216 results about "Muscular dystrophy" patented technology

Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload inhibits expression or activity of a DMPK allele comprising a disease-associated-repeat. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide or RNAi oligonucleotide.

Aspects of the disclosure relate to complexes comprising a muscle-targeting agent covalently linked to a molecular payload. In some embodiments, the muscle-targeting agent specifically binds to an internalizing cell surface receptor on muscle cells. In some embodiments, the molecular payload inhibits expression or activity of a DMPK allele comprising a disease-associated-repeat. In some embodiments, the molecular payload is an oligonucleotide, such as an antisense oligonucleotide or RNAi oligonucleotide.

An isolated nucleic acid that includes the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) is provided. In some embodiment, the nucleic acid includes at least one chemically-modified nucleotide. The nucleic acid and composition containing same find use in treating conditions associated with inflammation and / or fibrosis, for example, without limitation, heart conditions, such as hypertrophic myocardiopathy, myocardial infarction, and heart failure with preserved ejection fraction; muscle disorders, such as muscular dystrophy; skin disorders, such as scleroderma; and inflammatory conditions, such as autoimmune conditions or inflammatory conditions associated with a viral infection.

Methods, systems, and techniques for controlling actuators by using eye gaze technology such as in a wheelchair or bed, are provided. Example embodiments provide an Eye Gaze Actuator Control System (“EGACS”) which enables people with advanced motor neuron diseases or disabilities like amyotrophic lateral sclerosis or muscular dystrophy to use eye gaze technologies to control their actuators that control seating, bed positioning, and movement of motor-controlled devices. In one embodiment, the example EGACS comprises a display device, eye gaze sensor, eye gaze control application, and device interface(s) to one or more other devices that control aspects of a powered wheelchair, bed, vehicle, or other device. These components cooperate to control the powered wheelchair, bed, or vehicle using eye gaze technology as opposed to by manual control.

The present invention relates to immune cells engineered to express chimeric antigen receptors (CARs) that specifically bind to fibroblast activating proteins (FAPs) for use in the treatment of skeletal muscle fibrosis in muscular dystrophy.

To provide gene therapy vectors, such as adeno-associated virus (AAV) vectors, expressing a miniaturized human micro-dystrophin gene, and a method of using these vectors to express micro-dystrophin in a skeletal muscle including a diaphragm and a cardiac muscle and to protect muscle fibers from injury, increase muscle strength and reduce and / or prevent fibrosis in subjects suffering from muscular dystrophy.SOLUTION: In one embodiment, the present invention provides a rAAV vector comprising a nucleotide sequence of a muscle-specific control element and a nucleotide sequence encoding a microdystrophin protein.SELECTED DRAWING: Figure 1

The present invention particularly provides anti-Flt-1 antibodies and methods for treating muscular dystrophy, specifically Duchenne muscular dystrophy (DMD). In some embodiments, the methods according to the present invention include administering an effective amount of an anti-Flt-1 antibody or an antigen binding protein thereof to an individual suffering from or susceptible to DMD, such that at least one symptom or feature of DMD is reduced in intensity, severity, or frequency or the onset is delayed.

Disclosed herein are pharmaceutical agents and compositions that activate integrin heterodimers that contain beta-1 integrin protein that specifically bind laminin protein. Such agents and compositions are useful for treating diseases related to muscle malfunction, including muscular dystrophies.

The present invention provides compositions and methods of their use in treating dystroglycanopathy, muscular dystrophy and other disorders. In particular, a method of treating a disorder associated with a mutation or loss of function in a fukutin related protein (FKRP) gene and / or a disorder associated with a defect in glycosylation of α-DG in a subject is provided, comprising administering to the subject an effective amount of a ribitol and a selective estrogen receptor modulator (SERM).

Provided herein are, in various embodiments, methods and compositions for treating muscular dystrophy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a composition comprising a bottlebrush polymer-oligonucleotide conjugate. Also provided herein are methods of making bottlebrush polymer-oligonucleotide conjugates.

A phosphorothioate-containing RNA molecule that includes the nucleotide sequence: 5'-NCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC-3' (SEQ ID NO: 1), where N is uracil or thymine, is provided. The RNA molecule can include one or more phosphorothioate bonds between nucleic acid residues in one or more pairs (e.g., between nucleic acid residues in each pair) of consecutive nucleic acid residues within SEQ ID NO: 1. The RNA molecule and compositions thereof find use in treating muscle disorders, such as muscular dystrophy, heart conditions, such as heart failure or myocardial infarction, and / or conditions associated with inflammation and / or fibrosis.

The present invention provides a method for diagnosing a patient having a neurological (including neuromuscular) disorder, which method extends to the pre-symptomatic diagnosis of said patients. The invention further relates to a method for distinguishing between neurological disorders, said method extending to include the ability to discriminate one subtype from other subtypes of the same disorder. Examples of the latter include the ability to discriminate: spinal muscular dystrophy type II (astasia) from spinal muscular atrophy type II or type IV (mobile but may subsequently lose ambulation); "fast- progression" amyotrophic lateral sclerosis from "slow-progression" amyotrophic lateral sclerosis; and "severe disease stage" amyotrophic lateral sclerosis from "mild disease stage" amyotrophic lateral sclerosis. In this way, the present invention allows one to monitor disease state progression of a neurological disorder in a patient, or to track a patient's responsiveness to therapeutic intervention.

Antisense oligomers complementary to a selected target site in the human dystrophin gene to induce exon 50 skipping are described. In various aspects, antisense oligomers are described according to Formula (I):or a pharmaceutically acceptable salt thereof, wherein T, Nu, n, and R100 are defined herein.

The invention relates to the technical field of biomedicine, in particular to a method for regulating and controlling the liquid-liquid phase separation capacity and function of DUX4 and application of the method, and the liquid-liquid phase separation capacity and function of the DUX4 are regulated and controlled by mutating an internal disordered region of the DUX4. The invention finds that the mutation has a remarkable inhibition effect on expression of DUX4 activated totipotent genes and FSHD related genes; according to the method, an intracellular liquid-liquid phase separation model is constructed through intracellular overexpression of DUX4; a research basis and a model are provided for subsequent LLPS research of DUX4, and thinking and mechanism explanation are provided for research of DUX4-mediated facial shoulder brachial muscular dystrophy (FSHD) and development of treatment targets.

The present invention provides novel gene therapy compositions for use in treatment of Duchenne Muscular Dystrophy (DMD).

Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.

The present invention relates to a composition for enhancing or protecting muscles, comprising a fermented salmon roe product. According to the present invention, if salmon roe is fermented, the amino acid composition of proteins changes, and the effects of promoting muscle synthesis, inhibiting muscle degradation and damage, and protecting muscles are greatly improved. Therefore, the fermented salmon roe product of the present invention can be applied to food to exhibit effects of enhancing and protecting muscles, and can also be used as a pharmaceutical composition for preventing or treating sarcopenia or amyotrophic diseases through the effects.

Disclosed herein are compositions that are useful for targeting a signaling pathway modulator to a muscle cell. In some instances, such compositions may be useful in treating a muscle disorder, such as muscular dystrophy.

The present invention relates to activin receptor IIA type variants and methods of use thereof. The present invention features a polypeptide comprising an extracellular ActRIIa variant. In some embodiments, the polypeptides of the present invention comprise an extracellular ActRIIa variant fused to an Fc domain monomer or part. The invention also features the treatment of diseases and conditions involving muscle weakness and atrophy using said polypeptides, such as Duchenne muscular dystrophy, facial shoulder brachial muscular dystrophy, inclusion body myositis, amyotrophic lateral sclerosis, sarcopenia; or cancer cachexia; the present invention relates to pharmaceutical compositions and methods for treating a metabolic disease, such as obesity, type 1 diabetes mellitus or type 2 diabetes mellitus.

The present disclosure relates to a composition for preventing or treating muscle disease, comprising CXCL14 as an active ingredient. According to the present disclosure, it was confirmed that CXCL14 increased muscle differentiation and synthesis, thereby increasing muscle mass. In addition, it was confirmed that in LPS-induced muscular atrophy or DEX-induced muscular dystrophy, CXCL14 inhibited muscle loss, increased the expression of muscle synthesis and differentiation factors, and inhibited the expression of muscle degradation proteins. In addition, it was confirmed that CXCL14 promoted muscle synthesis and differentiation and inhibited the muscle degradation even in vivo.

New dosing regimens for treating muscular dystrophy in a patient suffering from Duchenne muscular dystrophy (DMD) with an antisense oligonucleotide conjugate that causes skipping of an exon in the human dystrophin gene are described. Also described is a method of treating a patient with an antisense oligomer CPP conjugate and a magnesium supplement.

Recombinant myotropic AAV rh.74 capsids are described herein. In addition, plasmids, viral vectors, dual vector systems, cells, and compositions comprising or encoding such recombinant capsids are further described. Such recombinant polynucleotides, plasmids, viral vectors, dual vector systems, cells, and compositions may be used to treat muscle diseases or disorders, including muscular dystrophies and cardiomyopathies.

Antisense oligomers complementary to a selected target site in the human dystrophin gene to induce exon 51 skipping are described.

The present invention relates to compounds for use in treating a disease or disorder associated with muscle fibrosis in a subject. In particular, the present invention relates to inhibitors of the RhoA / ROCK pathway for use in treating a disease or disorder associated with muscle fibrosis, like muscular dystrophy in a subject.

Disclosed herein are improved methods for treating muscular dystrophy, such as DMD, BMD, or FSHD. Various combination therapies and monotherapies are provided.

The present invention relates to an albumin nanocomposite comprising a phytochemical, and a composition for improving muscle diseases comprising the same, and more specifically, to an albumin nanocomposite comprising a phytochemical, the present invention relates to an albumin nanocomposite containing phytochemicals, and more specifically, to an albumin nanocomposite containing phytochemicals, which exhibits the effects of inhibiting muscle reduction caused by oxidative stress or inflammatory response and promoting the differentiation of myoblasts into muscle cells. The albumin nanocomposite containing the phytochemicals can target and induce immune cells of active oxygen and inflammatory reaction and effectively deliver the phytochemicals, so that muscle cell atrophy is inhibited and differentiation is promoted by adjusting a muscle reduction signal mechanism induced by the active oxygen and the inflammatory reaction, and further muscle reduction can be improved, so that the curative effect of the albumin nanocomposite is improved. The muscular dystrophy is prevented and treated. Therefore, the composition containing the albumin nanocomposite containing phytochemicals of the present invention can be provided as a composition for improving muscle diseases.

The invention discloses application of hydrogen-rich water in preparation of a drug for treating Duchenne type muscular dystrophy, and particularly relates to the technical field of medicines.The random control experiment is adopted, homologous c57 mice serve as a normal control group, mdx mice are randomly divided into a model group and a hydrogen-rich water group, and the exercise ability is evaluated through a four-limb holding power test and a rotating bar test; detecting mouse creatine kinase by an enzyme-linked immunosorbent assay; carrying out hematoxylin-eosin, NADH-tetrazole reductase and improved Goori three-color dyeing, and carrying out cytochrome C oxidase, succinate dehydrogenase and SDH-COX combined dyeing to observe the pathological change of the skeletal muscle tissue; the invention discloses that the muscle injury condition of a Duchenne type muscular dystrophy model mouse is improved by the hydrogen-rich water through a mitochondrial protection mechanism, and the hydrogen-rich water has a relatively high application prospect and a relatively high economic value.

The present invention provides an oral dosage form for, and a therapeutically effective dose for the management and / or treatment of muscular dystrophy using Sitagliptin or its pharmaceutically acceptable salt, alone or in combination with other therapeutically effective agents.

The invention discloses a fluorescent quantitative PCR (Polymerase Chain Reaction) primer probe and a kit for detecting abalone muscular dystrophy virus. The probe and the primer are designed for a highly conserved region of an AbSV genome, a real-time fluorescent PCR system is established, and the probe and the primer can be used for detection of abalone muscular dystrophy virus and quantitative analysis of virus load; the detection sensitivity is high, and 10 copies / mu L of viruses can be detected; the method is simple to operate, low in detection cost and wide in application range; the detection specificity is high, the detection speed is high, and the detection process can be completed in only 80 minutes.

The present application provides an engineered circular RNA capable of recruiting adenosine deaminase acting on RNA (ADAR; arRNA) and its application in treating Duchenne muscular dystrophy (DMD).