Aptamer capable of being in specific binding to TS/MDEP protein in gastric cancer cells

A gastric cancer and protein technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, material inspection products, etc., can solve the problem of expression reduction and achieve the effect of simple method and low cost

Inactive Publication Date: 2015-08-05
刘红卫
View PDF2 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, for example, CN101168566A discloses that the expression of TS / MEDP protein is the highest in BGC823 in the M phase, and its expression level gradually decreases with the completion of cell division

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment I

[0022] The SELEX screening of embodiment 1 TS / MDEP protein specific binding DNA adapter

[0023] The conventional TS / MDEP protein expression method in the art was adopted. According to the known gene sequence, the corresponding gene sequence was obtained by conventional gene synthesis or genome retrieval, and the TS / MDEP protein was expressed in vitro by yeast expression method, and the corresponding protein was obtained, which was named TS / MDEP.

[0024] Chemically synthesize the initial oligonucleotide random library and primers, the sequence is as follows: (5'-GGTAACTAGCGTTACTGCTAG----N38----TGCATAAGGCATCATTGGAA-3'), wherein N38 is 38 random oligonucleotides;

[0025] Primer P1: GGTAACTAGCGTTACTGCTAG;

[0026] Primer P2: TTCCAATGATGCCTTATGCA.

[0027] The single-stranded DNA library was amplified into double-stranded DNA, and the product was subjected to 2% agarose gel electrophoresis and then gel-cut to recover and purify; the recovered double-stranded DNA was used as ...

Embodiment 2

[0028] Example 2 Obtainment of TS / MDEP-binding gametes with high specificity and high affinity

[0029] name Dissociation constant Kd TS-002 22nM TS-005 27nM TS-006 25nM TS-013 29nM TS-014 33nM TS-015 21nM TS-017 19nM TS-019 28nM TS-024 27nM TS-026 22nM TS-028 33nM TS-030 32nM PBS blank control no binding ability

Embodiment 3

[0030] Example 3 The aptamer specificity analysis and stability analysis

[0031] Human albumin, RASAL1 protein, YAP protein, TRIM59 protein and 12 aptamers were used for specific detection. After binding experiments, it was found that these aptamers did not bind to these proteins, but only combined with TS / MDEP maintain high specificity.

[0032] 0.1 ug of the aptamer was taken and placed in normal temperature serum and aqueous solution for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after two weeks of placement.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a targeted artificial TS / MDEP protein nucleic acid aptamer and a sequence thereof. A new combinatorial chemistry technology SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is applied, the TS / MDEP protein serves as a target protein, and a DNA aptamer capable of being in specific binding to the TS / MDEP protein is screened from a single-chain RNA random library. The aptamer can form a special stem-loop structure in a random sequence area and can be in specific and high-affinity binding to the TS / MDEP protein or targeted binding to gastric cancer cells. The RNA aptamer provides a specific and efficient marker molecule for the gastric cancer diagnosis and treatment field, as well as a new choice for developing gastric cancer diagnosis reagents and gastric cancer treatment medicines.

Description

technical field [0001] The invention belongs to the field of biological detection. Background technique [0002] Nucleic acid aptamer (aptamer) is an artificial single-stranded oligonucleotide ligand of a biological macromolecule, which is screened from a random single-stranded oligonucleotide library by SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology. SELEX technology (that is, phylogenetic evolution index enrichment technology) is a new combinatorial chemistry technology developed / developed in the early 1990s. It uses a large-capacity random oligonucleotide library, combined with in vitro PCR amplification technology, to The oligonucleotides that specifically bind to the target molecule are enriched exponentially, and after multiple rounds of screening, nucleotide aptamers (aptamers) with high affinity and strong specificity are obtained. This technology has been successfully applied to the screening of many target molecules, including metal i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115G01N33/68
Inventor刘红卫
Owner刘红卫