99results about How to "Less catch" patented technology

A set of alloy formulations is disclosed to use with thorium based nuclear fuels in a fast spectrum reactor; with thorium based nuclear fuels in existing thermal spectrum power reactors; for medical isotope production in the epithermal, the fast, the fission spectrum and the thermal spectra; and to use as fuel in test and experimental reactors that are non proliferative. The alloys form inert metal matrixes to hold fine particles of dispersed thorium containing fuel. The formulations also are useful for the production of medical and commercial isotopes in the high energy, fast and epithermal neutron spectra.

Disclosed is a light-emitting element which includes a first light-emitting layer over and in contact with a hole-transport layer and a second light-emitting layer over and in contact with the first light-emitting layer. The first and the second light-emitting layers contain a bipolar host material and an emissive guest material. The guest material in the first light-emitting layer has a lower ability for capturing a hole than a guest material in the second light-emitting layer; therefore, the hole-transport property of the first light-emitting layer can be controlled to be higher than that of the second light-emitting layer. The difference in hole-transport property between the first and second light-emitting layers allows a recombination region to be widely spread in the light-emitting layers. An anti-reducing material may be provided in the hole-transport layer, which prevents the hole-transport layer from being reduced by electrons which fail to undergo recombination in the light-emitting layers.

The invention discloses a beam switching method, system and device based on a low earth orbit satellite and a storage medium, and the method is applied to a satellite terminal, and comprises the steps: obtaining the ephemeris information of the low earth orbit satellite; according to the ephemeris information and the geographic position information of the satellite terminal, obtaining a target beam to be switched and a target moment when switching occurs; switching to the target beam at a target moment; selecting the strongest adjacent beam with the strongest signal quality of the target beam;and switching to the strongest adjacent beam. According to the invention, switching parameters are flexibly configured according to the position information and ephemeris information of the satelliteterminal; the wave beam becomes a target wave beam more easily; and switching the beam to the target beam according to the switching moment, according to the invention, the switching accuracy is improved, the switching accuracy and the strongest beam reservation time are also improved by selecting and residing in the strongest adjacent beam under the target beam, the difficulty of link capture and tracking caused by Doppler frequency shift is reduced, the beam switching efficiency is improved, and the network searching efficiency of the satellite terminal is improved.

A thermal power plant includes carbon dioxide capture scrubbing equipment that suppresses reductions in the efficiency and output of a steam turbine, and, at the same time, reduces variations in the amount of steam supplied from a solar heat collection apparatus to a reboiler and variations in the temperature and pressure of reboiler generated steam, and stably carries out reactions for separating carbon dioxide from an absorbent by heating. The thermal power plant includes the carbon dioxide capture scrubbing equipment for capturing carbon dioxide from a boiler exhaust gas and the solar heat collection apparatus. Steam generated by the solar heat collection apparatus is supplied to the reboiler provided for a regeneration tower of the carbon dioxide capture scrubbing equipment.

The invention provides a joint enclosing sequence, a library construction kit, and a construction method of a sequencing library. The joint enclosing sequence comprises a P5 joint enclosing sequence containing a sequence represented by SEQ ID NO:1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC, and the 3' terminal of the sequence represented by SEQ ID NO:1 is modified through one modification selected from reverse dT modification, dividing wall modification, dideoxycytidylic acid modification, and phosphorylation modification; the 3' terminal of the joint enclosing sequence is provided with enclosing modification, so that enclosing sequence combination efficiency is increased, non-target region capturing caused by joint connection is reduced, capturing efficiency is increased, and influences of the enclosing sequence on subsequent PCR process are reduced.

In a system and process for selectively purifying various pharmacologically-relevant components of a source plant such as cannabis, an initial step provides a low-temperature, robust essential oil/terpene capture that also dehydrates and decarboxylates the starting product—fresh raw cannabis—by means of a vacuum-assisted microwave distillation process. By doing the terpene capture under vacuum distillation temperature may be kept low. The low distillation temperature maximizes yields of thermally-sensitive components such as terpenes and cannabinoids. The system includes an oil/water separator configured to prevent leakage of ambient air into the system.

The invention discloses a hematoxylin and eosin staining kit for circulating tumor cells (CTC). The kit comprises stationary liquid, immunomagnetic microspheres, a staining reagent as well as confining liquid, wherein the confining liquid comprises an ion detergent and a protein protectant; the surfaces of immunomagnetic microspheres are carried with a combined antibody for resisting EpCAM and Her2; the staining reagent is a compound fluorescence staining reagent containing FITC-CK19 or FITC-Her2, Cy3-CD45 and DAPI. The hematoxylin and eosin staining kit for circulating tumor cells (CTC) has the advantages that the interference of blood leucocytes is low, the CTC cells are specifically enriched and captured, and the staining effect on CTC cells is good.

A flooring system for intercepting debris including at least a plurality of floor tiles with a perforated top surface providing on a top of the plurality of tube frames for intercepting the debris. Each plurality of floor tiles may include a plurality of tube frames in side by side relationship to form a distributed suction area for fluid entrance into tile interiors and for debris interception and capture. The tile interiors of the flooring system may also provide a distributed flow path for fluid flow to a transition plenum. The flooring system may also include a transition plenum for directing a flow path of the fluid from the tiles to a sump, wherein the pumps take suction.

The invention relates to a semantic segmentation method and system based on dynamic interpolation reconstruction for streetscape understanding, and the method comprises the steps: carrying out the preprocessing of an input image of a training set, enabling the image to be standardized, and obtaining preprocessed images with the same size; extracting general characteristics by using a convolutionalnetwork, then obtaining hybrid space pyramid pooling characteristics, and extracting coding characteristics by using the two parts of cascading as a coding network; selecting an intermediate layer characteristic from the convolutional network, calculating an interpolation weight characteristic in combination with the encoding characteristic, constructing a decoding network in a dynamic interpolation mode, reconstructing an image resolution, and calculating a decoding characteristic; performing calculating to obtain edge-enhanced semantic segmentation loss, and training the deep neural networkwith the purpose of minimizing the edge-enhanced semantic segmentation loss; and performing semantic segmentation on the to-be-segmented image by using the deep neural network model, and outputting asegmentation result. The method and the system are beneficial to improving the accuracy and robustness of image semantic segmentation.

The invention discloses a power control device and method used for low voltage ride through of a direct-drive permanent magnetic synchronous wind driven generator. The device comprises a generator speed measuring module, a direct current voltage measuring module, a generator terminal voltage measuring module, a generator terminal current measuring module, a grid measurement voltage measuring module, a grid measurement current measuring module, a maximum power tracking and controlling module, a grid measurement power measuring module, a wind speed measuring module, a pitch angle measuring module and a power coordination control module. The invention further provides the power control method, active power and reactive power of a unit in a temporarily stable state period can be coordinated and controlled, so that the direct-drive wind driven generator effectively achieves low voltage ride through in a maximum power tracking area and a power limiting area, and the unit can provide dynamic reactive support for a power grid in a low-voltage transient state period. The power control device and method can use the control means of the direct-drive wind driven generator self sufficiently and reasonably without adding unloading hardware, and the power control method is easy to implement and remarkable in effect.

The invention discloses a megawatt wind power generation master control system, which comprises a master control unit, an upper monitoring system, a pitch control system and a variable frequency system, wherein the master control unit consists of a tower-bottom control cabinet and a cabin control cabinet; the tower-bottom control cabinet is provided with a master control central processing unit (CPU) module, a remote input output (IO) extended optical fiber master module, a CANOpen communication master module, an RS232 expansion module, a tower-bottom universal IO module, a first multimode optical fiber port four-electrical port industrial switch, a single-mode photoelectric converter, a first pigtail box, an in-situ upper computer and multimode optical fibers; and the master control unit is connected with the upper monitoring system through the single-mode photoelectric converter, connected with the variable frequency system through the CANOpen communication master module and connected with the pitch control system through an RS485 module. In the megawatt wind power generation master control system, the characteristics of a wind machine are taken as bases, and when the wind machine runs at an optimal tip-speed ratio lambda, a fan unit captures maximum energy to maintain the stable output power of a generator.

The invention relates to a platelet membrane wrapped drug loading porous nano particle and a preparation method of the nano particle. The nano particle is prepared by modifying PLGA (poly (lactic-co-glycolic acid)) with chitosan oligosaccharide CS, loading Bufotalin and then wrapping with a platelet membrane. The preparation method comprises the steps of preparation of chitosan oligosaccharide modified PLGA, preparation of CS-pPLGA/Bu NPs, preparation of a platelet membrane fragment and preparation of PLTM-CS-pPLGA/Bu NPs. According to the method, the nano particle with the positively chargedsurface is prepared from CS modified PLGA; absorption of the negatively charged platelet membrane is facilitated by a layer-by-layer self-assembly manner; the stability of the nano particle is improved; and the prepared platelet membrane bionic coated porous nano particle is expected to achieve excellent biocompatibility, low immunogenicity and active cancer cell targeting ability, can actively deliver chemotherapeutics to tumor cells in a targeted manner, improves a treatment effect and has a very good practical value.

The invention provides a short joint, a double-index joint primer and a double-index library building system of a gene sequencer. The short joint comprises two partially complementary joint oligonucleotide chains: including a joint oligonucleotide chain 1 and a joint oligonucleotide chain 2, wherein the joint oligonucleotide chain 1 sequentially comprises an index 2 primer binding region, a positive-sense joint complementary region, a positive-sense molecular tag and a protruding base T from the 5' end to the 3 'end; and the joint oligonucleotide chain 2 sequentially comprises an antisense molecular tag, an antisense joint complementary region and an index1 primer binding region from the 5' end to the 3 'end. The fragment conversion efficiency, the amplification efficiency uniformity between index combinations, the capture efficiency uniformity and the data yield stability of the double-index library system constructed by using the short joint are remarkably superior to those of an existing double-index library system.

The invention discloses a space junk removal satellite device which comprises a satellite body and a task execution module. The satellite body comprises a first structure box, a power module, a navigation module, an orbit control module, a flight control module, a wireless communication module and a solar cell array, the power module, the navigation module, the orbit control module, the flight control module and the wireless communication module are arranged in the first structure box, the first structure box is a cube, and all the faces of the box are fixed through mechanical structures; andthe task execution module comprises a second structure box, a task control module, a detection recognition module, a capture module, a smashing module, a transporting module and a laser ablation module, the task control module, the detection recognition module, the capture module, the smashing module, the transporting module and the laser ablation module are arranged in the second structure box, the second structure box is a cube, the left side face of the second structure box is a fixed face mechanically locked to the satellite body, and the remaining five faces are each of a deformable structure and can be unfolded and folded within the range from -60 degrees to 60 degrees. The device can capture and remove small-size space junk, and the space junk containing a conductive material can beablated through the laser ablation module and then secondarily used to supply energy to the laser ablation module.

In a method for inspecting and tailoring a predefined point of a moving product web (2), the moving product web (2) is located at least partly on a winder (3). Both a relative running length L of the product web (2) and an associated angle of rotation α of the winder (3) are captured. From these values, the absolute running length L_TOT of the moving product web (2) is then calculated. A camera (34) captures the moving product web (2). The camera value is compared with a reference value (36) and, together with the absolute running length L_TOT of the moving product web (2), is stored in a file (37). At a later time, with the aid of the file (37), the defective points of the moving product web (2) are moved to. The absolute running length L_TOT is determined again and compared with the file (37). Therefore, the defective points can easily be separated out from the moving product web (2).

An apparatus and method for obtaining a data file representing a three-dimensional image of the surface of a subject are disclosed. The apparatus incorporates a plurality of scanners, each comprising illuminating means and digital camera means, disposed about the subject, and computer means to correlate the images and store the data file. An apparatus and method for producing a three-dimensional model from that data file are also disclosed. The use of rapid prototyping and manufacturing technology for manufacturing a model is disclosed. The present invention is particularly applicable to human subjects.

The invention relates to a navigation signal capturing to tracking method and system. The method comprises that serial 2D blind searching is carried out on a navigational star via a first channel, a tracking loop is turned to, and instant code phase information of the navigational start is output; code phase information in the capturing start time and code phase information in the capturing complete end time of the navigational star are rapidly captured via a second channel, and a fixed delay value is calculated; a fixed code delay difference from the capture start time to time when a capturing result is turned to the tracking loop is obtained according to the code phase information in the capturing start time and the instant code phase information; and a to-tracking fixed delay value is captured according to the fixed code delay difference and the fixed delay, and to-tracking code phase compensation is carried out according to the fixed delay value. According to the scheme, the fixed delay value is calculated accurately, a capturing code phase result is output in a compensated manner, and the method and system can be applied to accurate satellite object tracking. According to a real-time code phase deviant calculation method, the code phase deviant is compensated accurately, and the navigation signal capturing and tracking time can be shortened.