Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

101results about How to "Less catch" patented technology

Non Proliferating Thorium Nuclear Fuel Inert Metal Matrix Alloys for Fast Spectrum and Thermal Spectrum Thorium Converter Reactors

A set of alloy formulations is disclosed to use with thorium based nuclear fuels in a fast spectrum reactor; with thorium based nuclear fuels in existing thermal spectrum power reactors; for medical isotope production in the epithermal, the fast, the fission spectrum and the thermal spectra; and to use as fuel in test and experimental reactors that are non proliferative. The alloys form inert metal matrixes to hold fine particles of dispersed thorium containing fuel. The formulations also are useful for the production of medical and commercial isotopes in the high energy, fast and epithermal neutron spectra.
Owner:RGT UNIV OF CALIFORNIA

Light-Emitting Element, Light-Emitting Device, and Method for Manufacturing the Same

Disclosed is a light-emitting element which includes a first light-emitting layer over and in contact with a hole-transport layer and a second light-emitting layer over and in contact with the first light-emitting layer. The first and the second light-emitting layers contain a bipolar host material and an emissive guest material. The guest material in the first light-emitting layer has a lower ability for capturing a hole than a guest material in the second light-emitting layer; therefore, the hole-transport property of the first light-emitting layer can be controlled to be higher than that of the second light-emitting layer. The difference in hole-transport property between the first and second light-emitting layers allows a recombination region to be widely spread in the light-emitting layers. An anti-reducing material may be provided in the hole-transport layer, which prevents the hole-transport layer from being reduced by electrons which fail to undergo recombination in the light-emitting layers.
Owner:SEMICON ENERGY LAB CO LTD

Axial lengthening thrombus capture system

Axial lengthening thrombus capture systems and methods can remove materials of interest, including blood clots, from a body region. These can involve the circulatory system for the treatment of pulmonary embolism (PE), deep vein thrombosis (DVT), cerebrovascular embolism, and other vascular occlusions.
Owner:VASCULAR MEDCURE INC

Surgical filament assemblies

ActiveUS8790370B2Reduce in quantitySimplify overall knot tying processSuture equipmentsSuture anchorsMedicine
A suture anchor, and a surgical filament assembly using same, capable of being fixated in a hole formed in a bone of a patient. The suture anchor preferably includes an anchor body with a passage extending from a proximal end toward a distal end, and at least one bone engaging feature on the exterior of the anchor. A knot patency element disposed within the passage holds a removable sliding knot formed, using the surgical filament. A tightening limb of the sliding knot enables the user to tighten the sliding knot against an object extending through a capture loop to secure the object to the anchor.
Owner:MEDOS INT SARL

Beam switching method, system and device based on low earth orbit satellite and storage medium

The invention discloses a beam switching method, system and device based on a low earth orbit satellite and a storage medium, and the method is applied to a satellite terminal, and comprises the steps: obtaining the ephemeris information of the low earth orbit satellite; according to the ephemeris information and the geographic position information of the satellite terminal, obtaining a target beam to be switched and a target moment when switching occurs; switching to the target beam at a target moment; selecting the strongest adjacent beam with the strongest signal quality of the target beam;and switching to the strongest adjacent beam. According to the invention, switching parameters are flexibly configured according to the position information and ephemeris information of the satelliteterminal; the wave beam becomes a target wave beam more easily; and switching the beam to the target beam according to the switching moment, according to the invention, the switching accuracy is improved, the switching accuracy and the strongest beam reservation time are also improved by selecting and residing in the strongest adjacent beam under the target beam, the difficulty of link capture and tracking caused by Doppler frequency shift is reduced, the beam switching efficiency is improved, and the network searching efficiency of the satellite terminal is improved.
Owner:BEIJING SPREADTRUM HI TECH COMM TECH CO LTD

Radiation detection apparatus and radiation image capturing system

A radiation detection apparatus and a radiation image capturing system according to the present invention includes an electronic cassette equipped with a casing, and a radiation detection device accommodated inside the casing, which detects radiation emitted from a radiation source and having passed through a subject, while converting the radiation into radiation image information. The electronic cassette includes a sensor for sensing that the casing has been lifted, a power supply controller for supplying power based on a detection signal from the sensor, a discriminating unit for discriminating whether the radiation detection apparatus has transitioned to an image capturing capable mode, and a warning signal output unit for outputting a warning signal, for issuing a warning when the radiation detection apparatus cannot transition to the image capturing capable mode.
Owner:FUJIFILM CORP

Thermal Power Plant with Carbon Dioxide Capture Scrubbing Equipment

A thermal power plant includes carbon dioxide capture scrubbing equipment that suppresses reductions in the efficiency and output of a steam turbine, and, at the same time, reduces variations in the amount of steam supplied from a solar heat collection apparatus to a reboiler and variations in the temperature and pressure of reboiler generated steam, and stably carries out reactions for separating carbon dioxide from an absorbent by heating. The thermal power plant includes the carbon dioxide capture scrubbing equipment for capturing carbon dioxide from a boiler exhaust gas and the solar heat collection apparatus. Steam generated by the solar heat collection apparatus is supplied to the reboiler provided for a regeneration tower of the carbon dioxide capture scrubbing equipment.
Owner:MITSUBISHI HITACHIPOWER SYST LTD

Joint enclosing sequence, library construction kit, and construction method of sequencing library

The invention provides a joint enclosing sequence, a library construction kit, and a construction method of a sequencing library. The joint enclosing sequence comprises a P5 joint enclosing sequence containing a sequence represented by SEQ ID NO:1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC, and the 3' terminal of the sequence represented by SEQ ID NO:1 is modified through one modification selected from reverse dT modification, dividing wall modification, dideoxycytidylic acid modification, and phosphorylation modification; the 3' terminal of the joint enclosing sequence is provided with enclosing modification, so that enclosing sequence combination efficiency is increased, non-target region capturing caused by joint connection is reduced, capturing efficiency is increased, and influences of the enclosing sequence on subsequent PCR process are reduced.
Owner:天津诺禾致源生物信息科技有限公司

Apparatus for preparation of pharmacologically-relevant compounds from botanical sources

In a system and process for selectively purifying various pharmacologically-relevant components of a source plant such as cannabis, an initial step provides a low-temperature, robust essential oil / terpene capture that also dehydrates and decarboxylates the starting product—fresh raw cannabis—by means of a vacuum-assisted microwave distillation process. By doing the terpene capture under vacuum distillation temperature may be kept low. The low distillation temperature maximizes yields of thermally-sensitive components such as terpenes and cannabinoids. The system includes an oil / water separator configured to prevent leakage of ambient air into the system.
Owner:RIVAS JOSE

Radiation detection apparatus and radiation image capturing system

A radiation detection apparatus and a radiation image capturing system according to the present invention includes an electronic cassette equipped with a casing, and a radiation detection device accommodated inside the casing, which detects radiation emitted from a radiation source and having passed through a subject, while converting the radiation into radiation image information. The electronic cassette includes a sensor for sensing that the casing has been lifted, a power supply controller for supplying power based on a detection signal from the sensor, a discriminating unit for discriminating whether the radiation detection apparatus has transitioned to an image capturing capable mode, and a warning signal output unit for outputting a warning signal, for issuing a warning when the radiation detection apparatus cannot transition to the image capturing capable mode.
Owner:FUJIFILM CORP

Hematoxylin and eosin staining kit for circulating tumor cells (CTC)

ActiveCN104931324ALess blood leukocyte interferenceGood effectPreparing sample for investigationIonChemistry
The invention discloses a hematoxylin and eosin staining kit for circulating tumor cells (CTC). The kit comprises stationary liquid, immunomagnetic microspheres, a staining reagent as well as confining liquid, wherein the confining liquid comprises an ion detergent and a protein protectant; the surfaces of immunomagnetic microspheres are carried with a combined antibody for resisting EpCAM and Her2; the staining reagent is a compound fluorescence staining reagent containing FITC-CK19 or FITC-Her2, Cy3-CD45 and DAPI. The hematoxylin and eosin staining kit for circulating tumor cells (CTC) has the advantages that the interference of blood leucocytes is low, the CTC cells are specifically enriched and captured, and the staining effect on CTC cells is good.
Owner:NINGBO MEIJING MEDICAL TECH

Floor tile debris interceptor and transition plenum in a nuclear power plant

A flooring system for intercepting debris including at least a plurality of floor tiles with a perforated top surface providing on a top of the plurality of tube frames for intercepting the debris. Each plurality of floor tiles may include a plurality of tube frames in side by side relationship to form a distributed suction area for fluid entrance into tile interiors and for debris interception and capture. The tile interiors of the flooring system may also provide a distributed flow path for fluid flow to a transition plenum. The flooring system may also include a transition plenum for directing a flow path of the fluid from the tiles to a sump, wherein the pumps take suction.
Owner:GENERAL ELECTRIC CO

Semantic segmentation method and system based on dynamic interpolation reconstruction for streetscape understanding

The invention relates to a semantic segmentation method and system based on dynamic interpolation reconstruction for streetscape understanding, and the method comprises the steps: carrying out the preprocessing of an input image of a training set, enabling the image to be standardized, and obtaining preprocessed images with the same size; extracting general characteristics by using a convolutionalnetwork, then obtaining hybrid space pyramid pooling characteristics, and extracting coding characteristics by using the two parts of cascading as a coding network; selecting an intermediate layer characteristic from the convolutional network, calculating an interpolation weight characteristic in combination with the encoding characteristic, constructing a decoding network in a dynamic interpolation mode, reconstructing an image resolution, and calculating a decoding characteristic; performing calculating to obtain edge-enhanced semantic segmentation loss, and training the deep neural networkwith the purpose of minimizing the edge-enhanced semantic segmentation loss; and performing semantic segmentation on the to-be-segmented image by using the deep neural network model, and outputting asegmentation result. The method and the system are beneficial to improving the accuracy and robustness of image semantic segmentation.
Owner:FUZHOU UNIV

Method for improving incoherent detection performance of MSK (minimum shift keying) signals

The invention provides a method for improving the incoherent detection performance of MSK (minimum shift keying) signals, and aims at providing the method solving the problem of MSK signal application limitation caused by poorer incoherent detection performance and realization difficulty of coherent detection of the MSK signals. The method provided by the invention is realized through the following technical scheme that in an MSK data transmission receiving machine, a signal capture module stores baseband signals after the down-conversion into a memory, then, a high-speed clock is used for reading out the stored signals from the memory, next, the read signals are subjected to frequency offset compensation and bit synchronization searching according to the pre-divided frequency grooves, and the searching results are sent to a signal tracking module; the signal tracking module realizes the frequency and bit synchronization tracking through a frame head waveform matching correlator according to the capture results sent from the signal capture module; and a correlation judging module carries out correlation calculation on the signals sent by the signal tracking module with the local waveforms, selects the maximum correlation value from the correlation results and adopts the bit of the maximum correlation value corresponding to the middlemost part of the bit flow as the final judgment results to be output.
Owner:10TH RES INST OF CETC

Power control device and method used for low voltage ride through of direct-drive wind driven generator

InactiveCN103762919AImproved intrinsic pitch angle controlMeet the control requirements of active and reactive powerSingle network parallel feeding arrangementsReactive power adjustment/elimination/compensationWind drivenTerminal voltage
The invention discloses a power control device and method used for low voltage ride through of a direct-drive permanent magnetic synchronous wind driven generator. The device comprises a generator speed measuring module, a direct current voltage measuring module, a generator terminal voltage measuring module, a generator terminal current measuring module, a grid measurement voltage measuring module, a grid measurement current measuring module, a maximum power tracking and controlling module, a grid measurement power measuring module, a wind speed measuring module, a pitch angle measuring module and a power coordination control module. The invention further provides the power control method, active power and reactive power of a unit in a temporarily stable state period can be coordinated and controlled, so that the direct-drive wind driven generator effectively achieves low voltage ride through in a maximum power tracking area and a power limiting area, and the unit can provide dynamic reactive support for a power grid in a low-voltage transient state period. The power control device and method can use the control means of the direct-drive wind driven generator self sufficiently and reasonably without adding unloading hardware, and the power control method is easy to implement and remarkable in effect.
Owner:NORTH CHINA ELECTRIC POWER UNIV (BAODING)

Megawatt wind power generation master control system

The invention discloses a megawatt wind power generation master control system, which comprises a master control unit, an upper monitoring system, a pitch control system and a variable frequency system, wherein the master control unit consists of a tower-bottom control cabinet and a cabin control cabinet; the tower-bottom control cabinet is provided with a master control central processing unit (CPU) module, a remote input output (IO) extended optical fiber master module, a CANOpen communication master module, an RS232 expansion module, a tower-bottom universal IO module, a first multimode optical fiber port four-electrical port industrial switch, a single-mode photoelectric converter, a first pigtail box, an in-situ upper computer and multimode optical fibers; and the master control unit is connected with the upper monitoring system through the single-mode photoelectric converter, connected with the variable frequency system through the CANOpen communication master module and connected with the pitch control system through an RS485 module. In the megawatt wind power generation master control system, the characteristics of a wind machine are taken as bases, and when the wind machine runs at an optimal tip-speed ratio lambda, a fan unit captures maximum energy to maintain the stable output power of a generator.
Owner:ZHEJIANG ZHONGKE AUTOMATION ENG TECH

Platelet membrane wrapped drug loading porous nano particle and preparation method thereof

The invention relates to a platelet membrane wrapped drug loading porous nano particle and a preparation method of the nano particle. The nano particle is prepared by modifying PLGA (poly (lactic-co-glycolic acid)) with chitosan oligosaccharide CS, loading Bufotalin and then wrapping with a platelet membrane. The preparation method comprises the steps of preparation of chitosan oligosaccharide modified PLGA, preparation of CS-pPLGA / Bu NPs, preparation of a platelet membrane fragment and preparation of PLTM-CS-pPLGA / Bu NPs. According to the method, the nano particle with the positively chargedsurface is prepared from CS modified PLGA; absorption of the negatively charged platelet membrane is facilitated by a layer-by-layer self-assembly manner; the stability of the nano particle is improved; and the prepared platelet membrane bionic coated porous nano particle is expected to achieve excellent biocompatibility, low immunogenicity and active cancer cell targeting ability, can actively deliver chemotherapeutics to tumor cells in a targeted manner, improves a treatment effect and has a very good practical value.
Owner:DONGHUA UNIV

Short joint, double-index joint primer and double-index library building system of gene sequencer

InactiveCN112626189AUniformity of Amplification EfficiencyFragment transformation efficiency uniformityNucleotide librariesMicrobiological testing/measurementBase JEngineering
The invention provides a short joint, a double-index joint primer and a double-index library building system of a gene sequencer. The short joint comprises two partially complementary joint oligonucleotide chains: including a joint oligonucleotide chain 1 and a joint oligonucleotide chain 2, wherein the joint oligonucleotide chain 1 sequentially comprises an index 2 primer binding region, a positive-sense joint complementary region, a positive-sense molecular tag and a protruding base T from the 5' end to the 3 'end; and the joint oligonucleotide chain 2 sequentially comprises an antisense molecular tag, an antisense joint complementary region and an index1 primer binding region from the 5' end to the 3 'end. The fragment conversion efficiency, the amplification efficiency uniformity between index combinations, the capture efficiency uniformity and the data yield stability of the double-index library system constructed by using the short joint are remarkably superior to those of an existing double-index library system.
Owner:北京吉因加医学检验实验室有限公司 +1

Anti-clogging fuel pump module

A by-pass fuel system in which the plumbing of the fuel pump module is configured to ensure by-pass strained (and filtered) fuel remains separate from the reservoir fuel after by-pass such that it is not re-strained before re-entry to the fuel pump. The anti-clogging fuel pump module is plumbed such that the by-pass strained fuel is directed to the fuel pump separately with respect to the reservoir fuel, wherein it never mixes with reservoir fuel except after the reservoir fuel has passed through the strainer. Thus, the by-pass strained fuel only mixes with strained fuel from the strainer before its entry to the fuel pump. Accordingly, only reservoir fuel in the fuel pump module is passed through the strainer, whereby the clogging rate of the strainer is minimized.
Owner:GM GLOBAL TECH OPERATIONS LLC

Off-target capture reduction in sequencing techniques

Presented herein are methods and compositions for enhancing specific enrichment of target sequences in a nucleic acid library. Off-target hybridization probes may be used to reduce binding and / or capture of off-target regions of a nucleic acid library in a targeted sequencing workflow. The off-target hybridization probes may be specific for locations known to generate off-target sequencing reads for a particular set of hybridization probes.
Owner:ILLUMINA INC

Space junk removal satellite device

The invention discloses a space junk removal satellite device which comprises a satellite body and a task execution module. The satellite body comprises a first structure box, a power module, a navigation module, an orbit control module, a flight control module, a wireless communication module and a solar cell array, the power module, the navigation module, the orbit control module, the flight control module and the wireless communication module are arranged in the first structure box, the first structure box is a cube, and all the faces of the box are fixed through mechanical structures; andthe task execution module comprises a second structure box, a task control module, a detection recognition module, a capture module, a smashing module, a transporting module and a laser ablation module, the task control module, the detection recognition module, the capture module, the smashing module, the transporting module and the laser ablation module are arranged in the second structure box, the second structure box is a cube, the left side face of the second structure box is a fixed face mechanically locked to the satellite body, and the remaining five faces are each of a deformable structure and can be unfolded and folded within the range from -60 degrees to 60 degrees. The device can capture and remove small-size space junk, and the space junk containing a conductive material can beablated through the laser ablation module and then secondarily used to supply energy to the laser ablation module.
Owner:LANZHOU JIAOTONG UNIV

Method and device for inspecting and tailoring a moving product web

In a method for inspecting and tailoring a predefined point of a moving product web (2), the moving product web (2) is located at least partly on a winder (3). Both a relative running length L of the product web (2) and an associated angle of rotation α of the winder (3) are captured. From these values, the absolute running length LTOT of the moving product web (2) is then calculated. A camera (34) captures the moving product web (2). The camera value is compared with a reference value (36) and, together with the absolute running length LTOT of the moving product web (2), is stored in a file (37). At a later time, with the aid of the file (37), the defective points of the moving product web (2) are moved to. The absolute running length LTOT is determined again and compared with the file (37). Therefore, the defective points can easily be separated out from the moving product web (2).
Owner:ADVANCED VISION TECH

Active fixation element

A helical fixation element of an implantable medical lead. The fixation element has at least one blood drainage channel running along at least a tissue-penetrating portion of the helix windings of the fixation element. The channel guides, during penetration and anchoring of the fixation element and the lead in a tissue, blood leaking from the tissue away from the vicinity of the fixation element, thereby reducing the size of a fibrin clot formed around the fixation element. The capture threshold for stimulating the tissue is therefore reduced.
Owner:ST JUDE MEDICAL

Shaving unit for an electric shaver

The invention relates to a shaving unit (1) for an electric shaver which comprises an outer cutter (5) and an inner cutter (13) associated to that outer cutter. The outer and inner cutters are mounted so as to be movable relative to each other and adapted to be set in a relative motion by a drive mechanism. The inner cutter (13) provides a plurality of cutting edges (23) and abuts with its outer face on the inner face of the outer cutter (5), and the outer cutter provides a plurality of teeth (6) equipped with cutting edges (22). According to the invention, the outer cutter (5) provides two comb elements (2, 3) which are disposed opposite one another and which extend according to the direction of the relative motion. The two comb elements are aligned with respect to one another such that the tips (10) of the teeth of the first comb element (2) are facing the tips of the teeth of the second comb element (3), with the tips of the teeth being essentially spaced from one another.
Owner:BRAUN GMBH

A method of manufacturing portunid crab bait

ActiveCN103283952APlay an attractive roleWithstand shockAnimal feeding stuffSOY LECITHINFish oil
The invention provides a method of manufacturing portunid crab bait. The portunid crab bait is composed of the following raw materials, by weight: 3 to 10% of squid paste, 3 to 10% of seaweed powder, , 1 to 5% of soy lecithin, 1 to 5% of fish oil , 3 to 10% of fish meal, 10 ~ 15% of wheat middling, 30 ~ 50% of soybean meal, 10 ~ 15% of high gluten flour, 0.05 to 0.15% of sodium alginate, 0.005 to 0.015% of amino acids, 0.005-0.015% of attractant small peptides, 1 ~ 5%of monocalcium phosphate, 0.005 to 0.015% of dextran, 0.005 to 0.015% of trimethylamine oxide, 0.005 to 0.015% of sulfobetaine, and 0.5 to 1% of potassium sorbate. According to the invention, raw materials such as the squid paste are employed for preparing compound bait for portunid crabs which are small in yield in Zhoushan but have a high commercial value; and the bait is easy to use and has natural attractant effect, ensuring adequate and stable bait supply for crab catching industry.
Owner:舟山瑞洋水产品研发有限公司 +1

Apparatus and method for three-dimensional scanning of a subject, fabrication of a model therefrom, and the model produced thereby

An apparatus and method for obtaining a data file representing a three-dimensional image of the surface of a subject are disclosed. The apparatus incorporates a plurality of scanners, each comprising illuminating means and digital camera means, disposed about the subject, and computer means to correlate the images and store the data file. An apparatus and method for producing a three-dimensional model from that data file are also disclosed. The use of rapid prototyping and manufacturing technology for manufacturing a model is disclosed. The present invention is particularly applicable to human subjects.
Owner:BEWLEY WILBUR C JR +1
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More