Vector capable of being used for expressing foreign gene and cell line screening method

A technology of expressing vectors and cell lines, which is applied in the direction of using vectors to introduce foreign genetic material, genetic engineering, plant genetic improvement, etc. It can solve the problems of loss of gene expression level, unstable expression of target genes, and large manpower and time consumption.

Active Publication Date: 2012-07-11
SINO CELL TECH INC
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

High concentration of MTX can amplify the gene to improve protein expression ability, but the expression level of the gene is also very easy to lose in long-term culture, making the expression level of the target gene very unstable
Therefore, it is necessary to obtain a very small number of stable and high-expressing cell lines from a large number of cell expansion screening, which requires a lot of manpower and time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector capable of being used for expressing foreign gene and cell line screening method
  • Vector capable of being used for expressing foreign gene and cell line screening method
  • Vector capable of being used for expressing foreign gene and cell line screening method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of high-efficiency expression vectors

[0026] The eukaryotic expression vector was constructed based on the commercialized pcDNA3 / hyg vector, and the CMV promoter on the original vector was replaced with the human ubiquinone protein promoter (hUbc) with low activation efficiency. The specific method is well known to those skilled in the art. Design hUbc-F upstream primer 5'GCTTCGCGAGATCTGGCCTCCGCGC3' (SEQ ID NO: 1) and hUbc-R downstream primer 5'AGCAAGCTTGTCTAACAAAAAAGCC 3' (SEQ ID NO: 2), PCR commercialized vector Ubc.IkBSR-Flag Pgk.Cre plasmid , to obtain a 1.2 kb hUbc promoter PCR fragment (SEQ ID NO: 3). This fragment was double digested with Nru I and Hind III. After the pcDNA3 / hyg vector was digested with Nru I and Hind III, the digested product was purified using the promega WizardSV Gel and PCR clean-up System purification kit. The light chain expression cassette was ligated with the pcDNA3 vector using TaKaRa's DNALigation Kit Ver.2....

Embodiment 2

[0029] Example 2: Construction of the gene carrier of IFNγR1-Fc fusion protein

[0030] The highly efficient promoter CMV-IE sequence can be obtained by PCR from the pDendra2-N (Clonetech Company) vector, and the promoter sequence is used with promoter-F 5'GCTTCGCGAAGTTATTAATAGTAATCAATTACGG 3'(SEQ ID No: 10) and promoter-R 5'AGCAAGCTTGGATCTGACGGTTCACTAAACCAGC After the 3' (SEQ ID No: 11) PCR is obtained (SEQ ID No: 12), Nru I and Hind III double enzyme digestion, the pcDNA3 vector is also digested with Nru I+Hind III double enzymes, and ligated to construct pc3-CMVIE carrier. The IFNγR1-Fc fusion protein gene was synthesized from the whole gene, digested with Hind III+Xba I, and purified with the promegaWizard SV Gel and PCR clean-up System purification kit. The pc3-CMVIE vector was also digested with Hind III+Xba I, and the fragment was ligated to form a pc3-CMVIE-IFNγR1-Fc expression vector.

Embodiment 3

[0031] Example 3: Construction of the expression vector of the CHO stable strain of IFNγR1-Fc fusion protein

[0032] The pc3-CMVIE-IFNγR1-Fc vector was digested with Nru I+Nae I enzymes, and a fragment of about 3.4 kb was recovered using the promegaWizard SV Gel and PCR clean-up System purification kit. This fragment contains the entire expression cassette of IFNγR1-Fc, and the expression cassette is inserted into the pSCT-dhfr CHO stable cell line expression vector. After digesting pSCT-dhfr with EcoR V, purify the linearized fragment with the purification kit, dephosphorylate the vector with CIAP, and then purify it with the purification kit, then connect it with the 3.4kb IFNγR1-Fc expression cassette to construct pSCT- IFNγR1-Fc CHO stable strain expression vector, see the vector diagram figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a vector capable of being used for expressing a foreign gene. The vector is used for tightly connecting expression of a target gene with expression of hygromycin B phosphotransferase of a screening gene. According to the vector, a technology of avianizing the expression of an amplified gene enzyme dihydrofolate reductase (DHFR) for increasing the MTX (methotrexate) screening efficiency and reducing the MTX use concentration is adopted. The invention provides a screening method for obtaining high-level expression cloning after a cell is transfected by an expression vector optimized by adopting the technology.

Description

field of invention [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a vector for high-efficiency expression in mammalian cells using DNA recombination technology. Technology, a technology that weakens the expression of the amplified gene DHFR to improve the efficiency of MTX screening and reduce the concentration of MTX. The present invention also relates to a screening method for obtaining high-level expression clones after the expression vector optimized by the above technology is used to transfect cells. Background of the invention [0002] In order to obtain protein post-translational modifications consistent with functional and pharmacokinetic properties, biopharmaceutical proteins need to use mammalian cells as their expression host cells. Commonly used mammalian cell lines include Chinese hamster kidney cells (CHO), BHK cells and hybridoma NSO cells, etc. CHO cells are widely used because they can gro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/79C12N15/65C12N15/113C12N15/54C12N15/52C12Q1/04
Inventor 谢良志孙春昀罗春霞盖文琳
Owner SINO CELL TECH INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap