Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

338 results about "Binding efficiency" patented technology

The cross-arm binding efficiency (χ) describes an increase in apparent affinity when a BsAb binds to the second target or receptor (R2) following its binding to the first target or receptor (R1) on the same cell. χ is an intrinsic characteristic of a BsAb mostly related to the binding epitopes on R1 and R2.

Isolation of proteins

The present invention relates to a novel method for the isolation or purification of immunoglobulins (a special class of proteins) from a solution containing immunoglobulins, e.g. hybridoma cell culture supernatants, animal plasma or sera, or colostrum. The method includes the use of a minimum of salts, such as lyotropic salts, in the binding process and preferably also the use of small amounts of organic solvents in the elution process. The solid phase matrices, preferably epichlorohydrin activiated agarose matricees, are functionalised with mono- or bicyclic aromatic or heteroaromatic ligands (molecular weight: at the most 500 Dalton) which, preferably, comprises an acidic substituent, e.g. a carboxylic acid. The matrices utilised show excellent properties in a “Standard Immunoglobulin Binding Test” and in a “Monoclonal Antibody Array Binding Test” with respect to binding efficiency and purity, and are stable in 1M NaOH.
Owner:UPFRONT CHROMATOGRAPHY

Fast CRISPR-Cas9 working efficiency testing system and application thereof

The invention discloses a fast CRISPR-Cas9 working efficiency testing system and application thereof. The testing system comprises a plasmid used for expressing sg RNA, a plasmid used for expressing Cas9 and a reporting system used for testing the CRISPR-Cas9 gene editing efficiency; the reporting system can splice the C-terminal of a nucleotide segment capable of coding effective protein and the N-terminal of a reporter gene and insert two restriction endonuclease enzyme digestion sites into the splicing position; before a special gene is edited (knocked out) through the CRISPR-Cas9 system, selection of a target sequence is vital, and the selection can influence the recognition efficiency of the sg RNA to target DNA, the binding efficiency of the sg RNA with the target DNA, the targeted cutting efficiency of the Cas9 and the NHEJ repairing efficiency. According to the system, the gene editing efficiency of different sgRNA-target DNA sequences can be quantitatively compared, the sgRNA with the best working effect can be determined within a short time, the actual knockout success rate is increased, therefore, the working cost can be lowered, the working efficiency can be improved, and the working progress can be promoted.
Owner:ZHEJIANG UNIV

Methods and systems for redesigning pre-existing concrete mix designs and manufacturing plants and design-optimizing and manufacturing concrete

Design optimization methods can be used to design concrete mixtures having optimized properties, including desired strength and slump at minimal cost. The design optimization methods use a computer-implemented process that is able to design and virtually “test” millions of hypothetical concrete compositions using mathematical algorithms that interrelate a number of variables that affect strength, slump, cost and other desired features. The design optimization procedure utilizes a constant K (or K factor) within Feret's strength equation that varies (e.g., logarithmically) with concrete strength for any given set of raw material inputs and processing equipment. That means that the binding efficiency or effectiveness of hydraulic cement increases with increasing concentration so long as the concrete remains optimized. The knowledge of how the K factor varies with binding efficiency and strength is a powerful tool that can be applied in multiple circumstances. A concrete manufacturing process may include accurately measuring the raw materials to minimize variation between predicted and actual strength, as well as carefully controlling water content throughout the manufacturing and delivery process.
Owner:ICRETE LLC

Computer-implemented methods for re-designing a concrete composition to have adjusted slump

Design optimization methods can be used to design concrete mixtures having optimized properties, including desired strength and slump at minimal cost. The design optimization methods use a computer-implemented process that is able to design and virtually “test” millions of hypothetical concrete compositions using mathematical algorithms that interrelate a number of variables that affect strength, slump, cost and other desired features. The design optimization procedure utilizes a constant K (or K factor) within Feret's strength equation that varies (e.g., logarithmically) with concrete strength for any given set of raw material inputs and processing equipment. That means that the binding efficiency or effectiveness of hydraulic cement increases with increasing concentration so long as the concrete remains optimized. The knowledge of how the K factor varies with binding efficiency and strength is a powerful tool that can be applied in multiple circumstances. A concrete manufacturing process may include accurately measuring the raw materials to minimize variation between predicted and actual strength, as well as carefully controlling water content throughout the manufacturing and delivery process.
Owner:ICRETE LLC

Computer-implemented methods for redesigning a pre-existing concrete mix design

Design optimization methods can be used to design concrete mixtures having optimized properties, including desired strength and slump at minimal cost. The design optimization methods use a computer-implemented process that is able to design and virtually “test” millions of hypothetical concrete compositions using mathematical algorithms that interrelate a number of variables that affect strength, slump, cost and other desired features. The design optimization procedure utilizes a constant K (or K factor) within Feret's strength equation that varies (e.g., logarithmically) with concrete strength for any given set of raw material inputs and processing equipment. That means that the binding efficiency or effectiveness of hydraulic cement increases with increasing concentration so long as the concrete remains optimized. The knowledge of how the K factor varies with binding efficiency and strength is a powerful tool that can be applied in multiple circumstances. A concrete manufacturing process may include accurately measuring the raw materials to minimize variation between predicted and actual strength, as well as carefully controlling water content throughout the manufacturing and delivery process.
Owner:ICRETE LLC

Cable take-up device

ActiveCN105398879AFast automatic windingImprove winding and bundling efficiencyFilament handlingButt jointElectric cables
The invention discloses a cable take-up device which comprises a mounting base, a fixed support, a movable support, a driving rotary disc, a driven rotary disc, a winding reel and a driving mechanism. The fixed support is fixedly mounted on the mounting base. The movable support is movably mounted on the mounting base. The driving rotary disc is mounted on the fixed support and connected with the driving mechanism, the driving rotary disc is provided with a butt joint shaft and a ring groove, and the butt joint shaft is provided with first convex blocks. Second convex blocks are arranged on the inner circumferential surface of the ring groove, and a groove is formed between any two adjacent second convex blocks. The driven rotary disc is mounted on the movable support, the driven rotary disc is provided with a sleeve, and a clamping groove is formed in the sleeve. The winding reel is mounted on the driven rotary disc, and third convex blocks are arranged on the winding reel. Through the cable take-up device, a manual take-up mode is replaced, cables can be rapidly and automatically wound into cable coils of the unified specification, harnesses are uniform and attractive in appearance, the cable take-up and binding efficiency is greatly improved, and production cost is reduced.
Owner:蚌埠格识知识产权运营有限公司

Method and device for binding equipment

The present disclosure relates to a method and a device for binding equipment, belonging to the technical field of computer, wherein the method comprises the steps as follows: receiving a binding request transmitted by a terminal, wherein the binding request comprises a device identification of electronic equipment to be bound and a user account corresponding to the terminal; detecting whether there is conversion record corresponding to the user account and the device identification in a server; and binding the user account and the device identification when there is conversion record corresponding to the user account and the device identification in the server. The method and the device solve the problem that the binding process is complicated and inefficient because the electronic equipment only can be determined as the electronic equipment owned by the user according to the operation of the user to the electronic equipment and improves the binding efficiency of the equipment.
Owner:XIAOMI INC

Capillary array and related methods

The invention provides methods and devices for detecting the presence of one or more target analytes in a sample employing a channel having affixed therein one or more binding partners for each target analyte. Assays are carried out by transporting the sample through the channel to each successive binding partner so that target analyte present in said sample binds to the corresponding binding partner. The sample is then transported beyond the binding partner(s), followed by detection of any target analyte bound to each binding partner. In one embodiment, binding efficiency is increased by the use of segmented transport, wherein a first bolus or bubble of a fluid that is immiscible with the sample precedes the sample during transport and a second bolus or bubble of a fluid that is immiscible with the sample follows the sample. Many configurations are possible for the device of the invention. A preferred device includes: a substrate with a channel formed in its surface, and a cover element that overlies and seals the channel. Binding partner(s) are affixed to the surface of the cover element facing the channel lumen.
Owner:RGT UNIV OF CALIFORNIA

Replicating viral vectors for gene therapy

The present invention concerns the field of gene therapy and in particular the use of specific adenoviral vector systems for gene therapy, said vector systems offering enhanced efficiency and specificity for gene delivery. More specifically, the present invention provides replicating-competent adenoviral vector systems carrying one or more inserted heterologous gene. The adenoviral vectors system according to the invention are characterized by high binding efficiency and infectivity to cells of neural origin, endothelial cells, carcinoma cells and dendritic cells.
Owner:MEI YA FANG +1

Display device, display backboard and production method

The invention provides a display device, a display backboard and a production method and relates to the technical field of display. The production method comprises the steps of providing a substrate base plate; forming a backboard function layer on the substrate base plate, and forming a plurality of grooves located on the backboard function layer, wherein the backboard function layer comprises aplurality of drive thin film transistors, and the drive thin film transistors comprise first electrodes and second electrodes; transferring LED chips to the grooves through adoption of a mass transfertechnology, wherein faces of the LED chips close to the substrate base plate are light emitting faces, and third electrodes and fourth electrodes are set on the faces of the LED chips away from the substrate base plate; and forming a graph of a connection electrode layer, wherein the connection electrode layer comprises first connection electrodes and second connection electrodes, one end of thefirst connection electrodes is connected with the first electrodes of the drive thin film transistors, the other end is connected with the third electrodes of the LED chips, and one end of the secondconnection electrodes is connected with the fourth electrodes of the LED chips. Binding efficiency and binding yield of the LED chips can be improved, and production cost is reduced.
Owner:BOE TECH GRP CO LTD

Capillary array and related methods

The invention provides methods and devices for detecting the presence of one or more target analytes in a sample employing a channel having affixed therein one or more binding partners for each target analyte. Assays are carried out by transporting the sample through the channel to each successive binding partner so that target analyte present in said sample binds to the corresponding binding partner. The sample is then transported beyond the binding partner(s), followed by detection of any target analyte bound to each binding partner. In one embodiment, binding efficiency is increased by the use of segmented transport, wherein a first bolus or bubble of a fluid that is immiscible with the sample precedes the sample during transport and a second bolus or bubble of a fluid that is immiscible with the sample follows the sample. Many configurations are possible for the device of the invention. A preferred device includes: a substrate with a channel formed in its surface, and a cover element that overlies and seals the channel. Binding partner(s) are affixed to the surface of the cover element facing the channel lumen.
Owner:RGT UNIV OF CALIFORNIA

Methods and apparatus that increase sequencing-by-binding efficiency

A method of determining a nucleic acid sequence that includes steps of: (a) contacting a primed template nucleic acid with a series of mixtures for forming ternary complexes, wherein each of the mixtures includes a polymerase and nucleotide cognates for at least two different base types suspected of being present at the next template position of the template nucleic acid; (b) monitoring the next template position for ternary complexes formed by the series of mixtures, wherein a signal state indicates presence or absence of ternary complex formed at the next template position by each individual mixture, thereby determining a series of signal states that encodes a base call for the next template position; and (c) decoding the series of signal states to distinguish a correct base call for the next template position from an error in the base call.
Owner:PACIFIC BIOSCIENCES

Joint enclosing sequence, library construction kit, and construction method of sequencing library

The invention provides a joint enclosing sequence, a library construction kit, and a construction method of a sequencing library. The joint enclosing sequence comprises a P5 joint enclosing sequence containing a sequence represented by SEQ ID NO:1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC, and the 3' terminal of the sequence represented by SEQ ID NO:1 is modified through one modification selected from reverse dT modification, dividing wall modification, dideoxycytidylic acid modification, and phosphorylation modification; the 3' terminal of the joint enclosing sequence is provided with enclosing modification, so that enclosing sequence combination efficiency is increased, non-target region capturing caused by joint connection is reduced, capturing efficiency is increased, and influences of the enclosing sequence on subsequent PCR process are reduced.
Owner:天津诺禾致源生物信息科技有限公司

Rope winding machine used for trees

The invention relates to the field of agricultural machines, in particular to a rope winding machine used for trees. The rope winding machine comprises a bottom fixing device, a rotating device and a rope winding device. The bottom fixing device is installed on the ground, comprises a fixing base, fixing bolts and a first balancing weight and is used for enclosing the trees and providing stable support for the rotating device and the rope winding device. The rotating device comprises a rotating base, a rotating gear, a rotating motor, belt wheels and a belt and is used for driving the rope winding device to move around the trees circumferentially. The rope winding device comprises a vertical rod, a sliding disc, a rope winding tube, a first rotating rod, a second rotating rod, an air cylinder and a second balancing weight. The rope winding device is used for binding straw ropes around the trees from bottom to top. Mechanical operation is used for replacing manual operation to wind the straw ropes around the trees, in this way, rope binding efficiency is effectively improved, labor is saved, and the labor cost is lowered.
Owner:山东艺林市政园林建设集团有限公司

Methods and systems for manufacturing optimized concrete

Design optimization methods can be used to design concrete mixtures having optimized properties, including desired strength and slump at minimal cost. The design optimization methods use a computer-implemented process that is able to design and virtually “test” millions of hypothetical concrete compositions using mathematical algorithms that interrelate a number of variables that affect strength, slump, cost and other desired features. The design optimization procedure utilizes a constant K (or K factor) within Feret's strength equation that varies (e.g., logarithmically) with concrete strength for any given set of raw material inputs and processing equipment. That means that the binding efficiency or effectiveness of hydraulic cement increases with increasing concentration so long as the concrete remains optimized. The knowledge of how the K factor varies with binding efficiency and strength is a powerful tool that can be applied in multiple circumstances. A concrete manufacturing process may include accurately measuring the raw materials to minimize variation between predicted and actual strength, as well as carefully controlling water content throughout the manufacturing and delivery process.
Owner:ICRETE LLC

Display module, binding detection system and binding system

The invention provides a display module, a binding detection system and a binding system and relates to the technical field of display. Whether a COF is qualified or not can be automatically detected, so that the waste of a binding material is reduced and the binding efficiency is improved. The display module comprises a display panel and the COF, wherein the COF is bound to a binding area of the display panel; the display panel also comprises first alignment identifiers; the first alignment identifiers are arranged on at least one side of the binding area along the direction, close to the edge of the display panel, of the binding area; the COF also comprises second alignment identifiers; the second alignment identifiers are in one-to-one correspondence with the first alignment identifiers; the second alignment identifiers are used for being aligned at the first alignment identifiers, wherein the first alignment identifiers are of a hollow structure; the second alignment identifiers are of a solid structure; and the second alignment identifiers can be embedded into the hollow parts of the first alignment identifiers.
Owner:BOE TECH GRP CO LTD +1

Method and system for binding device

Embodiments of the present application provide a method and a system for binding a device. The system comprises devices to be bound, electronic equipment, and a server. The electronic equipment is used for sending a device information acquisition request to a plurality of devices to be bound. The devices to be bound receive the device information acquisition request sent by the electronic equipment, obtain the device information thereof, and send the obtained device information to the electronic equipment. The electronic equipment receives the device information sent by each device to be bound, determines device binding information according to the device information, obtains an account on the server to be bound of each device to be bound, and sends the device binding information and the accounts to the servers. The server receives the device binding information and the accounts sent by the electronic equipment, determines whether the device binding information is correct or not according to pre-stored device binding information, and if it is correct, binds each device to be bound to the corresponding account. The scheme provided by the embodiments of the present application can improve the device binding efficiency and the user experience.
Owner:HANGZHOU EZVIZ NETWORK CO LTD

Car window assembly and binding method thereof

Disclosed are a car window assembly and a binding method thereof. The car window assembly comprises a transparent base and an integrated hard plastic layer covering at least three peripheral sides of the transparent base. The binding method of the car window assembly includes: providing the transparent base; forming the integrated hard plastic layer on the periphery of the transparent base by injection molding to cover at least three peripheral sides of the transparent base. Bond between the plastic layer and glass in the car window assembly is higher, no dislocation occurs, binding efficiency is higher, and production cost is lowered.
Owner:SAINT-GOBAIN GLASS FRANCE

Adhering tool for adhering glass panel to exhaust fume collecting hood

The invention relates to an adhering tool for adhering a glass panel to an exhaust fume collecting hood. The adhering tool comprises a support, and an adhering structure is at least arranged on one side of the support. The adhering tool is characterized in that the adhering structure comprises an upper bearing board, a lower bearing board, two positioning air cylinders, an upper installation board and compression blocks, wherein locating detents are installed on piston rods of the positioning air cylinders and provided with horizontal arms and inclined arms; first positioning blocks are fixed to the horizontal arms; second positioning blocks are fixed to the ends of the inclined arms on at least one side; the upper installation board is fixed above the support; the upper installation board and a top board of the support are spaced vertically; the compression blocks are located over the upper bearing board and driven by a compression air cylinder to vertically and perpendicularly move; the compression blocks press downwards to compress the glass panel to the front end face of the exhaust fume collecting hood for pressure maintaining. The adhering tool has the advantages that structural design is reasonable, the glass panel adheres to the exhaust fume collecting hood accurately and firmly, the binding efficiency and precision are high, a few procedures are needed, and operation is convenient.
Owner:NINGBO FOTILE KITCHEN WARE CO LTD

Card binding method and terminal

The embodiment of the invention discloses a card binding method and a terminal, and relates to the technical field of mobile payment. The invention aims to solve the problems that in the prior art, the operation of a user in the card binding process is tedious and the card binding efficiency is low after the user binds a card for the first time or replaces a terminal. The card binding method disclosed by the embodiment of the invention is applied to the terminal, and the method comprises the steps that a first interface is displayed, and at least two bank cards associated with an account currently logged in by an electronic wallet APP are displayed on the first interface. And determining a to-be-verified bank card and at least one to-be-bound bank card from the at least two bank cards. Anddisplaying a second interface, wherein the second interface is used for prompting the user to input the verification information of the to-be-verified bank card. And sending the verification information to a server to request the server to issue a card application and personalized data corresponding to each to-be-bound bank card to the terminal after the verification is passed according to the verification information so as to complete the binding of the at least one to-be-bound bank card.
Owner:HUAWEI TECH CO LTD

Steel bar binding wire binding hook used for construction site

The invention relates to a steel bar binding wire binding hook used for a construction site. The steel bar binding wire binding hook used for the construction site comprises a binding hook shell body, a second binding hook rod, a third binding hook rod and a locating block; finger grooves are formed in the lower surface of the binding hook shell body, and a mistaken-touch preventing groove is formed in the rear side face of the binding hook shell body; and a gear adjusting swivel plate is installed in the mistaken-touch preventing groove, and a clamping head is connected with the inner side of the gear adjusting swivel plate through a connecting shaft. According to the steel bar binding wire binding hook used for the construction site, by adopting the design of the finger grooves, the mistaken-touch preventing groove, the gear adjusting swivel plate, a hanging rope ring, a sawtooth pressing rod, a binding hook rod, a reset spring, a magnet, anti-slip silicone particles, a hanging strip, a hook-shaped head and a hook block, a user can hold the binding hook more comfortably, the condition that the gear adjusting swivel plate is damaged can be avoided, binding for steel bars with different specifications is facilitated, the steel bar binding efficiency can be increased, the device can be carried conveniently, and safety of the user and other staffs can be guaranteed.
Owner:湖南鑫成建设有限责任公司

Information exchange method based on NFC and system thereof

The information exchange method based on NFC and system thereof comprises that a user device reads an identity of a wearing device in the NFC mode and detects whether or not the user device and the wearing device simultaneously generate a first stage designation action event. If so, transmitting the wireless-access-configuration information of the user device to a wearing device in a NFC manner; the wearing device detects, after receiving the wireless access configuration information of the user device, whether or not the wearing device and the user device simultaneously generate a second stage designation action event. If so, accesses the user device according to the wireless access configuration information of the user device. If so, accessing the user device according to the wireless access configuration information of the user equipment; and transmitting the information to be exchanged for a presence of the wearing device to the user device. The invention has the advantage of improving a binding efficiency between the wearing device and the user device, thereby improving an efficiency of an information exchange between the wearing device and the user device.
Owner:GUANGDONG XIAOTIANCAI TECH CO LTD

Substrate for biochip and method of manufacturing the substrate

A substrate for a biochip and a method of manufacturing the substrate. The substrate for a biochip having nanostructured spots formed on a base to which probe biomolecules are attached are, improving the binding efficiency between the substrate and the spots, and improving the efficiency in the detection of the biomolecules as well.
Owner:SAMSUNG ELECTRONICS CO LTD

Mycoplasma hyopneumoniae antibody detection kit and manufacture method thereof

The invention belongs to the detection field of biotechnology and particularly relates to a mycoplasma hyopneumoniae antibody detection kit and a manufacture method thereof. A solid carrier is wrapped by a link-coupled mycoplasma hyopneumoniae peculiar polypeptide antigen, and the manufactured mycoplasma hyopneumoniae peculiar polypeptide antigen enzyme-linked immuno sorbent assay (ELISA) detection kit is used for clinical detection of mycoplasma hyopneumoniae infection, epidemiological investigation and immunologic surveillance. The non-protein polymer directional link-coupled mycoplasma hyopneumoniae peculiar polypeptide antigen serves as the wrapping solution, the combination efficiency of polypeptide and a target antibody is effectively improved, accordingly, detection sensitivity is remarkably improved, non-singular background value reading is remarkably reduced simultaneously, the specificity is high, and the detection kit has the advantages of being easy to operate, fast in diagnosis, economic and convenient in large-scale detection and the like. The manufacture method is convenient to popularize and has wide application prospect. When the kit is used for detecting samples, the using amount of the wrapping antigen can be reduced to 10ng / ml, so that cost is reduced, and popularization and using are facilitated.
Owner:GUANGDONG HAID ANIMAL HUSBANDRY & VETERINARY RES INST +1

Method for preparing g-C3N4/MoS2 nanocomposite with vulcanizing sintering method

The invention provides a method for preparing a g-C3N4 / MoS2 nanocomposite with a vulcanizing sintering method. The method comprises steps as follows: (1), mixing: thiourea and molybdenum trioxide are weighed and are placed in a ball milling tank to be subjected to ball milling, so that thiourea and molybdenum trioxide are mixed sufficiently, and grey white powder is obtained; (2), sintering: the grey white powder obtained in the step (1) is placed in a corundum crucible, the corundum crucible is put in a tube furnace with introduction of inert gas, the grey white powder is heated to 550-650 DEG C, subjected to heat preservation and then naturally cooled to the room temperature, and grey black powder is obtained and is the g-C3N4 / MoS2 nanocomposite. The binding efficiency of thiourea and molybdenum trioxide can be improved by the aid of g-C3N4 / MoS2 heterojunction prepared through high-temperature vulcanization by the tube furnace, and meanwhile, oxidation resistance, deliquescence resistance and heavy load resistance of MoS2 as a lubricant can be greatly improved when MoS2 is modified with g-C3N4.
Owner:JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More