9 results about "Deficient cell" patented technology

This invention discloses the application of arginine-depleted engineered bacteria for the treatment of soft tissue sarcomas, including preliminary validation, obtaining qualified engineered bacteria SGR1, obtaining drug compositions and regimens, experimental conclusions, and clinical application promotion. During use, clinical soft tissue sarcoma samples are collected, including undifferentiated pleomorphic sarcoma, synovial sarcoma, and liposarcoma. Immunohistochemistry (IHC) is used to detect ASS1 protein expression, qPCR is used to detect ASS1 gene transcription levels, and the proportion of ASS1 deletion / low expression is statistically analyzed. Arginine auxotrophic sarcoma subpopulations are confirmed based on literature. Cells are cultured in arginine-containing or arginine-free media, and cell viability, colony formation, cell cycle, and apoptosis are detected. The sensitivity of ASS1-deficient cells to arginine deprivation is verified, and therapeutic targets are identified. The enzyme activity, substrate specificity, and immunogenicity of human ARG I / II, mycoplasma ADI, and Pseudomonas ADI are compared. High-activity, low-immunogenic enzymes or enzyme combinations (such as human ARG I + microbial ADI) are selected, and site-directed mutagenesis or codon optimization is performed on microbial ADI to increase expression levels.

A method for producing modified cells lacking mannosyl(alpha-1,3)-glycoprotein beta-1,2-N-acetylglucosamine transferase 1 ("MGAT1") activity is provided. The MGAT1 activity-deficient CHO cell line produced by this method is also provided. A method for producing glycoproteins is further disclosed.

The present invention relates to SURF4 gene-deficient erythroid progenitor cells and a method for differentiating same into erythroid cells. SURF4 gene-deficient cells in which the SURF4 gene has been knocked out of erythroid progenitor cells were found to express erythroid differentiation markers at a higher proportion and undergo erythroid differentiation more rapidly under erythroid differentiation conditions according to the present invention. Accordingly, the present invention provides a method for rapidly differentiating erythrocytes using SURF4 gene-deficient erythroid progenitor cells.

The present invention relates to ERRα gene-deficient erythrocyte progenitor cells and a method for differentiating erythrocytes thereof. It was confirmed that ERRα gene-deficient cells, in which ERRα genes are knocked out in erythrocyte progenitor cells, exhibit a higher expression level of erythrocyte differentiation markers and a more rapid progression of erythrocyte differentiation under erythrocyte differentiation conditions according to the present invention. Accordingly, the present invention provides a method for rapidly differentiating erythrocytes by using ERRα gene-deficient erythrocyte progenitor cells.

The present invention relates to UT2 gene-deficient erythroid progenitor cells and a method for differentiating same into erythrocytes. It was confirmed UT2 gene-deficient cells in which the UT2 gene is knocked out in erythroid progenitor cells exhibit a higher expression ratio of erythroid differentiation markers and more rapid progression of erythroid differentiation under erythroid differentiation conditions according to the present invention, Accordingly, the present invention provides a method capable of rapidly differentiating erythroid cells using UT2 gene-deficient erythroid progenitor cells.

The present disclosure relates to T cell anticancer immunotherapy based on modulation of Nrf2 expression, that is, to an Nrf2-targeting immune cell, e.g., T cell, anticancer therapy. The present disclosure allows deep interference with the Nrf2 expression in T cells, thereby solving the problem of immune tolerance shown by cancer cells to T cells; in other words, the effect of anticancer immunotherapy can be improved by targeting Nrf2. The present disclosure can provide an Nrf2-targeting new T cell anticancer immunotherapy and a T cell for the second-generation anticancer immunotherapy. This technology is applicable to the preparation of CAR-T, engineered T, and TIL T cells, and to the treatment of various solid carcinomas, including lymphoma. It can be said to be a new anticancer therapy that improves the therapeutic efficacy effectively.

The present disclosure reports that a calcium-dependent serine protease, complement component is (C1s) has been identified as a protease responsive for cleavage of exogenous polypeptides expressed in mammalian cell lines such as CHO cells. These CHO cell lines provide for increased yield of antigenically correct, uncleaved exogenous polypeptide as compared to unmodified CHO cells expressing the active C1s protease. C1s-deficient cell lines and methods for use of same for producing exogenous polypeptides, e.g., human immunodeficiency virus (HIV) envelope glycoprotein polypeptides, such as, gp120 or human Factor VIII are provided.

This invention discloses an editing site that specifically identifies the porcine ACADL gene and its application, relating to the field of biotechnology. The editing site includes two editing sites, T1 and T2. The sequence of the T1 editing site is: CGTGGATCTCTGCGCTTGTG, and the sequence of the T2 editing site is: CGTGCTCCGCGCCTACCGA. Both T1 and T2 editing sites are located in the first exon region of the coding region of the ACADL gene on porcine chromosome 15. The chromosome coordinates of the T1 editing site are 75441814–75441833, and the coding region coordinates are 246–265; the chromosome coordinates of the T2 editing site are 75442009–75442028, and the coding region coordinates are 441–460. This invention is based on CRISPR / Cas9 gene editing technology. A targeting vector with a porcine ACADL gene editing site inserted was constructed using the PX459 vector as a backbone. Combined with electroporation and puromycin screening, and PCR amplification and Sanger sequencing, ACADL-deficient cell lines were obtained. Cell proliferation was observed using CCK-8, cloning experiments and EDU555 assays. This invention provides insights into the role of the ACADL gene in pork breed improvement.

Provided are methods and formulations for the treatment of p53-deficient cancers using a combinational drug strategy which enhances DNA damage in p53 deficient cells while not allowing cells to escape cell death by activation of p53-p21 signaling. Wild-type p53 carriers, on the other hand, respond with activation of p53-p21 signaling and cell-cycle arrest, thereby escaping cell death. The methods involve administering to an individual in need of treatment a combination of one or more poly (ADP ribose) polymerase inhibitors (PARPi) and one or more deoxyuridine analogs. Pharmaceutical formulations comprising PARPi and dU analogs are also provided.