progenitor cells, germ cells, differentiated cells or terminally differentiated cells, cancer cells, endothelial cells, epithelial cells, splenic cells, hepatocells, kidney cells and / or osteoblasts, for example, for use in the diagnosis, prevention and / or treatment of a condition or disease.

The invention relates to an application of Avasimibe in preparation of a medicine for treating nasopharynx cancer or oral cancer, and belongs to the field of tumor targeted therapy. An in-vitro cell experiment and an in-vivo animal model experiment verify the anti-tumor effect of the compound. Experiments show that Avasimibe can significantly inhibit the activity, proliferation ability, healing ability and cloning ability of nasopharynx cancer cells and oral cancer cells, can regulate cell cycle arrest in a dose-dependent manner, and induces cell apoptosis. In vivo experiments, the tumor volume of nude mice in an Avasimibe treatment group is remarkably reduced, serum cholesterol is remarkably reduced, and serum biochemical analysis shows that compared with a control group, the Avasimibe treatment group has no statistical difference in indexes such as aspartate transaminase (AST) / glutamic-pyruvic transaminase (ALT) and creatinine (Cr). The invention provides a new indication for resisting nasopharynx cancer and oral cancer for the existing compound Avassimibe, has the clinical advantages of low toxicity and capability of overcoming drug resistance, and provides a new treatment choice for patients with nasopharynx cancer and oral cancer.

The invention discloses a preparation method and application of lithospermum carbon nanodots with an anti-adrenal cortical carcinoma function, and relates to the field of carbon dots, the lithospermum carbon nanodots are prepared by the following steps: mixing a lithospermum extract and deionized water, and carrying out a hydrothermal reaction to obtain a lithospermum carbon dot aqueous solution; the lithospermum carbon nanodots are used for preparing medicines for resisting adrenal cortex cancer. The lithospermum carbon nanodot provided by the invention has an inhibition effect on proliferation of adrenal cortex cancer cells, especially on the adrenal cortex cancer cells ACHN and 769-P. The lithospermum carbon nanodot disclosed by the invention has a remarkable proliferation inhibition effect on ACC (adrenal cortical carcinoma) cells. The adrenal cortex cancer is a rare and malignant tumor, and traditional treatment methods such as surgery and chemotherapy have certain limitations. Therefore, the development of a new targeted therapy strategy is very important. The lithospermum carbon nanodots can effectively inhibit proliferation of adrenal cortex cancer cells such as ACHN and 769-P through a certain molecular mechanism.

The invention discloses an application of tripterine in preparation of an anti-esophageal cancer drug. The tripterine or the pharmaceutically acceptable salt thereof provided by the invention can be used for preparing medicines for preventing or treating esophageal cancer. The tripterine is adopted to achieve the effects of inhibiting proliferation of esophageal squamous carcinoma cells, inducing apoptosis of the esophageal squamous carcinoma cells, reducing the size of esophageal tumors and being small in side effect.

The invention discloses application of lncRNASEH1-AS1 as a target in preparation of a medicine for treating lung squamous cell carcinoma, and belongs to the technical field of biological medicine. The invention finds that the expression of the lncRNASEH1-AS1 in tissues, plasma and cell lines of a lung squamous cell carcinoma patient is higher than that of a control group of the lung squamous cell carcinoma patient. The lncRNASEH1-AS1 has clinical correlation with the tumor diameter of a lung squamous cell carcinoma patient. The results of CCK-8, clone formation, Transwell migration and invasion experiments show that after the lncRNASEH1-AS1 and the MCM7 are knocked down, the proliferation, migration and invasion ability of the lung squamous cell carcinoma cells is weakened, and after the lncRNASEH1-AS1 is over-expressed, the inhibition of the MCM7 on the proliferation, migration and invasion ability of the lung squamous cell carcinoma cells can be reversely knocked down. The result of a nude mouse subcutaneous tumor formation experiment shows that the tumor formation capability of the LUSC cells which stably knock down the lncRNASEH1-AS1 is weakened.

The present application is related to a panel of antibody-drug conjugates (ADCs) in which cytotoxic tubulin inhibitor monomethyl auristatin E (MMAE) is conjugated onto monoclonal antibodies targeting cadherin-17 (CDH17), a tumor-associated antigen that is overexpressed in uterine cervical adenocarcinoma, mucinous carcinoma of the ovary, and gastrointestinal cancers including pancreatic, gastric, colorectal cancers, etc. These ADCs recognise different parts of CDH17, showing high-affinity binding to CDH17-expressing cells. All these properties allow the CDH17-targeting ADCs to demonstrate cytotoxicity specifically against CDH17-expressing cancer cells. The cytotoxic effect of MMAE would be highly localized in tumors, maximising the anti-tumor effect and simultaneously reducing the adverse effects of anti-cancer drug on non- cancerous normal tissues.

The invention belongs to the technical field of biological medicines, and discloses application of decitabine or an optical isomer thereof, or a hydrate thereof, or a solvate thereof, or a prodrug thereof, or a derivative thereof, or a pharmaceutically acceptable salt thereof in preparation of medicines for preventing and / or treating nasopharynx cancer. Or application in preparation of drugs for inhibiting postoperative recurrence and growth of nasopharyngeal carcinoma. In-vivo and in-vitro experiments prove that decitabine has the activity of remarkably inhibiting growth of nasopharyngeal carcinoma cells and is efficient and low in toxicity; the in-situ gel is prepared into the in-situ gel and is locally administrated through the nasopharyngeal cavity, so that toxic and side effects caused by a conventional treatment method can be avoided, tumor recurrence and growth can be remarkably inhibited after nasopharyngeal carcinoma operation, good safety is achieved, a new medicine and a new means are provided for prevention and treatment of nasopharyngeal carcinoma, and therefore the in-situ gel has wide application prospects.

The application discloses a dihydroquinazolinone-containing N-hydroxy amide compound and a preparation method and application thereof, relates to the technical field of medicinal chemistry, and utilizes the splicing principle to design and synthesize dihydroquinazolinone-containing N-hydroxy amide compounds with novel structures, and the compounds are tested in terms of HDAC6 protein affinity and anti-proliferation activity of cervical cancer cell Siha, and the results show that the compounds E1-E5 have better affinity to the HDAC6 protein, the IC 50 values are 4.1-85.4 nM, wherein the affinity of the compound E4 to the HDAC6 protein is higher than that of a positive control SAHA; and the compounds E1-E5 can better inhibit the proliferation of the cervical cancer cell Siha, the IC 50 values are 2.4-9.3 muM, wherein the activity of the compound E4 is the strongest.

The invention discloses an optical positioning method and system for papillary thyroid cancer cells of a terahertz near-field system, and relates to the field of terahertz near-field imaging, and the method comprises the following steps: carrying out the imaging observation of a thyroid tissue section under a first magnification factor through a microscope, carrying out low-magnification imaging partitioning on an area where imaging observation is located according to the morphological characteristics of the cells to form partitioned images; selecting an area of suspected papillary thyroid cancer cells, performing observation and comparison under a second magnification, comparing the observed morphology with the known optical characteristics of the papillary thyroid cancer cells, and selecting an area near the area with the suspected characteristics as an optical positioning point and performing marking; and carrying out positioning according to the optical positioning point, and carrying out scanning imaging by using a terahertz near-field system. The problems that a terahertz near-field system is long in time consumption and difficult to locate when finding papillary cancer cells in multiple cells of thyroid tissue slices are mainly solved.

The invention discloses a polypeptide and application thereof. The polypeptide TCL6148 is a polypeptide composed of an amino acid sequence as shown in SEQ ID NO: 1. The polypeptide TCL6148 is prepared by adopting a solid-phase synthesis method, it is proved for the first time that the polypeptide TCL6148 can inhibit proliferation and migration of renal cell carcinoma cells, and a new target spot and a new medication strategy are provided for treating renal cell carcinoma.

Proposed are antibodies specifically binding to PTK7 and a use thereof and, more particularly, PTK7 neutralizing antibodies specifically binding to PTK7 to inhibit PTK function, and a use thereof for inhibiting angiogenesis, cell growth, cell migration, and cell invasion. The human PTK7 neutralizing monoclonal antibodies have been found to independently exhibit an effective inhibitory effect on cancer cell growth, migration, invasion in esophageal squamous cell carcinoma and triple-negative breast cancer, and angiogenesis. Therefore, the human PTK7 neutralizing monoclonal antibodies can be applied to various PTK7-positive carcinomas and angiogenic diseases, and can be further developed as a targeted drug therapy for intractable cancers and angiogenic diseases to be used as a core global treatment drug for the same.