Fast CRISPR-Cas9 working efficiency testing system and application thereof

A technology for testing system and work efficiency, applied in genetic engineering, virus/phage, microbial assay/inspection, etc., can solve the problems of gene editing efficiency and inability to accurately test the pros and cons of sgRNA

Inactive Publication Date: 2016-06-08
ZHEJIANG UNIV
View PDF4 Cites 77 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the broken DNA in this reporter system is repaired by a specific, repeat-mediated SSA, rather than HR and NHEJ utilized by CRISPR technology, this method does not test the true gene editing efficiency , and cannot accurately test the pros and cons of sgRNA, and the selected target gene fragments need to be cloned or amplified to obtain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast CRISPR-Cas9 working efficiency testing system and application thereof
  • Fast CRISPR-Cas9 working efficiency testing system and application thereof
  • Fast CRISPR-Cas9 working efficiency testing system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Application of the CRISPR / Cas9 work efficiency test system based on the pBGN plasmid containing the BSD-fsEGFP fusion gene (screening sgRNA targeting the mouse FBXW7 gene)

[0056] (1) BSD-fsEGFP fusion gene: use conventional PCR to amplify the known BSD gene, 5'-PCR primers with HindIII sites, and 3'-PCR primers to introduce I-SceI and EcoRI sites. The PCR product (BSD) is inserted into the HindIII and EcoRI sites between the CMV driver and the EGFP coding region in the EGFP plasmid (the EGFP nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2), generating Plasmid pBGN containing BSD-fsEGFP fusion gene ( image 3 ), the nucleotide sequence of the BSD-fsEGFP fusion gene is shown in SEQ ID NO.3, and the amino acid sequence is shown in SEQ ID NO.4. The fusion gene is driven by CMV driver or PGK driver, but EGFP is inactive due to frameshift, so it is called fsEGFP.

[0057] 5'-PCR primers are

[0058] CTCAAGCTTAAC...

Embodiment 2

[0072] Example 2: Application of the CRISPR / Cas9 work efficiency test system based on the pBLuc plasmid containing the BSD-fsFLuc fusion gene (screening the sgRNA targeting the mouse MDC1 gene)

[0073] (1) Utilize conventional PCR amplification system and condition, PCR amplifies FLuc gene (nucleotide sequence is shown in SEQIDNO.5, aminoacid sequence is shown in SEQIDNO.6), 5'-PCR primer band KpnI site, 3 '-primer with NotI site. The PCR product (FLuc) replaced the EGFP part between KpnI and NotI in the plasmid pBGN (containing BSD-fsEGFP) to generate the BSD-fsFLuc plasmid pBLuc ( Figure 4 ), FLuc is inactive due to frameshift, so it is called fsFLuc. The nucleotide sequence of the BSD-fsFLuc fusion gene is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO.8.

[0074] 5'-PCR primers are

[0075] GACGGTACCGCGGGCCCGGGATCCATCGCCACCATGGAAGATGCCAAAAAC,

[0076] The 3'-PCR primer was AGTCGCGGCCGCTTTACACGGCGATCTTGCCGC.

[0077] (2) Similar to Example 1,...

Embodiment 3

[0093] Example 3: Screening of sgRNA targeting human hypoxanthine phosphoribosyltransferase HPRT and application of human HPRT gene editing (knockout)

[0094] (1) The construction of pBGN is the same as in Example 1.

[0095] (2) Utilize the CRISPR / Cas9 gene editing test system of the present invention to screen the best sgRNA for gene editing (knockout) of human cell hypoxanthine phosphoribosyltransferase HPRT. Embodiment is with embodiment 1. First, seven different sgRNAs were designed for the human HPRT gene using www.crispr.mit.edu website.

[0096] Six human HPRTsgRNA expression sequences and targeting sequences, the underlined part indicates the PAM motif:

[0097] sgRNA0 expression sequence 5'to3'GTGCTTTGATGTAATCCAGC

[0098] sgRNA0 target sequence 5'to3'GTGCTTTGATGTAATCCAGC AGG

[0099] sgRNA1 expression sequence 5'to3'TAAATTCTTTGCTGACCTGC

[0100] sgRNA1 target sequence 5'to3'TAAATTCTTTGCTGACCTGC TGG

[0101] sgRNA2 expression sequence 5'to3'TGTAGCCCCTCTGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fast CRISPR-Cas9 working efficiency testing system and application thereof. The testing system comprises a plasmid used for expressing sg RNA, a plasmid used for expressing Cas9 and a reporting system used for testing the CRISPR-Cas9 gene editing efficiency; the reporting system can splice the C-terminal of a nucleotide segment capable of coding effective protein and the N-terminal of a reporter gene and insert two restriction endonuclease enzyme digestion sites into the splicing position; before a special gene is edited (knocked out) through the CRISPR-Cas9 system, selection of a target sequence is vital, and the selection can influence the recognition efficiency of the sg RNA to target DNA, the binding efficiency of the sg RNA with the target DNA, the targeted cutting efficiency of the Cas9 and the NHEJ repairing efficiency. According to the system, the gene editing efficiency of different sgRNA-target DNA sequences can be quantitatively compared, the sgRNA with the best working effect can be determined within a short time, the actual knockout success rate is increased, therefore, the working cost can be lowered, the working efficiency can be improved, and the working progress can be promoted.

Description

(1) Technical field [0001] The invention relates to a CRISPR / Cas9 working efficiency testing system and its application, which can quickly, easily and accurately test the gene editing efficiency mediated by CRISPR / Cas9 sgRNA at the cellular level, and can be effectively used for gene editing (knockout, mutation, etc.) , knock-in) sgRNA. (2) Background technology [0002] Clustered, regularly interspersed short palindromic repeats CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) is currently the most efficient genome editing system, which is transformed from an immune mechanism that degrades invading viral DNA or other foreign DNA from bacteria and archaea Come. It consists of three components: Cas9 protein, crRNA (CRISPR-associated RNA) and tracrRNA (trans-activatingcrRNA). The Cas9 protein containing two nuclease domains (RuvC and HNH) first binds to crRNA and tracrRNA to form a complex, and then recognizes and binds to the PAM (protospace radjacent mot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12Q1/68C12Q1/66
CPCC07K14/43595C12N9/0059C12N9/0069C12N9/2471C12N9/78C12N15/113C12N15/85C12N2310/10C12N2800/107C12N2800/80C12N2810/10C12Q1/6811C12Q1/6897C12Q2600/156C12Y110/03001C12Y113/12007C12Y302/01023C12Y305/04023C12Q2563/107C12Q2565/626
Inventor谢安勇郭涛冯依力
OwnerZHEJIANG UNIV