Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

771results about How to "Improve binding efficiency" patented technology

Fluorescence immunochromatography device for detecting COVID-19 and using method thereof

The invention discloses a fluorescence immunochromatography device for detecting a novel coronavirus COVID-19 and a using method of the fluorescence immunochromatography device. The fluorescence immunochromatography device disclosed by the invention is high in sensitivity and strong in specificity, the accuracy is high, the detection sensitivity can reach 10pg / ml, the detection speed is high, theoperation is simple, the device is portable, the requirement for personnel is low, the operation of professionals is not needed, the detection cost is low, the device can be applied to preliminary screening of various places such as hospitals, airports, customs and disease control centers, the detection time (10-15 min) is short, a simpler, more convenient and faster field detection means is provided for suspected patient investigation and asymptomatic infected person screening, and therefore epidemic spreading is prevented as soon as possible.
Owner:SHENZHEN BIOEASY BIOTECHNOLOGY CO LTD

Method and device for binding equipment

The present disclosure relates to a method and a device for binding equipment, belonging to the technical field of computer, wherein the method comprises the steps as follows: receiving a binding request transmitted by a terminal, wherein the binding request comprises a device identification of electronic equipment to be bound and a user account corresponding to the terminal; detecting whether there is conversion record corresponding to the user account and the device identification in a server; and binding the user account and the device identification when there is conversion record corresponding to the user account and the device identification in the server. The method and the device solve the problem that the binding process is complicated and inefficient because the electronic equipment only can be determined as the electronic equipment owned by the user according to the operation of the user to the electronic equipment and improves the binding efficiency of the equipment.
Owner:XIAOMI INC

Quinolizinones compound and preparation method and application thereof

The invention discloses a quinolizinones compound which comprises an optical isomer, a raceme and a cis-trans-isomer and a random combination or pharmaceutical salt thereof. A structure of the quinolizinones compound is as shown in a formula I: (with reference to the specification), wherein one of V and Y is O, and the other one of V and Y is CR8R9; R8 and R9 respectively independently are hydrogen or C1-6 alkyl. The invention further discloses a preparation method and application of the compound in the formula I. The compound in the formula I can obviously reduce a HBsAg (Hepatitis B surface antigen) level in vivo and meanwhile, inhibit replication of a HBV (Hepatitis B Virus), wherein when V or Y is O, solubility of the compound is obviously improved, the compound has excellent medicinal attributes and meanwhile, is also low in toxicity, pharmacokinetics and pharmacodynamics functions are improved, efficiency of combining with the HBV can be greatly improved, and a clearance ratio of the HBV in vivo can also be further improved.
Owner:河南春风医药科技有限公司

Display device, display backboard and production method

The invention provides a display device, a display backboard and a production method and relates to the technical field of display. The production method comprises the steps of providing a substrate base plate; forming a backboard function layer on the substrate base plate, and forming a plurality of grooves located on the backboard function layer, wherein the backboard function layer comprises aplurality of drive thin film transistors, and the drive thin film transistors comprise first electrodes and second electrodes; transferring LED chips to the grooves through adoption of a mass transfertechnology, wherein faces of the LED chips close to the substrate base plate are light emitting faces, and third electrodes and fourth electrodes are set on the faces of the LED chips away from the substrate base plate; and forming a graph of a connection electrode layer, wherein the connection electrode layer comprises first connection electrodes and second connection electrodes, one end of thefirst connection electrodes is connected with the first electrodes of the drive thin film transistors, the other end is connected with the third electrodes of the LED chips, and one end of the secondconnection electrodes is connected with the fourth electrodes of the LED chips. Binding efficiency and binding yield of the LED chips can be improved, and production cost is reduced.
Owner:BOE TECH GRP CO LTD

Joint enclosing sequence, library construction kit, and construction method of sequencing library

The invention provides a joint enclosing sequence, a library construction kit, and a construction method of a sequencing library. The joint enclosing sequence comprises a P5 joint enclosing sequence containing a sequence represented by SEQ ID NO:1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC, and the 3' terminal of the sequence represented by SEQ ID NO:1 is modified through one modification selected from reverse dT modification, dividing wall modification, dideoxycytidylic acid modification, and phosphorylation modification; the 3' terminal of the joint enclosing sequence is provided with enclosing modification, so that enclosing sequence combination efficiency is increased, non-target region capturing caused by joint connection is reduced, capturing efficiency is increased, and influences of the enclosing sequence on subsequent PCR process are reduced.
Owner:天津诺禾致源生物信息科技有限公司

Detection kit for ischemia modified albumin

The invention relates to the technical field of detection of ischemia modified albumin content, and in particular to a detection kit for ischemia modified albumin. The kit includes a reagent 1 and a reagent 2. The reagent 1 contains a buffer, cobalt chloride, a stabilizer and a preservative; and the reagent 2 contains a buffer, dithiothreitol, a stabilizer, a reducing protective agent and a preservative. The kit can accelerate the binding efficiency of cobalt ions with normal albumin, and the cobalt ions fully integrate with normal albumin in a certain period of time, so as to ensure the accuracy of the detection result on a sample by the reagent; the kit protects the stability of dithiothreitol in the solution, and does not affect the binding of dithiothreitol with cobalt ions, so as to ensure that an open reagent bottle can be stably kept in a dark place for 30 days at room temperature and a closed reagent bottle can be stably kept at 2-8 DEG C for 12 months, and fully meet the needs of clinical laboratory; and the kit accelerates the combination of dithiothreitol with cobalt ions, so that the reagents reach reaction endpoints as soon as possible, thereby ensuring the efficient detection effect of reagents and significantly improving the accuracy of reagent detection.
Owner:BIOBASE BIODUSTRY (SHANDONG) CO LTD

Methods and kits for reducing non-specific nucleic acid amplification

Methods and kits for efficient amplification of nucleic acids are provided. The disclosure generally relates to methods and kits for nucleic acid amplification of target nucleic acids of interest. The methods described herein promote the synthesis of the target nucleic acid (i.e., template nucleic acid) by reducing the production of undesirable primer-dimer structures and chimeric nucleic acid products during the amplification process by using novel modified primers.
Owner:GLOBAL LIFE SCI SOLUTIONS OPERATIONS UK LTD

Smart device binding method and device

The invention relates to the technical field of communication, in particular to a smart device binding method and device. The method comprises the following steps: monitoring WIFI broadcasting initiated by a client to acquire device binding information broadcast by the client, wherein the device binding information comprises device networking information, device identifier (DID) information of a smart device acquired by the client from a business platform, address information of a device cloud platform connected with the business platform, and validation information used to access the device cloud platform; accessing an external network based on the device networking information, and generating a unique DID based on an SN and the DID information of the smart device; and accessing the device cloud platform based on the address information of the device cloud platform, the validation information and the unique DID, sending the unique DID to the client, and notifying the client to send adevice binding request to the business platform, so that the business platform can be triggered to complete binding between a user account and the unique DID. The smart device binding method has the advantages that the device binding efficiency and the user experience can be improved.
Owner:CHINA MOBILEHANGZHOUINFORMATION TECH CO LTD +1

Method and system for binding device

Embodiments of the present application provide a method and a system for binding a device. The system comprises devices to be bound, electronic equipment, and a server. The electronic equipment is used for sending a device information acquisition request to a plurality of devices to be bound. The devices to be bound receive the device information acquisition request sent by the electronic equipment, obtain the device information thereof, and send the obtained device information to the electronic equipment. The electronic equipment receives the device information sent by each device to be bound, determines device binding information according to the device information, obtains an account on the server to be bound of each device to be bound, and sends the device binding information and the accounts to the servers. The server receives the device binding information and the accounts sent by the electronic equipment, determines whether the device binding information is correct or not according to pre-stored device binding information, and if it is correct, binds each device to be bound to the corresponding account. The scheme provided by the embodiments of the present application can improve the device binding efficiency and the user experience.
Owner:HANGZHOU EZVIZ NETWORK CO LTD

Light-emitting diode (LED) epitaxial layer structure and LED chip with same

The invention provides a light-emitting diode (LED) epitaxial layer structure and an LED chip with the same. The epitaxial layer structure comprises an MQW layer, an electronic barrier layer and a P-type GaN hole injection layer, which sequentially grow, wherein the P-type GaN hole injection layer comprises a hole injection layer and also a P-type AlGaN / GaN superlattice layer growing between the electronic barrier layer and the hole injection layer. According to the LED epitaxial layer structure provided by the invention, an MQW protective layer is arranged between the electronic barrier layer and the MQW layer, and then the P-type AlGaN / GaN superlattice layer is arranged on the electronic barrier layer, so that even diffusion of the hole is facilitated by a two-dimensional carrier gas formed by the P-type AlGaN / GaN superlattice layer, and the joint efficiency between electronics and holes is improved.
Owner:XIANGNENG HUALEI OPTOELECTRONICS

Construction and application of bispecific antibody EpCAMxCD3

The present invention provides a bispecific antibody. The bispecific antibody provided by the present invention comprises a single-chain unit and a monovalent unit, wherein the single-chain unit has a specific binding capability against surface antigen CD3 of an immune cell; the monovalent unit has a specific binding capability against the surface antigen EpCAM of a tumor cell; the single-chain unit comprises a single-chain variable fragment ScFv fused with an Fc fragment; and the monovalent unit comprises a light chain and heavy chain pair. The present invention also provides a preparation method of the bispecific antibody and pharmaceutical use of these antibodies.
Owner:WUHAN YZY BIOPHARMA CO LTD

Construction method of long open-cut tunnel

The invention discloses a construction method of a long open-cut tunnel, comprising the following steps of: after reducing ground water level by utilizing precipitation of a tube well, carrying out the slope excavation to be the designed height, sequentially constructing a bed course, waterproof roll and inverted arch and filling, carrying out secondary lining by using inner and outer mould trolleys, constructing external coverage and waterproof engineering, back-filling and compacting. The invention has the advantages that: the construction method has strong scene maneuverability, is easy to popularize, ensures the construction safety, and improves the construction quality of the long open-cut tunnel.
Owner:CHINA RAILWAY NO 2 ENG GRP CO LTD +1

Gene vector system, its preparation and application

The invention discloses a gene vector system of a redox sensitive shielding system having targeting function, its preparation and application in the field of gene therapy. The gene vector system disclosed herein comprises a redox sensitive shielding system having targeting function, a cationic high-molecular material and plasmid DNA; wherein the cationic high-molecular material and plasmid DNA form compound particles, the redox sensitive shielding system having targeting function shields the compound surface by electrostatic action, thus the toxicity of the vector can be reduced, the loaded genetic material is transferred into the cell successfully, the expression of the genetic material is realized, the transfection process is completed, the targeting of gene transfection can be raised, and simultaneously the gene transfection efficiency is raised.
Owner:SICHUAN UNIV

Automatic winding and bundling device for connecting wires

The invention belongs to the technical field which is suitable for winding and bundling connecting wires or guide wires, and discloses an automatic winding and bundling device for connecting wires, which comprises a rack provided with a guide groove, wherein the rack is provided with a winding device, a winding conveying device, a bundling device, a twisting and bundling device, a device for feeding cable ties and cutting cable ties, and a circuit and gas circuit control device for controlling the above devices to operate coordinately, wherein the winding conveying device is connected with the guide groove or a guide rail on the rack through a winding conveying rack; and the winding conveying rack is also connected with the output end of a winding conveying cylinder fixed on the rack. As the connecting wire can be automatically bundled by the bundling device, on one hand, the bundling efficiency of the connecting wire can be improved; on the other hand, the cable ties needs not to be cut to a certain length in advance, thus avoiding the wastes of labors and cable ties caused by cutting in advance.
Owner:刘光辉

Display module, binding detection system and binding system

The invention provides a display module, a binding detection system and a binding system and relates to the technical field of display. Whether a COF is qualified or not can be automatically detected, so that the waste of a binding material is reduced and the binding efficiency is improved. The display module comprises a display panel and the COF, wherein the COF is bound to a binding area of the display panel; the display panel also comprises first alignment identifiers; the first alignment identifiers are arranged on at least one side of the binding area along the direction, close to the edge of the display panel, of the binding area; the COF also comprises second alignment identifiers; the second alignment identifiers are in one-to-one correspondence with the first alignment identifiers; the second alignment identifiers are used for being aligned at the first alignment identifiers, wherein the first alignment identifiers are of a hollow structure; the second alignment identifiers are of a solid structure; and the second alignment identifiers can be embedded into the hollow parts of the first alignment identifiers.
Owner:BOE TECH GRP CO LTD +1

Human serum amyloid protein A determination kit with high sensitivity and wide detection range

The embodiment of the invention relates to the field of immunodetection, in particular to a human serum amyloid protein A determination kit with high sensitivity and a wide detection range. The humanserum amyloid protein A determination kit comprises a reagent 1, a reagent 2 and SAA calibrators with different concentration gradients, wherein the reagent 2 comprises carboxylated latex microspheresonly labeled with human SAA monoclonal antibodies and carboxylated latex microspheres only labeled with human SAA polyclonal antibodies; the average particle size of the carboxylated latex microspheres only labeled with the human SAA monoclonal antibodies is larger than the average particle size of the carboxylated latex microspheres only labeled with the human SAA polyclonal antibodies. The kitcan be used for detecting a single sample within 10 minutes; the kit has the advantages that the kit is simple in structure and excellent in precision, accuracy, linearity, interference resistance andother indexes, can well diagnose early inflammation of infectious diseases, can detect the content of SAA in serum and the content of SAA in blood plasma, is very suitable for clinical biochemical analyzers, and greatly facilitates clinical examination.
Owner:BEIJING BEIER BIOENG

Protein A immuo adsorption material and preparing method

The present invention relates to a protein A immunoadsorption material for purifying blood and its preparation method. Said protein A immunoadsorption material is a high-molecular material which is obtained by using agarose gel as carrier matrix, making said agarose gel be reacted with diglycidyl ether coupling reagent to obtain active carrier, then making said active carrier and protein A implement coupling reaction. Said invention can be used for making clinical immunoadsorption therapy.
Owner:GUANGZHOU KONCEN BIOSCI +1

Method, device and system for establishing binding relationship between account and device

The invention relates to a method, device and system for establishing a binding relationship between an account and a device, and belongs to the technical field of computers. The method comprises: transmitting a device binding request carrying a first group identification group to a server; receiving a device identification of each device in a region device group corresponding to the first identification group transmitted by the server; displaying options of each device; and receiving option commands corresponding to the options of a target device in the devices, and transmitting the device identification of the target device to the server. By adopting the invention, the efficiency of binding the account and the device can be improved.
Owner:BEIJING XIAOMI MOBILE SOFTWARE CO LTD

Wood pallet assembling and nailing device

The invention discloses a wood pallet assembling and nailing device which comprises a wood pallet assembling and nailing assembly line. A plurality of wood pallet stacking brackets are carried on the wood pallet assembling and nailing assembly line and shaped like a Chinese character 'tian'. Each wood pallet stacking bracket is provided with nine stilt through grooves at nine interaction corners of the wood pallet stacking bracket respectively and correspondingly, wherein the nine stilt through grooves are matched with wood pallet stilts in shape and size. One side of each stilt through groove is provided with a stilt pushing air cylinder, wherein the stilt pushing air cylinders are used for pushing the wood pallet stilts to the stilt through grooves. Each wood pallet stacking bracket is further provided with a wood pushing air cylinder, wherein the wood pushing air cylinders are used for pushing wood boards to be nailed of wood pallets to the wood pallet stilts. By the adoption of the structure, the wood pallet assembling and nailing device can improve assembling and nailing efficiency substantially.
Owner:邹建静

Fusion protein used for single-cell ChIP-seq library preparation and application thereof

The invention relates to a fusion protein used for single-cell ChIP-seq library preparation and application thereof. The fusion protein comprises Tn5 transposase and an Fc binding protein; a kit comprises the fusion protein and other auxiliary detection reagents; a method uses the fusion protein or the kit for ChIP-seq detection. The fusion protein, the kit and the method can improve the library building efficiency and lower the library background in the ChIP-seq detection process, so that the accuracy of the ChIP-seq detection method can be improved, and the experimental flow of ChIP-seq canbe simplified.
Owner:PEKING UNIV

Bookbinding machine and prebinding apparatus

In a bookbinding machine, an image forming apparatus, a prebinding apparatus and a bookbinding apparatus are coupled on line in this order. In the prebinding apparatus, a sheet aligning section, a slitting section which cuts off margins at both side portions of a sheet of paper, a cutting section which cuts off top and bottom margins, and a creasing section are arranged in this order. The prebinding apparatus is provided with a control section which sorts out supplied sheets of paper into those which need an SCC step and those which do not, and performs the SCC step only on the sheets of paper that need the SCC step.
Owner:DUPLO CORP

Method for manufacturing aluminum/magnesium/aluminum composite plate on three-dimensional layer interface

ActiveCN110181227AIncrease the bonding force between platesImprove interface bonding strength and bonding efficiencyMetal rolling arrangementsNon-electric welding apparatusAluminum compositesSmooth surface
The invention discloses a method for manufacturing an aluminum / magnesium / aluminum composite plate on a three-dimensional layer interface. The method comprises the steps of firstly, machining the three-dimensional interfaces matched with each other on magnesium alloy plates and aluminum alloy plates; cleaning to-be-bonded surfaces of the magnesium alloy plates and the aluminum alloy plates; stacking and assembling the magnesium alloy plates and the aluminum alloy plates alternately in a mutually meshing mode to obtain a composite plate blank; repeatedly carrying out unidirectional ultrasonic temperature change and load change hot pressing to fill a mold; and carrying out hot rolling to obtain the tightly bonded composite plate. According to the method, a two-step thermal deformation methodcombining hot pressing and rolling is adopted to obtain the laminated plate with uniform thickness, smooth surface and relatively high surface quality, the process is simple, the energy consumption islow, the quality of the composite plate is high, and the method is suitable for application and popularization.
Owner:TAIYUAN UNIV OF TECH

Compound for treating or preventing hepatitis B virus infection and preparation method and application thereof

The invention discloses a compound taking quinolizine ketone as a mother nucleus and for treating or preventing hepatitis B virus infection. The compound comprises optical isomer, raceme, cis-trans-isomer and any combination thereof or medicinal salt thereof. The invention further discloses a preparation method and application of the compound. The compound can remarkably lower in-vivo HBsAg leveland inhibit duplication of HBV, has good medicinal attribute and is low in toxicity, and pharmacokinetic and pharmacodynamic functions are improved; efficiency of combining with the HBV can be improved greatly, and clearance rate of in-vivo HBV can be further increased.
Owner:河南春风医药科技有限公司

Blood purifying protein A immunoadsorption material and synthesizing method thereof

The invention relates to a staphylococcal protein A (SPA) immunoadsorption material used for blood purification and a preparation method thereof. The invention discloses a macromolecule material which is coupled by agarose gel and SPA. The material is prepared by taking the agarose gel as carrier substrate which is reacted with epoxy bromopropane to obtain the epoxy-based active carrier; after that, polyamines reagent is taken as a space arm which is then reacted with carbonyl diimidazole and is then coupled with the SPA. The material has the advantages of short synthesis time, safe preparation, strong specificity of product, high adsorption efficiency and good regeneration performance to immunoglobulin and the compound thereof, and being able to be applied to clinic immunoadsorption cure.
Owner:GUANGZHOU KONCEN BIOSCI +1

Preparation method of latex particles coated with prostate specific antigen-antibody and PSA enhanced turbidimetric immunophelometry kit

The invention relates to a preparation method of latex particles coated with a prostate specific antigen-antibody (PSA) and a PSA-enhanced turbidimetric immunophelometry kit. The latex particles coated with the PSA antibody are prepared by bonding the PSA antibody with latex particles by an optimized physical adsorption method. According to the invention, the kit utilizes the PSA antibody bonded onto the surface of the latex particles and the PSA in the human blood sample to conduct immunoreaction to form the turbidity, and the kit detects the content of the prostate specific antigen-antibody by the increase of the turbidity.
Owner:BEIJING STRONG BIOTECH INC

Mass spectrometry method for polypeptides

ActiveUS20170016910A1Prevent suppression of ionizationReduce loss of the target polypeptideBiological material analysisBiological testingBiological bodyMass Spectrometry-Mass Spectrometry
Provided is a method for measuring a target polypeptide in a biological sample abundantly containing impurities by mass spectrometry. A method for measuring a target polypeptide in a biological sample includes: a first reaction step of bringing a liquid containing a biological sample into contact with a first antibody-immobilizing carrier to bind the target polypeptide in the biological sample with the first carrier; a first washing step of washing the first carrier; a first eluting step of eluting the target polypeptide from the first carrier by using an acidic solution to obtain a first eluate; a neutralizing step of obtaining a first purified solution by adding a neutral buffer to the first eluate; a second reaction step of bringing the first purified solution into contact with a second antibody-immobilizing carrier, to bind the target polypeptide in the first purified solution with the second carrier; a second washing step of washing the second carrier; a second eluting step of eluting the target polypeptide from the second carrier by using an acidic solution to obtain a second purified solution; and a step of detecting the target polypeptide in the second purified solution by mass spectrometry.
Owner:SHIMADZU CORP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More