768results about How to "Improve binding efficiency" patented technology

Disclosed herein is a SERS sensing surface device comprising a substrate supporting a plurality of nano structures, an exposed sensing surface upon the nano structures, wherein said surface includes at least one active SERS nano surface and at least one inactive SERS nano surface established in proximity to the active SERS nano. Also disclosed are methods for forming the array device, systems based on the array device, as well as methods for performing SERS with the array device.

The invention discloses a fluorescence immunochromatography device for detecting a novel coronavirus COVID-19 and a using method of the fluorescence immunochromatography device. The fluorescence immunochromatography device disclosed by the invention is high in sensitivity and strong in specificity, the accuracy is high, the detection sensitivity can reach 10pg/ml, the detection speed is high, theoperation is simple, the device is portable, the requirement for personnel is low, the operation of professionals is not needed, the detection cost is low, the device can be applied to preliminary screening of various places such as hospitals, airports, customs and disease control centers, the detection time (10-15 min) is short, a simpler, more convenient and faster field detection means is provided for suspected patient investigation and asymptomatic infected person screening, and therefore epidemic spreading is prevented as soon as possible.

The invention provides novel methods for the separation of charged molecules such as proteins according to the isoelectric points (pI's) and includes the systems and buffering compositions employed for isolating charged molecules. The invention further provides for modifications to the above described chromatographic methods that enable the separation of charged molecules exhibiting virtually identical pI's by shifting both the buffer's pKa and the pI's of the eluted charged molecules while they are traversing the ion exchange column.

The invention discloses a quinolizinones compound which comprises an optical isomer, a raceme and a cis-trans-isomer and a random combination or pharmaceutical salt thereof. A structure of the quinolizinones compound is as shown in a formula I: (with reference to the specification), wherein one of V and Y is O, and the other one of V and Y is CR8R9; R8 and R9 respectively independently are hydrogen or C1-6 alkyl. The invention further discloses a preparation method and application of the compound in the formula I. The compound in the formula I can obviously reduce a HBsAg (Hepatitis B surface antigen) level in vivo and meanwhile, inhibit replication of a HBV (Hepatitis B Virus), wherein when V or Y is O, solubility of the compound is obviously improved, the compound has excellent medicinal attributes and meanwhile, is also low in toxicity, pharmacokinetics and pharmacodynamics functions are improved, efficiency of combining with the HBV can be greatly improved, and a clearance ratio of the HBV in vivo can also be further improved.

The invention provides a joint enclosing sequence, a library construction kit, and a construction method of a sequencing library. The joint enclosing sequence comprises a P5 joint enclosing sequence containing a sequence represented by SEQ ID NO:1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC, and the 3' terminal of the sequence represented by SEQ ID NO:1 is modified through one modification selected from reverse dT modification, dividing wall modification, dideoxycytidylic acid modification, and phosphorylation modification; the 3' terminal of the joint enclosing sequence is provided with enclosing modification, so that enclosing sequence combination efficiency is increased, non-target region capturing caused by joint connection is reduced, capturing efficiency is increased, and influences of the enclosing sequence on subsequent PCR process are reduced.

Methods and kits for efficient amplification of nucleic acids are provided. The disclosure generally relates to methods and kits for nucleic acid amplification of target nucleic acids of interest. The methods described herein promote the synthesis of the target nucleic acid (i.e., template nucleic acid) by reducing the production of undesirable primer-dimer structures and chimeric nucleic acid products during the amplification process by using novel modified primers.

The invention relates to the technical field of communication, in particular to a smart device binding method and device. The method comprises the following steps: monitoring WIFI broadcasting initiated by a client to acquire device binding information broadcast by the client, wherein the device binding information comprises device networking information, device identifier (DID) information of a smart device acquired by the client from a business platform, address information of a device cloud platform connected with the business platform, and validation information used to access the device cloud platform; accessing an external network based on the device networking information, and generating a unique DID based on an SN and the DID information of the smart device; and accessing the device cloud platform based on the address information of the device cloud platform, the validation information and the unique DID, sending the unique DID to the client, and notifying the client to send adevice binding request to the business platform, so that the business platform can be triggered to complete binding between a user account and the unique DID. The smart device binding method has the advantages that the device binding efficiency and the user experience can be improved.

Embodiments of the present application provide a method and a system for binding a device. The system comprises devices to be bound, electronic equipment, and a server. The electronic equipment is used for sending a device information acquisition request to a plurality of devices to be bound. The devices to be bound receive the device information acquisition request sent by the electronic equipment, obtain the device information thereof, and send the obtained device information to the electronic equipment. The electronic equipment receives the device information sent by each device to be bound, determines device binding information according to the device information, obtains an account on the server to be bound of each device to be bound, and sends the device binding information and the accounts to the servers. The server receives the device binding information and the accounts sent by the electronic equipment, determines whether the device binding information is correct or not according to pre-stored device binding information, and if it is correct, binds each device to be bound to the corresponding account. The scheme provided by the embodiments of the present application can improve the device binding efficiency and the user experience.

The invention discloses a construction method of a long open-cut tunnel, comprising the following steps of: after reducing ground water level by utilizing precipitation of a tube well, carrying out the slope excavation to be the designed height, sequentially constructing a bed course, waterproof roll and inverted arch and filling, carrying out secondary lining by using inner and outer mould trolleys, constructing external coverage and waterproof engineering, back-filling and compacting. The invention has the advantages that: the construction method has strong scene maneuverability, is easy to popularize, ensures the construction safety, and improves the construction quality of the long open-cut tunnel.

The invention belongs to the technical field which is suitable for winding and bundling connecting wires or guide wires, and discloses an automatic winding and bundling device for connecting wires, which comprises a rack provided with a guide groove, wherein the rack is provided with a winding device, a winding conveying device, a bundling device, a twisting and bundling device, a device for feeding cable ties and cutting cable ties, and a circuit and gas circuit control device for controlling the above devices to operate coordinately, wherein the winding conveying device is connected with the guide groove or a guide rail on the rack through a winding conveying rack; and the winding conveying rack is also connected with the output end of a winding conveying cylinder fixed on the rack. As the connecting wire can be automatically bundled by the bundling device, on one hand, the bundling efficiency of the connecting wire can be improved; on the other hand, the cable ties needs not to be cut to a certain length in advance, thus avoiding the wastes of labors and cable ties caused by cutting in advance.

The embodiment of the invention relates to the field of immunodetection, in particular to a human serum amyloid protein A determination kit with high sensitivity and a wide detection range. The humanserum amyloid protein A determination kit comprises a reagent 1, a reagent 2 and SAA calibrators with different concentration gradients, wherein the reagent 2 comprises carboxylated latex microspheresonly labeled with human SAA monoclonal antibodies and carboxylated latex microspheres only labeled with human SAA polyclonal antibodies; the average particle size of the carboxylated latex microspheres only labeled with the human SAA monoclonal antibodies is larger than the average particle size of the carboxylated latex microspheres only labeled with the human SAA polyclonal antibodies. The kitcan be used for detecting a single sample within 10 minutes; the kit has the advantages that the kit is simple in structure and excellent in precision, accuracy, linearity, interference resistance andother indexes, can well diagnose early inflammation of infectious diseases, can detect the content of SAA in serum and the content of SAA in blood plasma, is very suitable for clinical biochemical analyzers, and greatly facilitates clinical examination.

The present invention relates to a protein A immunoadsorption material for purifying blood and its preparation method. Said protein A immunoadsorption material is a high-molecular material which is obtained by using agarose gel as carrier matrix, making said agarose gel be reacted with diglycidyl ether coupling reagent to obtain active carrier, then making said active carrier and protein A implement coupling reaction. Said invention can be used for making clinical immunoadsorption therapy.

The invention discloses a wood pallet assembling and nailing device which comprises a wood pallet assembling and nailing assembly line. A plurality of wood pallet stacking brackets are carried on the wood pallet assembling and nailing assembly line and shaped like a Chinese character 'tian'. Each wood pallet stacking bracket is provided with nine stilt through grooves at nine interaction corners of the wood pallet stacking bracket respectively and correspondingly, wherein the nine stilt through grooves are matched with wood pallet stilts in shape and size. One side of each stilt through groove is provided with a stilt pushing air cylinder, wherein the stilt pushing air cylinders are used for pushing the wood pallet stilts to the stilt through grooves. Each wood pallet stacking bracket is further provided with a wood pushing air cylinder, wherein the wood pushing air cylinders are used for pushing wood boards to be nailed of wood pallets to the wood pallet stilts. By the adoption of the structure, the wood pallet assembling and nailing device can improve assembling and nailing efficiency substantially.

The invention relates to a fusion protein used for single-cell ChIP-seq library preparation and application thereof. The fusion protein comprises Tn5 transposase and an Fc binding protein; a kit comprises the fusion protein and other auxiliary detection reagents; a method uses the fusion protein or the kit for ChIP-seq detection. The fusion protein, the kit and the method can improve the library building efficiency and lower the library background in the ChIP-seq detection process, so that the accuracy of the ChIP-seq detection method can be improved, and the experimental flow of ChIP-seq canbe simplified.

In a bookbinding machine, an image forming apparatus, a prebinding apparatus and a bookbinding apparatus are coupled on line in this order. In the prebinding apparatus, a sheet aligning section, a slitting section which cuts off margins at both side portions of a sheet of paper, a cutting section which cuts off top and bottom margins, and a creasing section are arranged in this order. The prebinding apparatus is provided with a control section which sorts out supplied sheets of paper into those which need an SCC step and those which do not, and performs the SCC step only on the sheets of paper that need the SCC step.

The invention discloses a method for manufacturing an aluminum/magnesium/aluminum composite plate on a three-dimensional layer interface. The method comprises the steps of firstly, machining the three-dimensional interfaces matched with each other on magnesium alloy plates and aluminum alloy plates; cleaning to-be-bonded surfaces of the magnesium alloy plates and the aluminum alloy plates; stacking and assembling the magnesium alloy plates and the aluminum alloy plates alternately in a mutually meshing mode to obtain a composite plate blank; repeatedly carrying out unidirectional ultrasonic temperature change and load change hot pressing to fill a mold; and carrying out hot rolling to obtain the tightly bonded composite plate. According to the method, a two-step thermal deformation methodcombining hot pressing and rolling is adopted to obtain the laminated plate with uniform thickness, smooth surface and relatively high surface quality, the process is simple, the energy consumption islow, the quality of the composite plate is high, and the method is suitable for application and popularization.

The invention discloses a compound taking quinolizine ketone as a mother nucleus and for treating or preventing hepatitis B virus infection. The compound comprises optical isomer, raceme, cis-trans-isomer and any combination thereof or medicinal salt thereof. The invention further discloses a preparation method and application of the compound. The compound can remarkably lower in-vivo HBsAg leveland inhibit duplication of HBV, has good medicinal attribute and is low in toxicity, and pharmacokinetic and pharmacodynamic functions are improved; efficiency of combining with the HBV can be improved greatly, and clearance rate of in-vivo HBV can be further increased.

The invention relates to a staphylococcal protein A (SPA) immunoadsorption material used for blood purification and a preparation method thereof. The invention discloses a macromolecule material which is coupled by agarose gel and SPA. The material is prepared by taking the agarose gel as carrier substrate which is reacted with epoxy bromopropane to obtain the epoxy-based active carrier; after that, polyamines reagent is taken as a space arm which is then reacted with carbonyl diimidazole and is then coupled with the SPA. The material has the advantages of short synthesis time, safe preparation, strong specificity of product, high adsorption efficiency and good regeneration performance to immunoglobulin and the compound thereof, and being able to be applied to clinic immunoadsorption cure.