Vector capable of being used for expressing foreign gene and cell line screening method
A technology of expressing vectors and cell lines, which is applied in the direction of using vectors to introduce foreign genetic material, genetic engineering, plant genetic improvement, etc. It can solve the problems of loss of gene expression level, unstable expression of target genes, and large manpower and time consumption.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Construction of high-efficiency expression vectors
[0026] The eukaryotic expression vector was constructed based on the commercialized pcDNA3 / hyg vector, and the CMV promoter on the original vector was replaced with the human ubiquinone protein promoter (hUbc) with low activation efficiency. The specific method is well known to those skilled in the art. Design hUbc-F upstream primer 5'GCTTCGCGAGATCTGGCCTCCGCGC3' (SEQ ID NO: 1) and hUbc-R downstream primer 5'AGCAAGCTTGTCTAACAAAAAAGCC 3' (SEQ ID NO: 2), PCR commercialized vector Ubc.IkBSR-Flag Pgk.Cre plasmid , to obtain a 1.2 kb hUbc promoter PCR fragment (SEQ ID NO: 3). This fragment was double digested with Nru I and Hind III. After the pcDNA3 / hyg vector was digested with Nru I and Hind III, the digested product was purified using the promega WizardSV Gel and PCR clean-up System purification kit. The light chain expression cassette was ligated with the pcDNA3 vector using TaKaRa's DNALigation Kit Ver.2....
Embodiment 2
[0029] Example 2: Construction of the gene carrier of IFNγR1-Fc fusion protein
[0030] The highly efficient promoter CMV-IE sequence can be obtained by PCR from the pDendra2-N (Clonetech Company) vector, and the promoter sequence is used with promoter-F 5'GCTTCGCGAAGTTATTAATAGTAATCAATTACGG 3'(SEQ ID No: 10) and promoter-R 5'AGCAAGCTTGGATCTGACGGTTCACTAAACCAGC After the 3' (SEQ ID No: 11) PCR is obtained (SEQ ID No: 12), Nru I and Hind III double enzyme digestion, the pcDNA3 vector is also digested with Nru I+Hind III double enzymes, and ligated to construct pc3-CMVIE carrier. The IFNγR1-Fc fusion protein gene was synthesized from the whole gene, digested with Hind III+Xba I, and purified with the promegaWizard SV Gel and PCR clean-up System purification kit. The pc3-CMVIE vector was also digested with Hind III+Xba I, and the fragment was ligated to form a pc3-CMVIE-IFNγR1-Fc expression vector.
Embodiment 3
[0031] Example 3: Construction of the expression vector of the CHO stable strain of IFNγR1-Fc fusion protein
[0032] The pc3-CMVIE-IFNγR1-Fc vector was digested with Nru I+Nae I enzymes, and a fragment of about 3.4 kb was recovered using the promegaWizard SV Gel and PCR clean-up System purification kit. This fragment contains the entire expression cassette of IFNγR1-Fc, and the expression cassette is inserted into the pSCT-dhfr CHO stable cell line expression vector. After digesting pSCT-dhfr with EcoR V, purify the linearized fragment with the purification kit, dephosphorylate the vector with CIAP, and then purify it with the purification kit, then connect it with the 3.4kb IFNγR1-Fc expression cassette to construct pSCT- IFNγR1-Fc CHO stable strain expression vector, see the vector diagram figure 2 .
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap