Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

19 results about "Deficient cell" patented technology

Application of arginine depletion engineered bacteria for soft tissue sarcoma treatment

PendingCN122251638ABacteriaPeptide/protein ingredientsSynovial sarcomaSpecific immunity
This invention discloses the application of arginine-depleted engineered bacteria for the treatment of soft tissue sarcomas, including preliminary validation, obtaining qualified engineered bacteria SGR1, obtaining drug compositions and regimens, experimental conclusions, and clinical application promotion. During use, clinical soft tissue sarcoma samples are collected, including undifferentiated pleomorphic sarcoma, synovial sarcoma, and liposarcoma. Immunohistochemistry (IHC) is used to detect ASS1 protein expression, qPCR is used to detect ASS1 gene transcription levels, and the proportion of ASS1 deletion / low expression is statistically analyzed. Arginine auxotrophic sarcoma subpopulations are confirmed based on literature. Cells are cultured in arginine-containing or arginine-free media, and cell viability, colony formation, cell cycle, and apoptosis are detected. The sensitivity of ASS1-deficient cells to arginine deprivation is verified, and therapeutic targets are identified. The enzyme activity, substrate specificity, and immunogenicity of human ARG I / II, mycoplasma ADI, and Pseudomonas ADI are compared. High-activity, low-immunogenic enzymes or enzyme combinations (such as human ARG I + microbial ADI) are selected, and site-directed mutagenesis or codon optimization is performed on microbial ADI to increase expression levels.
Owner:GUANGZHOU SINOGEN PHARMA CO LTD +1

Induction of cell death in cancer

The present invention relates to the discovery that depletion of FANC proteins or genes, such as FANCM, FANCD2, or FANCI, causes synthetic lethality in SETD2-deficient cells. Methods and compounds for use in treating SETD2-deficient cancers are provided.
Owner:FUNDAÇÃO GIMM- GULBENKIAN INSTITUTE FOR MOLECULAR MEDICINE +1

MGAT1-deficient cells and their use

A method for producing modified cells lacking mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase 1 ("MGAT1") activity is provided. The MGAT1 activity-deficient CHO cell line produced by this method is also provided. A method for producing glycoproteins is further disclosed.
Owner:ROCK BIOMEDICAL INC

Surf4 gene-deficient erythroid progenitor cells and method for differentiating same into erythroid cells

PCT designated stageWO2026089184A1Genetically modified cellsCulture processErythrocyte differentiationGene defect
The present invention relates to SURF4 gene-deficient erythroid progenitor cells and a method for differentiating same into erythroid cells. SURF4 gene-deficient cells in which the SURF4 gene has been knocked out of erythroid progenitor cells were found to express erythroid differentiation markers at a higher proportion and undergo erythroid differentiation more rapidly under erythroid differentiation conditions according to the present invention. Accordingly, the present invention provides a method for rapidly differentiating erythrocytes using SURF4 gene-deficient erythroid progenitor cells.
Owner:PUSAN NAT UNIV IND UNIV COOPERATION FOUND

Errα gene-deficient erythrocyte progenitor cells and method for differentiating erythrocytes thereof

PCT designated stageWO2026089183A1Genetically modified cellsCulture processErythrocyte differentiationGene defect
The present invention relates to ERRα gene-deficient erythrocyte progenitor cells and a method for differentiating erythrocytes thereof. It was confirmed that ERRα gene-deficient cells, in which ERRα genes are knocked out in erythrocyte progenitor cells, exhibit a higher expression level of erythrocyte differentiation markers and a more rapid progression of erythrocyte differentiation under erythrocyte differentiation conditions according to the present invention. Accordingly, the present invention provides a method for rapidly differentiating erythrocytes by using ERRα gene-deficient erythrocyte progenitor cells.
Owner:PUSAN NAT UNIV IND UNIV COOPERATION FOUND

Ut2 gene-deficient erythroid progenitor cells and method for differentiating same into erythroid cells

PCT designated stageWO2026089182A1Genetically modified cellsCulture processErythrocyte differentiationGene defect
The present invention relates to UT2 gene-deficient erythroid progenitor cells and a method for differentiating same into erythrocytes. It was confirmed UT2 gene-deficient cells in which the UT2 gene is knocked out in erythroid progenitor cells exhibit a higher expression ratio of erythroid differentiation markers and more rapid progression of erythroid differentiation under erythroid differentiation conditions according to the present invention, Accordingly, the present invention provides a method capable of rapidly differentiating erythroid cells using UT2 gene-deficient erythroid progenitor cells.
Owner:PUSAN NAT UNIV IND UNIV COOPERATION FOUND

MGAT1 deficient cells and uses thereof

A method for producing a modified cell deficient in mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase 1 (“MGAT1”) activity. Also provided is a CHO cell line deficient in MGAT1 activity produced by the method. Further disclosed are methods for producing a glycoprotein.
Owner:ROCK BIOMEDICAL INC

Construction method of CETN3 knockout cell line, human brain organ with microhead malformation disease and application of human brain organ

The invention provides a construction method of a CETN3 knockout cell line, a human brain organ with microhead deformity and application of the human brain organ, and belongs to the field of organoids. The CETN3-deficient stem cells prepared by the method provided by the invention still have normal multiplication capacity and differentiation potential, do not influence the development of organoid, can still develop into organoid with good morphology, but have reduced volume, which is similar to phenotypes appearing in small head malformation patients. The CETN3 knockout embryonic stem cell line is utilized, the cells can be self-organized into a structure similar to the human cerebral cortex through nerve induction and 3D culture, and the phenotype of a small head malformation patient is simulated. By utilizing the organ, the research on the disease mechanism can be promoted, and the medicine can be screened more effectively and conveniently.
Owner:TONGJI UNIV

Construction of miR-155 gene deleted DF-1 cell line based on CRISPR / Cas9 technology

The invention provides a method for constructing a DF-1 cell line with miR-155 gene deletion based on a CRISPR / Cas9 technology, and belongs to the technical field of gene editing. The invention provides a method for knocking out a miR-155 gene in a DF-1 cell line by using a CRISPR-Cas9 system, which is characterized in that gRNA (guide ribonucleic acid) of a targeted miR-155 gene is designed and synthesized according to a miR-155 gene sequence, then a CRISPR-Cas9 recombinant plasmid containing the gRNA is constructed, and the CRISPR-Cas9 recombinant plasmid is transferred into a DF-1 cell to obtain the DF-1 with the miR-155 gene deleted. The homozygous miR-155 gene deletion cell strain obtained by the method provides an effective cell research model for further functional research of a disease-resistant candidate gene miR-155.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Nrf-2 deficient cells and uses thereof

PendingAU2019398111B2Cancer cellEfficacy
The present disclosure relates to T cell anticancer immunotherapy based on modulation of Nrf2 expression, that is, to an Nrf2-targeting immune cell, e.g., T cell, anticancer therapy. The present disclosure allows deep interference with the Nrf2 expression in T cells, thereby solving the problem of immune tolerance shown by cancer cells to T cells; in other words, the effect of anticancer immunotherapy can be improved by targeting Nrf2. The present disclosure can provide an Nrf2-targeting new T cell anticancer immunotherapy and a T cell for the second-generation anticancer immunotherapy. This technology is applicable to the preparation of CAR-T, engineered T, and TIL T cells, and to the treatment of various solid carcinomas, including lymphoma. It can be said to be a new anticancer therapy that improves the therapeutic efficacy effectively.

Mutant HLA-e heavy chain, HLA-e trimer, and use thereof

Provided are a mutant HLA-E heavy chain, an HLA-E trimer, and a use thereof. The mutant HLA-E heavy chain is obtained by modifying the extracellular domain and / or the transmembrane domain of a wild-type HLA-E heavy chain. MHC-I-deficient cells expressing the HLA-E trimer containing the mutant HLA-E heavy chain has a significantly improved ability to counter immune rejection by NK cells, and can continuously resist the killing effect of NK cells.
Owner:REFORGENE MEDICINE

A synthetic lethal combination preparation for treating liver cancer and its application

The present invention provides a synthetic lethal combination preparation for treating liver cancer and its application, belonging to the field of cell biology and medical technology. The present invention finds that low-dose iron intervention preparations or miR-122 inhibitors do not affect the activity of liver cancer cells when used alone, but the combination of the two can cause significant death of liver cancer cells. In addition, the present invention also finds that low-dose iron intervention preparations do not cause the death of normal liver cells, but can cause the death of miR-122-deficient liver cells, and the greater the dose of iron intervention preparations, the more miR-122-deficient cells die. This phenomenon shows that iron intervention preparations and miR-122 deletion / inhibition have synthetic lethal effects and have significant application prospects in the treatment of liver cancer.
Owner:THE NAVAL MEDICAL UNIV OF PLA

Complement component 1s (C1s) deficient cells for production of vaccines and biopharmaceutical proteins

The present disclosure reports that a calcium-dependent serine protease, complement component is (C1s) has been identified as a protease responsive for cleavage of exogenous polypeptides expressed in mammalian cell lines such as CHO cells. These CHO cell lines provide for increased yield of antigenically correct, uncleaved exogenous polypeptide as compared to unmodified CHO cells expressing the active C1s protease. C1s-deficient cell lines and methods for use of same for producing exogenous polypeptides, e.g., human immunodeficiency virus (HIV) envelope glycoprotein polypeptides, such as, gp120 or human Factor VIII are provided.
Owner:RGT UNIV OF CALIFORNIA

Application of miRNA markers in the prevention or treatment of hypoxia-related diseases

This invention relates to the field of biomedicine and provides the use of miRNA markers for the prevention or treatment of hypoxia-related diseases. Using TED-deficient cells, the present invention screens transcriptome-wide ceRNAs (ceRNAs) to obtain a panel of miRNA markers, including one or more of miR-199a-3p, miR-199b-3p, and miR-488-3p. These markers can regulate EPAS1 expression and are applicable to detecting hypoxia tolerance, preventing or treating diseases or injuries caused by low or hypoxic environments, and providing new insights into the molecular mechanisms of hypoxia tolerance.
Owner:GENERAL HOSPITAL OF PLA

Specific recognition of pig acadl gene editing site and application thereof

PendingCN122278877AExonElectroporation
This invention discloses an editing site that specifically identifies the porcine ACADL gene and its application, relating to the field of biotechnology. The editing site includes two editing sites, T1 and T2. The sequence of the T1 editing site is: CGTGGATCTCTGCGCTTGTG, and the sequence of the T2 editing site is: CGTGCTCCGCGCCTACCGA. Both T1 and T2 editing sites are located in the first exon region of the coding region of the ACADL gene on porcine chromosome 15. The chromosome coordinates of the T1 editing site are 75441814–75441833, and the coding region coordinates are 246–265; the chromosome coordinates of the T2 editing site are 75442009–75442028, and the coding region coordinates are 441–460. This invention is based on CRISPR / Cas9 gene editing technology. A targeting vector with a porcine ACADL gene editing site inserted was constructed using the PX459 vector as a backbone. Combined with electroporation and puromycin screening, and PCR amplification and Sanger sequencing, ACADL-deficient cell lines were obtained. Cell proliferation was observed using CCK-8, cloning experiments and EDU555 assays. This invention provides insights into the role of the ACADL gene in pork breed improvement.
Owner:INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI

Method for inactivating glutamine synthetase gene, and method for producing target protein by using same

The present invention relates to: a method for inactivating a glutamine synthetase (GS) gene involved in the synthesis of glutamine, which is a major energy source of cell growth, by using a zinc-finger nuclease; a cell line in which a GS gene is inactivated by the method; and a method for producing a target protein by using the method. According to the present invention, deletion or addition of a GS gene of a host cell is induced through a zinc-finger nuclease, which selectively binds to the GS gene, thereby enabling the GS gene to be effectively inactivated. According to the present invention, since a cell line having an inactivated GS gene loses glutamine synthesis ability, a cell line in which a target recombinant protein is highly expressed can be effectively selected merely through a glutamine-deficient culture medium without adding an inhibitor by using a vector comprising a GS gene as a selection marker, and a cell line in which the expression of a target protein is stably maintained can be effectively selected. In addition, according to the present invention, a high-quality target protein can be produced using the GS gene-deficient cell line.
Owner:CELLTRION INC

MGAT1-deficient cells and uses thereof

A method for producing a modified cell lacking mannosyl (alpha-1, 3-)-glycoprotein beta-1, 2-N-acetylglucosamino transferase 1 ("MGAT1") activity is disclosed. Also provided are CHO cell lines that lack MGAT1 activity produced by the methods. Further disclosed are methods for producing glycoproteins.
Owner:ROCK BIOMEDICAL INC

Treatment of P53-deficient cancers

Provided are methods and formulations for the treatment of p53-deficient cancers using a combinational drug strategy which enhances DNA damage in p53 deficient cells while not allowing cells to escape cell death by activation of p53-p21 signaling. Wild-type p53 carriers, on the other hand, respond with activation of p53-p21 signaling and cell-cycle arrest, thereby escaping cell death. The methods involve administering to an individual in need of treatment a combination of one or more poly (ADP ribose) polymerase inhibitors (PARPi) and one or more deoxyuridine analogs. Pharmaceutical formulations comprising PARPi and dU analogs are also provided.
Owner:HEALTH RESEARCH INC

Inducing cell lethality in cancer

PendingCN120897998AAntineoplastic agentsDNA/RNA fragmentationSynthetic lethalityFANC proteins
The present invention relates to the discovery that depletion of a FANC protein or gene, such as FANCM, FANCD2 or FANCI, causes synthetic lethality of SETD2 deficient cells. Methods and compounds for the treatment of SETD2 deficient cancers are provided.
Owner:FUNDAÇÃO GIMM- GULBENKIAN INSTITUTE FOR MOLECULAR MEDICINE +1