Gene delivery system for the treatment of heart failure

Abstract

This disclosure generally relates to compositions for treating heart failure and methods of using the same, including administering a composition to cardiac tissue of a subject in need of such treatment with a modified mRNA (modRNA) encoding phosphatidylinositol-5-phosphate 4-kinase γ (pip4k2c).

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of U.S. Provisional Application 62 / 933,681, filed November 11, 2019, the disclosure of which is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure generally relates to gene delivery systems and methods of use for the treatment and prevention of heart diseases, including heart failure.

[0004] The sequence list provided electronically is incorporated by reference.

[0005] An electronic version of the sequence list is submitted, the contents of which are incorporated in their entirety by reference. The electronic file is 15.0 kilobytes in size and is titled MSIP_190712-WO_Sequence List_ST25.txt. Background Technology

[0006] Heart disease includes heart failure, heart attack, and related complications. Heart failure (HF) is a leading cause of morbidity and mortality worldwide. Heart failure, sometimes called congestive heart failure, typically develops gradually over time as the heart muscle weakens. In some cases of heart failure, once the heart muscle is damaged and weakened, the ventricles stretch (dilate) to the point that the heart cannot effectively pump blood throughout the body. This is often due to dilated cardiomyopathy (DCM)—a heart muscle disease that usually begins in the heart's main pump chamber (left ventricle)—where the heart muscle begins to dilate, meaning it stretches and thins. As the chambers dilate, the heart muscle no longer contracts normally and cannot pump blood well. As the heart weakens, heart failure can occur.

[0007] To date, the only treatment option for heart failure is to prevent further damage by controlling blood pressure, reducing the occurrence of arrhythmias, and preventing blood clot formation. There are no medications that can reverse weakened heart muscle. For those with severe deep cardiac complication (DCM), the only treatment is invasive procedures such as left ventricular surgery or implantation of a biventricular pacemaker and cardioverter defibrillator. Such surgical interventions pose risks for subjects with advanced heart failure, and it is unclear whether such treatments always improve long-term outcomes. Therefore, there is a need for less invasive therapies that not only treat heart failure but also improve myocardial function. Summary of the Invention

[0008] This disclosure is based, at least in part, on the development of superior compositions and methods of using these compositions to treat heart failure in general.

[0009] Therefore, one aspect of this disclosure provides a method for treating heart failure, the method comprising administering a modified mRNA (modRNA) encoding phosphatidylinositol type 2 phosphokinase 4-phosphate γ (pip4k2c) to the heart tissue of a subject in need. In some cases, gene expression of pip4k2c increases after administration of the modRNA encoding pip4k2c to the heart tissue of a subject in need. In other cases, gene expression of pip4k2c increases to at least 5-fold one day after administration of the modRNA encoding pip4k2c to the heart tissue of a subject in need. In still other cases, pip4k2c expression increases to at least 5-fold one day after administration of the modRNA encoding pip4k2c to the heart tissue of a subject in need, lasting for at least 8 days.

[0010] Any method used to deliver the modRNA encoding pip4k2c can inhibit the activity of mammalian target of rapamycin complex 1 (mTORC1), transforming growth factor β (TGFβ), or a combination thereof, after administration of the modRNA encoding pip4k2c to the heart tissue of a subject in need. In some instances, both mTORC1 and TGFβ were inhibited after administration of the modRNA encoding pip4k2c to the heart tissue of a subject in need.

[0011] In some embodiments, the method of administering modRNA encoding pip4k2c to the heart tissue of a subject in need increases life expectancy by at least 10% compared to an untreated subject with the same disease symptoms and predicted outcomes. In other embodiments, the method of administering modRNA encoding pip4k2c to the heart tissue of a subject in need improves cardiac function by at least 10% compared to an untreated subject with the same disease symptoms and predicted outcomes. In still other embodiments, the method of administering modRNA encoding pip4k2c to the heart tissue of a subject in need reduces cardiac fibrosis by at least 5% compared to an untreated subject with the same disease symptoms and predicted outcomes. In other embodiments, the method of administering modRNA encoding pip4k2c to the heart tissue of a subject in need reverses cardiac hypertrophy by at least 10% compared to an untreated subject with the same disease symptoms and predicted outcomes. In some instances, the heart failure treated by the methods disclosed herein is dilated cardiomyopathy (DCM).

[0012] Another aspect of this disclosure provides a gene delivery system for treating heart failure, comprising a modified mRNA (modRNA) encoding phosphatidylinositol type 2 phosphatidylinositol-5-phosphate 4-kinase γ (pip4k2c). In some instances, the gene delivery system for treating heart failure comprising the modRNA encoding pip4k2c can be locally applied to cardiac tissue. In other instances, the gene delivery system for treating heart failure comprising the modRNA encoding pip4k2c is locally applied to cardiac tissue to increase pip4k2c expression. In still other instances, the gene delivery system for treating heart failure comprising the modRNA encoding pip4k2c is locally applied to cardiac tissue to inhibit mammalian target of rapamycin complex 1 (mTORC1), transforming growth factor β (TGFβ), or a combination thereof, in cardiac tissue.

[0013] Any gene delivery system disclosed herein used to deliver locally applied modRNA encoding pip4k2c for the treatment of heart failure may further include a delivery agent. In some instances, the gene delivery system may further include a delivery agent targeting cardiac tissue. In some other instances, the gene delivery system for delivering locally applied modRNA encoding pip4k2c for the treatment of heart failure may be formulated for intracardiac injection. In some instances, the heart failure treated by the gene delivery system disclosed herein is dilated cardiomyopathy (DCM).

[0014] Another aspect of this disclosure provides a method for treating heart failure, the method comprising: a) preparing a modified mRNA (modRNA) encoding phosphatidylinositol type 2 phosphatidylinositol-5-phosphate 4-kinase γ (pip4k2c), wherein, upon local application, the prepared modRNA does not elicit an immune response compared to exogenous RNA; and b) locally applying the modRNA encoding pip4k2c to the heart tissue of a subject in need; wherein gene expression of pip4k2c increases after at least one application. In some embodiments, the modRNA encoding pip4k2c is locally applied to the heart tissue of a subject in need at least once every 20 days. In other embodiments, life expectancy increases by at least 40% 20 days after a single application of the modRNA encoding pip4k2c to the heart tissue of a subject in need, compared to an untreated subject with the same disease symptoms and predicted outcomes. In some instances, the heart failure treated by the method disclosed herein is dilated cardiomyopathy (DCM). Attached Figure Description

[0015] The following figures form part of and are included in this specification to further illustrate certain aspects of this disclosure, which can be better understood by referring to the figures in conjunction with the detailed description of the specific embodiments presented herein.

[0016] Figure 1A-1K This includes images showing reduced Pip4k2c expression in a failing human heart. Figure 1A Representative schematic images depicting non-failure normal heart samples, human heart samples with cardiac hypertrophy, and human heart samples with dilated cardiomyopathy used to assess the mRNA and protein expression of Pip4k2c. Figure 1B The mRNA expression profiles of Pip4k2c in non-failed normal human hearts (NF), human hearts with cardiac hypertrophy (CH), and human hearts with dilated cardiomyopathy (DCM), as measured by qRT-PCT, are shown. The significance of the results was assessed using one-way ANOVA and Tukey's multiple comparison test, where n=4 for NF, n=2 for CH, n=3 for DCM, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 1C-1D The protein expression of Pip4k2c in non-failed normal human heart (NF), human heart sample with cardiac hypertrophy (CH), and human heart sample with dilated cardiomyopathy (DCM) is shown by Western blot analysis. Figure 1C Representative images of Western blot analysis of Pip4k2c and the loading control GAPDH. Figure 1D A graph depicting the ratio of Pip4k2c protein expression to GAPDH expression in human heart samples. The significance of the results was assessed using one-way ANOVA and Tukey's multiple comparison test, where n=4 for NF, n=2 for CH, n=3 for DCM, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 1E-1K Images depicting left ventricular (LV) immunostaining of non-failure normal human heart (NF), hypertrophic human heart (CH), and dilated cardiomyopathy (DCM) human heart samples are shown, with Pip4k2c expression shown in red, α-actin (a cardiomyocyte marker) in green, and DAPI (a nuclear marker) in blue. White arrows point to non-CM samples. Yellow arrows point to CM samples. Scale bar = 50 μm. Figure 1E A representative image of Pip4k2c representation in LV of NF. Figure 1F Representative images of Pip4k2c, α-actin, and DAPI expression in the LV of NF. Figure 1G Representative image of Pip4k2c expression in LV of CH. Figure 1HRepresentative images of Pip4k2c, α-actin, and DAPI expression in the LV of CH. Figure 1I Representative image of Pip4k2c expression in LV of DCM. Figure 1J Representative images of Pip4k2c, α-actin, and DAPI expression in the LV of DCM. Figure 1I The figure shown illustrates the quantitative analysis of Pip4k2c fluorescence intensity in immunostained LV sections of NF (n=3), CH (n=3), and DCM (n=3). The significance of the results was assessed using one-way ANOVA and Tukey's multiple comparison test, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant.

[0017] Figure 2A-2K This includes images showing reduced Pip4k2c expression in the failing hearts of mice. Figure 2A A representative schematic image depicting the timeline of Pip4k2C mRNA and protein expression in the heart of a sham-operated or TAC mouse model of heart failure. Figure 2B-2C This study shows the protein expression competition of Pip4k2c in the hearts of sham-operated or TAC mouse models of heart failure, measured by Western blot analysis 4 days after sham-operated and TAC-operated procedures. Figure 2B Representative images of Western blot analysis of Pip4k2c and the loading control GAPDH. Figure 2C A graph depicting the ratio of Pip4k2c protein expression to GAPDH expression in mouse heart samples. The significance of the results was assessed using an unpaired two-tailed t-test, where n=2 for sham surgery and n=2 for TAC, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 2D-2E A graph showing the expression of Pip4k2c mRNA in the heart or cardiac cells isolated from sham-operated or TAC mouse models, as measured by qRT-PCT. Figure 2D : Pip4k2c mRNA expression profile in WT mouse heart samples compared to 4 days post-TAC injury. Unpaired two-tailed t-tests were used to assess the significance of the results, where n=4 for sham surgery and n=4 for TAC. Figure 2EGraphs showing Pip4k2c mRNA expression in cardiac myoblasts (CM) or cardiac fibroblasts harvested from mice 7 or 14 days after sham surgery or TAC injury (n=3). The significance of the results was assessed using two-way ANOVA and the Bonferroni post-hoc test, where n=3 was used for sham surgery and TAC, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant. Figure 2F-2K Shown in total cardiac cells ( Figure 2G ), cardiomyocytes ( Figure 2H ), non-myocardial cells ( Figure 2I ), endothelial cells ( Figure 2J ) and smooth muscle cells ( Figure 2K Representative images of isolated, cultured neonatal mouse (P8) cardiac cells stained with Pip4k2c (red), including α-actin (CM marker, green); vimentin (non-CM marker, green); PECAM1 (endothelial cell marker, green); α-smooth muscle actin (smooth muscle cell marker, green); DAPI (nuclear marker, blue); and... Figure 2F Total cells are shown. Scale bar = 10 μm.

[0018] Figure 3A A schematic experimental plan is described using qRT-PCR to evaluate Pip4k2c expression in neonatal P3 rat CM treated in vitro with phenylephrine (PE) or DMSO.

[0019] Figure 3B The figure depicts the quantification of Pip4k2c mRNA expression in neonatal P3 rat CM treated in vitro with phenylephrine (PE) or DMSO using qRT-PCR. The significance of the results was assessed using an unpaired two-tailed t-test, where n = 3 for DMSO and n = 3 for PE, and *** = P < 0.001.

[0020] Figure 3C A schematic experimental plan is described to evaluate Pip4k2c expression by immunostaining in isolated cultured neonatal mouse (P8) heart cells.

[0021] Figure 3D-3H Images depicting immunostainings of isolated, cultured neonatal mouse (P8) heart cells are shown, in which the cells are stained as follows: Pip4k2c (red), α-actin (CM marker, silver), vimentin (fibroblast marker, green), and DAPI (nuclear marker) are blue. Scale bar = 25 μm. Figure 3DRepresentative image of Pip4k2c expression in isolated and cultured neonatal mouse (P8) heart cells. Figure 3E Representative image of DAPI staining in isolated and cultured neonatal mouse (P8) heart cells. Figure 3F Representative image of vimentin expression in isolated and cultured neonatal mouse (P8) heart cells. Figure 3G Representative image of α-actin expression in isolated and cultured neonatal mouse (P8) cardiac cells. Figure 3H Representative images of Pip4k2c, α-actin, vimentin, and DAPI expression in isolated and cultured neonatal mouse (P8) heart cells. White arrows point to non-CM cells. Yellow arrows point to CM cells.

[0022] Figures 4A-4D The diagram depicts pip4k2c + / + Comparison of twins (WT) or pip4k2c - / - Image of (KO-Pip4k2c) mice at gestational age 18 (E18). Figure 4A pip4k2c + / + Representative image of a twin-tailed control (WT) mouse at E18. Actual size. Figure 4B pip4k2 c- / - Representative image of (KO-Pip4k2c) mice at E18. Actual size. Figure 4C : A representative image of the entire heart from an E18 WT mouse. Scale bar = 1 mm. Figure 4D : Representative image of the entire heart from KO-Pip4k2c mice at E18. Scale bar = 1 mm.

[0023] Figure 4E-4G The diagram depicts pip4k2c + / + Twin comparison (WT) or pip4k2c - / - Figure showing the quantitative analysis of (KO-Pip4k2c) mice at gestational age 18 (E18). The significance of the results was assessed using an unpaired two-tailed t-test, where NS = not significant. Figure 4E Figure 1 shows the body weight of E18 WT mice (n=5) and E18KO-Pip4k2c mice (n=5). Figure 4F Figure : This figure shows the ratio of whole heart weight to body weight in E18WT mice (n=5) and E18KO-Pip4k2c mice (n=5). Figure 4G Figure showing the number of isolated cardiomyocytes (CM) from the hearts (n=3) of E18 WT and E18 KO-Pip4k2c mice.

[0024] Figures 5A-5DEchocardiographic images (ECHO) depicting the left ventricle of the following mice (scale bar = 1 mm): 21 days after sham surgery injury, pip4k2c + / + Sibling control (WT) mice Figure 5A ); 21 days after the sham surgery injury, pip4k2c - / - (KO-Pip4k2c) mice ( Figure 5B ); WT mice 21 days after TAC injury ( Figure 5C ); and KO-Pip4k2c mice 21 days after TAC injury ( Figure 5D ).

[0025] Figure 5E-5H The following diagram depicts the fractional shortening of the left ventricle in the mice shown. Figure 5E ), LVIDd Figure 5F ), LVIDd Figure 5G ) and left ventricular ejection fraction δ% ( Figure 5H The ECHO evaluation figure: pip4k2c 21 days after sham surgery injury + / + Twin-tailed control (WT) mice (sham-operated WT); pip4k2c 21 days after sham-operated injury. - / - (KO-Pip4k2c) mice (sham-operated KO-Pip4k2c); WT mice 21 days after TAC injury (TAC WT); and KO-Pip4k2c mice 21 days after TAC injury (TAC KO-Pip4k2c). One-way ANOVA and Bonferroni post-hoc test were used to determine significance. For all four experimental groups, n=8, ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant.

[0026] Figure 6A-6I pip4k2c was shown 21 days after sham surgical injury or TAC injury. + / + Twin control (WT) mice and pip4k2c - / - Heart morphology of (KO-Pip4k2c) mice. Figure 6A A quantitative graph depicting the ratio of heart weight to tibia length in the following mice: 21 days after sham surgery injury (pip4k2c) + / + Twin-tailed control (WT) mice (sham-operated WT); pip4k2c 21 days after sham-operated injury. - / -(KO-Pip4k2c) mice (sham-operated KO-Pip4k2c); WT mice 21 days after TAC injury (TAC WT); and KO-Pip4k2c mice 21 days after TAC injury (TAC KO-Pip4k2c). One-way ANOVA and Bonferroni post-hoc test were used to determine significance. For all four experimental groups, n=8, ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 6B Representative image of the entire heart of a WT mouse 21 days after sham surgery. Scale bar = 1 mm. Figure 6C Representative image of the entire heart of a KO-Pip4k2c mouse 21 days after sham surgery. Scale bar = 1 mm. Figure 6D Representative image of the entire heart of a WT mouse 21 days after TAC surgery. Scale bar = 1 mm. Figure 6E Representative image of the entire heart of a KO-Pip4k2c mouse 21 days after TAC surgery. Scale bar = 1 mm. Figure 6F Representative images of H&E staining of heart sections from WT mice 21 days after sham surgery. Scale bar = 1 mm. Figure 6G Representative H&E stained images of heart sections from KO-Pip4k2c mice 21 days after sham surgery. Scale bar = 1 mm. Figure 6H Representative images of H&E staining of heart sections from WT mice 21 days after TAC surgery. Scale bar = 1 mm. Figure 6I Representative H&E stained images of heart sections from KO-Pip4k2c mice 21 days after TAC surgery. Scale bar = 1 mm.

[0027] Figures 7A-7E Showing pip4k2c 21 days after sham surgery or TAC injury + / + Twin control (WT) mice and pip4k2c - / - Images of heart slices from (KO-Pip4k2c) mice stained with wheat germ agglutinin (WGA) to assess CM size (cross-sectional area). Figure 7A Representative images of WGA-stained heart sections from WT mice 21 days after sham surgery. Scale bar = 50 μm. Figure 7B Representative WGA-stained images of heart sections from KO-Pip4k2c mice 21 days after sham surgery. Scale bar = 50 μm. Figure 7C Representative images of WGA-stained heart sections from WT mice 21 days after TAC surgery. Scale bar = 50 μm. Figure 7D Representative images of WGA-stained heart sections from KO-Pip4k2c mice 21 days after TAC surgery. Scale bar = 50 μm. Figure 7EA quantitative graph depicting the size (cross-sectional area) of the CM in the following mice: 21 days after sham surgery injury (pip4k2c) + / + Twin-tailed control (WT) mice (sham-operated WT); pip4k2c 21 days after sham-operated injury. - / - (KO-Pip4k2c) mice (sham-operated KO-Pip4k2c); WT mice 21 days after TAC injury (TAC WT); and KO-Pip4k2c mice 21 days after TAC injury (TAC KO-Pip4k2c mice). One-way ANOVA and Bonferroni post-hoc test were used to determine significance. For all four experimental groups, n=8, ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant.

[0028] Figures 8A-8E The image depicts the effect of qRT-PCR on pip4k2c 21 days after sham surgery or TAC injury. + / + Twin control (WT) mice and pip4k2c - / - A graph quantifying the mRNA expression of various genes in the heart of (KO-Pip4k2c) mice. Figure 8A A graph depicting the mRNA expression of the hypertrophy marker ANP in the heart of the following mice: 21 days after sham surgery injury (pip4k2c) + / + Twin-tailed control (WT) mice (sham-operated WT); pip4k2c 21 days after sham-operated injury. - / - (KO-Pip4k2c) mice (sham-operated KO-Pip4k2c); WT mice 21 days after TAC injury (TAC WT); and KO-Pip4k2c mice 21 days after TAC injury (TACKO-Pip4k2c). One-way ANOVA and Bonferroni post-hoc test were used to determine significance. For all four experimental groups, n=5, ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 8B : A graph depicting the mRNA expression of the hypertrophy marker BNP in the hearts of sham-operated WT, sham-operated KO-Pip4k2c, TAC WT, and TAC KO-Pip4k2c mice. Significance was determined using one-way ANOVA and the Bonferroni post-hoc test, where n=5 for all four experimental groups and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 8CPlot the following: mRNA expression of matrix metalloproteinase (MMP) genes MMP2, MMP3, MMP7, and MMP9 in the hearts of sham-operated WT, sham-operated KO-Pip4k2c, TAC WT, and TAC KO-Pip4k2c mice. Use an unpaired two-tailed t-test to determine significance, where n = 5 for all four experimental groups, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant. Figure 8D Plot the following: mRNA expression of TGFβ1 and its downstream target genes Col1a1, Col1a2, Col3a1, and FN1 in the hearts of sham-operated WT, sham-operated KO-Pip4k2c, TAC WT, and TAC KO-Pip4k2c mice. Significance was determined using one-way ANOVA and the Bonferroni post-hoc test, where n=5 for all four experimental groups and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 8E A graph depicting qPCR analysis of Pip4a2a and Pip4k2b expression 21 days after TAC injury in WT or KO-Pip4k2c (n=5). The unpaired two-tailed t-test for bNS was not significant.

[0029] Figure 9A-9K Images depicting Sirius Red / Fix Green staining of cardiac sections isolated from the hearts of the following mice are shown to assess fibrosis area: 21 days after sham-operated injury (pip4k2c) + / + Twin-tailed control (WT) mice (sham-operated WT); pip4k2c 21 days after sham-operated injury. - / - (KO-Pip4k2c) mice (sham-operated KO-Pip4k2c); WT mice 21 days after TAC injury (TAC WT); and KO-Pip4k2c mice 21 days after TAC injury (TAC KO-Pip4k2c). Figure 9A : This image shows a representative image of Sirius Red / Fix Green staining on a heart section of a WT mouse 21 days after sham surgical injury. Scale bar = 50 μm. Figure 9B : This image shows a representative image of Sirius Red / Fix Green staining on a heart section from a KO-Pip4k2c mouse 21 days after sham surgical injury. Scale bar = 50 μm. Figure 9C : This shows a representative image of Sirius Red / Fix Green staining on heart sections from WT mice 21 days after TAC injury. Scale bar = 50 μm. Figure 9D : This image shows a representative image of Sirius Red / Fix Green staining on a heart section from a KO-Pip4k2c mouse 21 days after TAC injury. Scale bar = 50 μm. Figure 9E: Plotting the fibrosis area of ​​the heart from sham-operated WT, sham-operated KO-Pip4k2c, TAC WT, and TACKO-Pip4k2c mice. One-way ANOVA and Bonferroni post-hoc test were used to determine significance, where n=8 for all four experimental groups and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 9F-9J Representative images of Sirius Red / Fixed Green are shown, illustrating the effects of sham-operated injury 21 days post-injury in wild-type mice. Figure 9F ) and KO-Pip4k2c mice ( Figure 9I ) and wild-type mice 21 days after TAC injury ( Figure 9G ) and KO-Pip4k2c mice ( Figure 9J The fibrotic area in ) where, Figure 9H A magnified view showing fibrosis in KO-Pip4k2c mice with sham-operated injury, and Figure 9K Enlarged images showing fibrosis in KO-Pip4k2c and KO-Pip4k2c mice with TAC damage.

[0030] Figure 10 The diagram depicts the following: pip4k2c 21 days after sham surgical injury or TAC injury. + / + Twin control (WT) mice and pip4k2c - / - Survival curves of (KO-Pip4k2c) mice. Significance was determined using the Mantel-Cox log-rank test, where n=10 for all four experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant.

[0031] Figure 11A-11D Images depicting isolated cardiomyocytes (CM) immunostained with CM sarcomere structural proteins, wherein the CMs were isolated from the hearts of mice 21 days after TAC injury (pip4k2c). + / + Twin-brother control (WT) mice (WT TAC) and pip4k2c 21 days after TAC injury - / - (KO-Pip4k2c) mice (KO-Pip4k2c TAC). Figure 11A This image shows isolated CM from the heart of a WT TAC mouse stained with CM sarcomere structural protein α-actin and DAPI (nuclear marker). Scale bar = 20 μm. Figure 11B : This shows isolated CM from the heart of a KO-Pip4k2c TAC mouse stained with CM sarcomere structural proteins α-actin and DAPI. Scale bar = 20 μm. Figure 11CThis image shows isolated CM from the heart of a WT TAC mouse stained with the CM sarcomere structural proteins troponin T and DAPI. Scale bar = 20 μm. Figure 11D : Shows isolated CM from the heart of a KO-Pip4k2c TAC mouse stained with CM sarcoma structural proteins troponin T and DAPI. Scale bar = 20 μm.

[0032] Figure 11E-11G Images depicting the evaluation of CM size (cross-sectional area) in cardiomyocytes (CM) isolated from the hearts of the following mice 21 days after TAC injury (pip4k2c) + / + Twin-brother control (WT) mice (WT TAC) and pip4k2c 21 days after TAC injury - / - (KO-Pip4k2c) mice (KO-Pip4k2c TAC). Figure 11E The image shows CMs isolated from the hearts of WT TAC mice, with CM size evaluated using DAPI (nuclear marker) and WGA immunostaining. Scale bar = 20 μm. Figure 11F : This image shows heart fragments isolated from KO-Pip4k2c TAC mice, with DAPI and WGA immunostaining used to evaluate CM size. Scale bar = 20 μm. Figure 11G : A graph depicting the quantitative CM size of cardiomyocytes isolated from WT TAC and KO-Pip4k2c TAC mice. Unpaired two-tailed t-tests were used to determine significance, where n=3 for all experimental groups and **=P<0.01.

[0033] Figure 11H The figure depicts the quantification of mRNA expression of the mast markers ANP and BNP in cardiomyocytes (CM) isolated from the hearts of the following mice by qRT-PCR: 21 days after TAC injury (pip4k2c) + / + Twin-brother control (WT) mice (WT TAC) and pip4k2c 21 days after TAC injury - / - (KO-Pip4k2c) mice (KO-Pip4k2c TAC). Unpaired two-tailed t-tests were used to determine significance, where n = 3 for all experimental groups and ** = P < 0.01.

[0034] Figure 12A-12B A schematic experimental plan depicting the in vitro assessment of Pip4k2c expression in CM of neonatal P3 rats treated with phenylephrine (PE) or DMSO using qPCR. Figure 12A ) and a schematic experimental plan for evaluating Pip4k2c expression in isolated and cultured neonatal mouse (P8) heart cells ( Figure 12B ).

[0035] Figure 12C-12D Pip4k2c (red) expression in neonatal P3 rat CM following luciferase (Luc; control) delivery. Figure 12C Alternatively, Pip4k2cmodRNA co-stained with α-actin (CM marker, green) and DAPI (nucleus, blue) can be used. Figure 12D The image is shown. Scale bar = 50 μm.

[0036] Figures 13A-13D Images depicting Western blot analysis of Pip4k2c expression following in vivo delivery of modRNA. Figure 13A Western blot of Luc (control) or Pip4k2c modRNA expression in mouse hearts 24 hours after TAC. Figure 13B : Figure 13A Quantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n = 2 for all experimental groups, and ** = P < 0.01. Figure 13C Western blots of Luc (control) or Pip4k2c modRNA expression in mouse hearts at 0, 12, 1, 2, 4, 7, 10 and 21 days after TAC. Figure 13D Figure 13 shows the quantitative analysis. One-way ANOVA and Tukey's multiple comparison test were used to determine significance. For all experimental groups, n=2, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0037] Figure 14A-14K Images depicting elevated Pip4k2c modRNA levels and reduced cardiac hypertrophy and fibrosis following TAC injury. Figures 14A-14B This demonstrates TAC damage and delivery of luciferase (Luc) modRNA ( Figure 14A ) or Pip4k2c modRNA ( Figure 14B Representative echocardiographic images of the left ventricle of wild-type (WT) mice 21 days after gestation. Scale bar = 1 mm. Figure 14C-14E The graph shows the fraction of time the mouse heart was shortened 21 days after TAC injury and delivery of luciferase (Luc) modRNA or Pip4k2c modRNA. Figure 14C ), LVIDd Figure 14D ) or LVIDd( Figure 14E ECHO evaluation. Unpaired two-tailed t-tests were used to determine significance, where n=8 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant. Figure 14F-14KThe graph shows the fractional shortening of TAC damage before (day 0), 14 days, or 21 days after delivery of Luc or Pip4k2c modRNA. Figure 14F ), LVIDd Figure 14G ), LVIDd Figure 14H ) and left ventricular ejection fraction (δ%) Figure 14I ), LVPWd ( Figure 14J ) and LVPWs ( Figure 14K ECHO evaluation (n=8).

[0038] Figures 15A-15C Images depicting the total weight analysis of mouse hearts. Figure 15A Representative image of the entire heart 21 days after TAC damage and delivery of luciferase (Luc) modRNA. Scale bar = 50 μm. Figure 15B Representative image of the entire heart 21 days after TAC damage and delivery of Pip4k2cmodRNA. Scale bar = 50 μm. Figure 15C : Figures 15A-15B Quantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n=8 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0039] Figures 16A-16C Images depicting WGA staining to evaluate the size (cross-sectional area) of the CM in the mouse heart. Figure 16A :Representative image of heart tissue stained with WGA 21 days after TAC injury and delivery of luciferase (Luc) modRNA. Scale bar = 100 μm. Figure 16B Representative WGA-stained images of cardiac tissue 21 days after TAC injury and delivery of Pip4k2c modRNA. Scale bar = 100 μm. Figure 16C : Figures 16A-16B Quantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n=8 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0040] Figures 17A-17C The figure depicts the quantification of mRNA expression of various genes in the hearts of wild-type (WT) mice 21 days after TAC lesioning and delivery of luciferase (Luc) modRNA or Pip4k2c modRNA. Significance was determined using an unpaired two-tailed t-test, where n = 8 for all experimental groups, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant. Figure 17AThe following graph depicts the mRNA expression of hypertrophy markers ANP and BNP in the mouse heart 21 days after TAC injury and delivery of luciferase (Luc) modRNA or Pip4k2c modRNA. Figure 17B : A graph depicting the mRNA expression of the following: The mRNA expression of TGFβ1 and its downstream target genes Col1a1, Col1a2, Col3a1 and FN1 in the heart of mice 21 days after TAC injury and delivery of Luc modRNA or Pip4k2c modRNA. Figure 17C The following diagram depicts the mRNA expression of matrix metalloproteinase (MMP) genes MMP2, MMP3, MMP7, and MMP9 in the heart of mice 21 days after TAC injury and delivery of luciferase (Luc) modRNA or Pip4k2c modRNA.

[0041] Figures 18A-18C Images depicting Sirius Red / Fix Green staining to evaluate the area of ​​fibrosis in mouse hearts. Figure 18A Representative image of Sirius red / fast green staining of heart tissue 21 days after TAC injury and delivery of luciferase (Luc) modRNA. Scale bar = 100 μm. Figure 18B Representative images of Sirius red / fast green staining of heart tissue 21 days after TAC injury and delivery of Pip4k2c modRNA. Scale bar = 100 μm. Figure 18C : Figures 18A-18B Quantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n=8 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0042] Figure 19 The graph depicts the survival curves of mice 21 days after TAC injury and delivery of luciferase (Luc) modRNA or Pip4k2c modRNA. Significance was determined using the Mantel-Cox log-rank test, where n = 10 for all four experimental groups, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant.

[0043] Figure 20A-20J The use of pip4k2c was shown 21 days after TAC injury. + / + Twin comparison (WT) and pip4k2c - / - Images of cardiac fibroblasts isolated from the heart (KO-Pip4k2c) to evaluate cardiac fibroblast proliferation. Figure 20ARepresentative bright-field images of cardiac fibroblasts isolated from WT hearts 21 days after TAC injury and subsequently treated with PBS for 5 days (control). Scale bar = 50 μm. Figure 20B Representative bright-field images of cardiac fibroblasts isolated from KO-Pip4k2c hearts 21 days after TAC injury and subsequently treated with PBS for 5 days (control). Scale bar = 50 μm. Figure 20C Representative bright-field images of cardiac fibroblasts isolated from KO-Pip4k2c hearts 21 days after TAC injury and subsequently treated with a TGF-β inhibitor (SB431542) for 5 days. Scale bar = 50 μm. Figure 20D Representative bright-field images of KO-Pip4k2c-rich cardiac fibroblasts isolated from a heart 21 days after TAC injury and subsequently treated with Pip4k2c modRNA for 5 days. Scale bar = 50 μm. Figure 20E Representative images of cardiac fibroblasts isolated from WT hearts 21 days after TAC injury, subsequently treated with PBS (control) for 5 days, and immunostained with pH3 (mitotic marker, red), vimentin (fibroblast marker, green), and DAPI (nucleus, blue). Scale bar = 50 μm. Figure 20F Representative images of cardiac fibroblasts isolated from KO-Pip4k2c hearts 21 days after TAC injury, subsequently treated with PBS (control) for 5 days, and immunostained with pH3 (mitotic marker, red), vimentin (fibroblast marker, green), and DAPI (nucleus, blue). Scale bar = 50 μm. Figure 20G Representative images of cardiac fibroblasts isolated from a KO-Pip4k2c heart 21 days after TAC injury, subsequently treated for 5 days with a TGF-β inhibitor (SB431542), and immunostained with pH3 (mitotic marker, red), vimentin (green), and DAPI (nucleus, blue). Scale bar = 50 μm. Figure 20H Representative images of cardiac fibroblasts isolated from a KO-Pip4k2c heart 21 days after TAC injury, subsequently treated with Pip4k2c modRNA for 5 days, and immunostained with pH3 (mitotic marker, red), vimentin (fibroblast marker, green), and DAPI (nucleus, blue). Scale bar = 50 μm. Figure 20I : Figure 20A-20D The cell counts for each experimental group are depicted in the figure. One-way ANOVA was used to determine significance, where n = 3 for all experimental groups, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant. Figure 20J : Figure 20E-20HThe figures depict pH3-positive cardiomyocytes in each experimental group. Significance was determined using one-way ANOVA, where n = 3 for all experimental groups, and *** = P < 0.001, ** = P < 0.01, * = P < 0.05, and NS = not significant.

[0044] Figures 21A-21E The figure shown depicts the following items: pip4k2c 21 days after TAC injury. + / + Twin comparison (WT) and pip4k2c - / - Quantification of mRNA expression of various genes in cardiac fibroblasts isolated from (KO-Pip4k2c) and then treated with PBS (control), a TGF-β inhibitor (SB431542), or Pip4k2c modRNA for 5 days was performed. One-way ANOVA was used to determine significance, where n=3 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 21A A diagram depicting the expression of the Col1a gene in all four experimental treatment groups. Figure 21B : A diagram depicting the expression of the Col2a gene in all four experimental treatment groups. Figure 21C A graph depicting the expression of the Col3a1 gene in all four experimental treatment groups. Figure 21D : A diagram depicting FN1 gene expression in all four experimental treatment groups. Figure 21E : A diagram depicting CTGF gene expression in all four experimental treatment groups.

[0045] Figures 22A-22B Images were drawn to depict the expression of phosphate-p70s6k and total p70s6k protein in WT or KO-Pip4k2c 21 days after sham surgery or TAC injury, to evaluate protein blot analysis. Figure 22A Representative images of Western blots used to detect the expression of phosphate-p70s6k protein, total p70s6k protein, and GAPDH (sample control) protein. Figure 22B : Figure 22A Quantitative analysis was performed. One-way ANOVA and Tukey's multiple comparison test were used to determine significance. For all experimental groups, n=8, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0046] Figure 23 This demonstrates the effect of administering a loading agent or rapamycin 21 days after TAC injury on pip4k2c. - / - A schematic experimental timeline of the effects of (KO-Pip4k2c) mice on cardiac function, cardiac hypertrophy, and fibrosis.

[0047] Figures 24A-24B Showing TAC damage and delivering the load ( Figure 24A ) or rapamycin ( Figure 24B Representative echocardiographic images of the left ventricle of KO-Pip4k2c mice 21 days after gestation. Scale bar = 1 mm.

[0048] Figure 24C-24E The graph shows the fraction of time reduced at 0, 7, 14, or 21 days after TAC injury and delivery of the load or rapamycin to the heart of KO-Pip4k2c mice. Figure 24C ), LVIDd Figure 24D ) or LVIDd( Figure 24E ECHO evaluation. Unpaired two-tailed t-tests were used to determine significance, where n=8 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0049] Figures 25A-25C Images depicting the total weight analysis of mouse hearts. Figure 25A Representative images of the entire heart 21 days after TAC injury and delivery of the load or rapamycin to the heart of a KO-Pip4k2c mouse. Scale bar = 50 μm. Figure 25B Quantitative analysis of the ratio of heart weight to tibia length in KO-Pip4k2c mice 21 days after TAC injury and delivery of the load or rapamycin. Unpaired two-tailed t-tests were used to determine significance, where n=4 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant. Figure 25C Quantitative analysis of the ratio of lung weight to tibia length in KO-Pip4k2c mice 21 days after TAC injury and delivery of the load or rapamycin. Unpaired two-tailed t-tests were used to determine significance, where n=4 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05, and NS=not significant.

[0050] Figures 26A-26C Images depicting CM size (cross-sectional area) in the heart of KO-Pip4k2c mice after WGA staining were drawn. Figure 26A Representative WGA-stained images of KO-Pip4k2c cardiac tissue 21 days after TAC injury and load delivery. Scale bar = 100 μm. Figure 26B Representative WGA-stained images of KO-Pip4k2c cardiac tissue 21 days after TAC injury and rapamycin delivery. Scale bar = 100 μm. Figure 26C : Figures 26A-26BQuantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n=4 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0051] Figure 27A and 27B This image depicts TGFβ1 in KO-Pip4k2c cardiac tissue 21 days after TAC injury and delivery of a load or rapamycin. Figure 27A ) as well as ANP and BNP ( Figure 27B A graph quantifying mRNA expression of ). Unpaired two-tailed t-tests were used to determine significance, where n=4 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0052] Figures 28A-28C Images of fibrosis area in the heart of KO-Pip4k2c mice were drawn using Sirius Red / Fix Green staining to evaluate the area of ​​fibrosis. Figure 28A Representative images of Sirius Red / Fixed Green staining of KO-Pip4k2c cardiac tissue 21 days after TAC injury and load delivery. Scale bar = 100 μm. Figure 28B Representative images of Sirius Red / Fixed Green staining of KO-Pip4k2c cardiac tissue 21 days after TAC injury and rapamycin delivery. Scale bar = 100 μm. Figure 28C : Figures 28A-28B Quantitative analysis was performed. Unpaired two-tailed t-tests were used to determine significance, where n=4 for all experimental groups, and ***=P<0.001, **=P<0.01, *=P<0.05 and NS=not significant.

[0053] Figure 29 A schematic diagram depicting a model of pip4k2cmodRNA regulation in cardiac hypertrophy and heart failure following TAC injury via inhibition of mTORC1 and TGFβ1.

[0054] Figure 30A-30L Images depicting Pip4k2c reducing cardiac fibrosis via the TGFβ1 pathway. Figure 30A Images of Western blot analysis of TGFβ protein expression in WT or KO-Pip4k2c 21 days after sham surgery or TAC injury are shown. Figure 30B Show Figure 30A Quantitative analysis of proteins in Western blot (n=2). Figure 30C-30D Shown in the load body ( Figure 30C ) or SB4311542 ( Figure 30DRepresentative echocardiographic images of the left ventricle 21 days after TAC injury, in the presence of α. Scale bar = 1 mm. Figure 30E-30G The figure shown depicts the following: the 21-day shortening fraction following TAC damage and delivery of the load or Sb4311542 ( Figure 30E ), LVIDd Figure 30F ) or LVIDd( Figure 30G The echo evaluation of (n=3). Figure 30H The figure shown depicts the ratio of heart weight to tibial length 21 days after TAC injury and delivery of the load or SB4311542 (n=3). Figure 30I The figure shown depicts the ratio of lung weight to tibial length 21 days after TAC injury and delivery of a load or SB4311542 (n=3). Figure 30J-30K Shown in the load body ( Figure 30J ) or SB4311542 ( Figure 30K Representative images of Sirius Red / Fixed Green for assessing fibrosis area 21 days after TAC injury in the presence of α. Scale bar = 50 μm. Figure 30L It is shown Figure 30J-30K Quantitative analysis of the images in the figure (n=3). Statistical analysis of all figures shows that one-way ANOVA, Tukey multiple comparison test, or unpaired two-tailed t-test results are *= P<0.05, NS=not significant.

[0055] Figures 31A-31E The diagram illustrates that, as assessed by flow cytometry quantification of immune cell populations in the hearts of KO-Pip4k2c and wild-type (WT) mice 21 days after TAC injury, Pip4k2c depletion does not alter the immune cell composition in the hearts 21 days after TAC injury. The diagram shows immune cell populations defined as follows: lymphocytes consisting of Lin+ and CD45+ cells (…). Figure 31A T cells are CD3+ lymphocytes. Figure 31B Bone marrow cells are CD11b+ lymphocytes. Figure 31C Macrophages are F4 / 80+ bone marrow cells ( Figure 31D ) and Ly6Clow / interm and neutrophils were high in Ly6G and CD11b ( Figure 31E ).

[0056] Figure 32A and 32B Images depicting the biodistribution of modRNA transfection in the TAC mouse model. Figure 32AThis image shows a representative cross-sectional view of a Rosa26mTmG mouse heart transfected with 100 μg Cre modRNA 24 hours after direct injection into the myocardium (short axis view; transfected cells are green, and untransfected cells are red). Scale bar = 1 mm. Figure 32B This is a graph showing the quantitative biodistribution of Cre modRNA in LV after in vivo transfection. n=3. Two-tailed Student's t-test (B). ****, P<0.0001.

[0057] Figure 33A-33N An image depicting the N-terminal motif (VMLLPDD) on Pip4k2c directly responsible for suppressing the TGFβ1 pathway. Figure 33A This is a schematic diagram showing the modRNA structure of Pip4k2c and the mutant Pip4k2c construct. Figures 33B-33E The figure shows the following: left ventricular ejection fraction δ% 21 days after TAC injury and delivery of Luc, Pip4k2c, or mutant Pip4k2c modRNA (Luc-, n=3, Pip4k2c-n=3, mutant Pip4k2c modRNA-n=6). Figure 33B ), shorten the score ( Figure 33C ), LVIDd Figure 33D ) and LVIDd( Figure 33E The echo evaluation of ). Figure 33F The figure shows the ratio of heart weight to tibia length 21 days after TAC injury and delivery of Luc or Pip4k2c modRNA (Luc-, n=3, Pip4k2c-n=3, mutant Pip4k2c modRNA-n=6). Figure 33G-33K The figure shows the following: qPCR analysis of the expression of downstream-TGFβ1 fibrosis markers in cardiac fibroblasts isolated and sorted from WT or KO-Pip4k2c hearts 21 days after TAC injury (targeting the fibroblast marker CD90) and treated with DMSO (control), a TbetaR1 / ALK5 inhibitor (SB431542), Pip4k2c, or mutant Pip4k2c modRNA, where the marker is Col1a1 (…). Figure 33G ), Col1a2 ( Figure 33H ), Col3a1 ( Figure 33I ), Ctgf( Figure 33J ) and FN1 ( Figure 33K ). Figure 33L-33NThis is a quantitative analysis graph showing the following: Total collagen isolated and sorted from WT or KO-Pip4k2c hearts 21 days after TAC injury (targeting the fibroblast marker CD90) and treated with DMSO (control), a TbetaR1 / ALK5 inhibitor (SB431542), Pip4k2c, or mutant Pip4k2c modRNA. Figure 33L Changes in the number of fibroblasts in the cardia ( Figure 33M The percentage expression of ) and pH3 (a marker of cell division) Figure 33N Cell number and pH3 (a marker of cell division) were calculated after 5 days. (n=3); one-way ANOVA, ****, P<0.0001, ***, P<0.001, **, P<0.01, NS, not significant. Detailed Implementation

[0058] Some aspects of this disclosure include compositions comprising gene delivery systems for treating heart failure. Generally, the compositions disclosed herein may comprise at least one modRNA encoding regulated gene expression of at least one cardiac gene. As used herein, the term "modRNA" refers to modified RNA that can be used to express the synthesis of a target gene. Also as used herein, the term "regulated gene expression" refers to overexpression of at least one gene naturally occurring in cardiac cells, low expression of at least one gene naturally occurring in cardiac cells, knockout of at least one gene naturally occurring in cardiac cells, or a combination thereof. As used herein, the terms "natural" or "natural cell" refer to the state of cells in the context of a multicellular organism or in their natural environment. In some embodiments, the compositions disclosed herein may comprise at least one modRNA encoding regulated gene expression of pip4k2c. As used herein, the term "pip4k2c" refers to the gene encoding the protein phosphatidylinositol-5-phosphate 4-kinase type 2 γ (PI5P4Kγ).

[0059] Some other aspects of this disclosure include methods for treating heart failure. Generally, the methods disclosed herein can treat heart failure by administering a gene delivery system comprising at least one modRNA encoding regulated gene expression of at least one cardiac gene. In some embodiments, the methods disclosed herein can treat heart failure by administering a modRNA encoding pip4k2c to the heart tissue of a subject in need of treatment.

[0060] (I) Composition

[0061] This disclosure includes compositions that at least encode a modRNA that regulates gene expression. The compositions disclosed herein may at least encode a modRNA that regulates gene expression, wherein the regulation of gene expression may be a result of treatment with the disclosed modRNA. The compositions disclosed herein may at least encode a modRNA that regulates gene expression, wherein the regulation of gene expression may increase life expectancy.

[0062] (a) modRNA

[0063] In various embodiments, the compositions disclosed herein may include at least one modRNA encoding a regulatory gene expression. Methods for synthesizing modRNAs suitable for the compositions disclosed herein are described in Kondrat et al., In: Ishikawa K. (eds) CARDIAC GENE THERAPY. METHODS IN MOLECULAR BIOLOGY, vol. 1521. Humana Press, New York, NY (2017); Hadas et al., MOL THER METHODS CLIN DEV. (2019) 14: 300–305; Sultana et al., MOL THER. (2017) 25(6): 1306–1315; and Svitkin et al., NUCLEIC ACIDS RES. (2017) 45(10): 6023–6036, the disclosures of which are incorporated herein by reference in their entirety. In some implementations, the synthesis of modRNA for in vivo use may include four steps: (1) creating a DNA template containing the desired transcript; (2) in vitro transcription (IVT); (3) removing the 5' phosphate with an antarctic phosphatase; and (4) precipitation with 5M ammonium acetate.

[0064] In some embodiments, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions. In some aspects, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions that alter the secondary structure of the mRNA compared to the foreign mRNA structure. In other aspects, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions that prevent recognition by the innate immune system compared to the foreign mRNA structure. In still other aspects, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions that reduce innate immune system recognition by about 50% to about 100%, about 55% to about 95%, or about 60% to about 90% compared to the foreign mRNA structure. In still other aspects, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions that prevent RNase degradation compared to the foreign mRNA structure. In still other aspects, the modRNA may include at least a foreign RNA sequence with nucleoside substitutions that reduce RNase degradation by about 50% to about 100%, about 55%, about 95%, or about 60% to about 90% compared to the foreign mRNA structure.

[0065] In some respects, a modRNA may include at least a foreign RNA sequence in which uridine is replaced by pseudouridine. In other respects, a modRNA may include at least a foreign RNA sequence in which cytidine is replaced by 5-methylcytidine. In some other respects, a modRNA may include a foreign RNA sequence comprising the modified nucleoside 5-methylcytidine (5mC). In still other respects, a modRNA may include a foreign RNA sequence comprising the modified nucleoside 2-thiouridine-5'-triphosphate (2-thioψU). In yet another respect, a modRNA may include a foreign RNA sequence comprising the modified nucleoside 1-methylpseudouridine-5'-triphosphate (1-mψU). In other respects, a modRNA may include a foreign RNA sequence comprising the modified nucleoside N1-methyl-pseudouridine (N1mΨ). In still other respects, a modRNA may include foreign RNA in which the 5' triphosphate has been removed. In other respects, modRNAs can encompass exogenous RNAs, including 3′-O-Me-m7G(5′)ppp(5′)G anti-reverse cap analogues (ARCA) caps or C... 32 H 43 N 15 O 24 P4CleanCap reagent AG can be substituted at the 5' untranslated region of RNA molecules.

[0066] In some embodiments, the modRNAs disclosed herein can target at least one tissue type. In some aspects, the modRNAs disclosed herein can target cardiac tissue. In other embodiments, the modRNAs can target a specific cell type. In some aspects, the modRNAs can target cardiac cells. In other aspects, cardiac cells that can be targeted by the modRNAs disclosed herein can be cardiomyocytes, cardiac fibroblasts, or a combination thereof. In some embodiments, the modRNAs can be administered to cardiac cells in vitro. In other embodiments, the modRNAs can be administered to cardiac cells in vivo. In some other embodiments, the modRNAs can be administered to ex vivo stem cells, wherein modRNA-treated stem cells can be administered to the heart.

[0067] In some implementations, modRNA can be administered to cardiac cells in vitro in the following amounts: approximately 0.001 μg modRNA / mm 2 / 500 heart cells to approximately 10 μg modRNA / mm 2 / 500 heart cells, approximately 0.01 μg modRNA / mm 2 / 500 heart cells to approximately 9.5 μg modRNA / mm 2 / 500 heart cells, or approximately 0.1 μg modRNA / mm 2 / 500 heart cells to approximately 9.0 μg modRNA / mm 2 / 500 heart cells. In some embodiments, modRNA can be administered to heart cells in vitro in the following amounts: about 0.001 μg, about 0.005 μg, about 0.010 μg, about 0.025 μg, about 0.050 μg, about 0.1 μg, about 0.5 μg, about 1.0 μg, about 1.5 μg, about 2.0 μg, about 2.5 μg, about 3.0 μg, about 3.5 μg, about 4.0 μg, about 4.5 μg, 5.0 μg, about 5.5 μg, about 6.0 μg, about 6.5 μg, about 7.0 μg, about 7.5 μg, about 8.0 μg, about 8.5 μg, about 9.0 μg, about 9.5 μg, or about 10 μg modRNA / mm 2 / 500 cardiomyocytes. In some embodiments, modRNA can be administered to cardiomyocytes in vitro in the following amount: approximately 0.001 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 10 μg modRNA / mm 2 / 500 cardiomyocytes, approximately 0.01 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 9.5 μg modRNA / mm 2 / 500 cardiomyocytes, or approximately 0.1 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 9.0 μg modRNA / mm 2 / 500 cardiomyocytes. In some embodiments, modRNA can be administered to cardiomyocytes in vitro in the following amounts: approximately 0.001 μg, approximately 0.005 μg, approximately 0.010 μg, approximately 0.025 μg, approximately 0.050 μg, approximately 0.1 μg, approximately 0.5 μg, approximately 1.0 μg, approximately 1.5 μg, approximately 2.0 μg, approximately 2.5 μg, approximately 3.0 μg, approximately 3.5 μg, approximately 4.0 μg, approximately 4.5 μg, 5.0 μg, approximately 5.5 μg, approximately 6.0 μg, approximately 6.5 μg, approximately 7.0 μg, approximately 7.5 μg, approximately 8.0 μg, approximately 8.5 μg, approximately 9.0 μg, approximately 9.5 μg, or approximately 10 μg modRNA / mm 2 / 500 cardiomyocytes. In some embodiments, modRNA can be administered to cardiomyocytes in vitro in the following amount: approximately 0.001 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 10 μg modRNA / mm 2 / 500 cardiomyocytes, approximately 0.01 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 9.5 μg modRNA / mm 2 / 500 cardiomyocytes, or approximately 0.10 μg modRNA / mm 2 / 500 cardiomyocytes to approximately 9.0 μg modRNA / mm 2 / 500 cardiomyocytes. In some embodiments, modRNA can be administered to cardiomyocytes in vitro in the following amounts: about 0.001 μg, about 0.005 μg, about 0.010 μg, about 0.025 μg, about 0.050 μg, about 0.1 μg, about 0.5 μg, about 1.0 μg, about 1.5 μg, about 2.0 μg, about 2.5 μg, about 3.0 μg, about 3.5 μg, about 4.0 μg, about 4.5 μg, 5.0 μg, about 5.5 μg, about 6.0 μg, about 6.5 μg, about 7.0 μg, about 7.5 μg, about 8.0 μg, about 8.5 μg, about 9.0 μg, about 9.5 μg, or about 10 μg modRNA / mm 2 / 500 cardiomyocytes. In some embodiments, modRNA can be administered to stem cells in vitro in the following amount: approximately 0.001 μg modRNA / mm 2 / 500 stem cells to approximately 10 μg modRNA / mm 2 / 500 stem cells, approximately 0.01 μg modRNA / mm 2 / 500 stem cells to approximately 9.5 μg modRNA / mm 2 / 500 stem cells, or approximately 0.10 μg modRNA / mm 2 / 500 stem cells to approximately 9.0 μg modRNA / mm 2 / 500 stem cells. In some embodiments, modRNA can be administered to stem cells in vitro in the following amounts: about 0.001 μg, about 0.005 μg, about 0.010 μg, about 0.025 μg, about 0.050 μg, about 0.1 μg, about 0.5 μg, about 1.0 μg, about 1.5 μg, about 2.0 μg, about 2.5 μg, about 3.0 μg, about 3.5 μg, about 4.0 μg, about 4.5 μg, 5.0 μg, about 5.5 μg, about 6.0 μg, about 6.5 μg, about 7.0 μg, about 7.5 μg, about 8.0 μg, about 8.5 μg, about 9.0 μg, about 9.5 μg, or about 10 μg modRNA / mm 2 / 500 stem cells.

[0068] In some embodiments, modRNA may be administered into a heart weighing from about 110 mg to about 190 mg in the following amounts: about 25 μg to about 100 μg, about 30 μg to about 95 μg, or about 35 μg to about 90 μg. In some embodiments, modRNA may be administered into a heart weighing from about 110 mg to about 190 mg in the following amounts: about 25 μg, about 30 μg, about 35 μg, about 40 μg, about 45 μg, about 50 μg, about 55 μg, about 60 μg, about 65 μg, about 70 μg, about 75 μg, about 80 μg, about 85 μg, about 90 μg, about 95 μg, or about 100 μg. In some aspects, the heart weighing from about 110 mg to about 190 mg may be a mouse heart.

[0069] In some embodiments, modRNA may be administered to a heart weighing about 250g to about 320g in the following amounts: about 1mg to about 100mg, about 1.5mg to about 95mg, or about 2mg to about 90mg. In some embodiments, modRNA may be administered to a heart weighing about 250g to about 320g in the following amounts: about 1mg, about 5mg, about 10mg, about 15mg, about 20mg, about 25mg, about 30mg, about 35mg, about 40mg, about 45mg, about 50mg, about 55mg, about 60mg, about 65mg, about 70mg, about 75mg, about 80mg, about 85mg, about 90mg, about 95mg, or about 100mg. In some aspects, the heart weighing about 250g to about 320g may be a pig heart. In other aspects, the heart weighing about 250g to about 320g may be a human heart, wherein the human is under 10 years of age. In other respects, a heart weighing approximately 250g to approximately 320g can be a human heart, wherein the person is under 18 years of age. In yet another respect, a heart weighing approximately 250g to approximately 320g can be an adult heart.

[0070] In some embodiments, modRNA may be administered into the heart in the following amounts: 1 μg / 10g heart tissue to about 10 mg / 10g heart tissue or about 10 μg / 10g heart tissue to about 5 mg / 10g heart tissue. In some other embodiments, modRNA may be administered into the heart in the following amounts: about 1 μg / 10g heart tissue, about 5 μg / 10g heart tissue, about 10 μg / 10g heart tissue, about 15 μg / 10g heart tissue, about 20 μg / 10g heart tissue, about 30 μg / 10g heart tissue, about 40 μg / 10g heart tissue, about 50 μg / 10g heart tissue, about 75 μg / 10g heart tissue, about 100 μg / 10g heart tissue, about 1 mg / 10g heart tissue, about 3 mg / 10g heart tissue, about 5 mg / 10g heart tissue, or about 10 mg / 10g heart tissue.

[0071] In some embodiments, the modRNA may comprise a foreign RNA sequence encoding a gene for a protein native to cardiac tissue with at least a nucleoside substitution. In other embodiments, the modRNA may comprise a foreign RNA sequence encoding a gene for a protein known to be downregulated in heart disease. In some embodiments, the modRNA may comprise a foreign RNA sequence encoding a gene for a protein known to be downregulated in heart failure. In other embodiments, the modRNA may comprise a foreign RNA sequence encoding a gene for a protein known to be downregulated in dilated cardiomyopathy. In still other embodiments, the modRNA may comprise a foreign RNA sequence for pip4k2c with at least a nucleoside substitution. In still other embodiments, the modRNA may comprise a foreign RNA sequence for human pip4k2c with at least a nucleoside substitution, wherein the foreign RNA sequence for human pip4k2c is:

[0072] 5’atggcgtcctcctcggtcccaccagccacggtatcggcggcgacagcaggccccggcccaggtttcggcttcgcctccaagaccaagaagaagcatttcgtgcagcagaaggtgaaggtgttccgggcggccgacccgctggtgggtgtgttcctgtggggcgtagcccactcgatcaatgagctcagccaggtgcctcccccggtgatgctgctgccagatgactttaaggccagctccaagatcaaggtcaacaatcaccttttccacagggaaaatctgcccagtcatttcaagttcaaggagtattgtccccaggtcttcaggaacctccgtgatcgatttggcattgatgaccaagattacttggtgtcccttacccgaaacccccccagcgaaagtgaaggcagtgatggtcgcttccttatctcctacgatcggactctggtcatcaaagaagtatccagtgaggacattgctgacatgcatagcaacctctccaactatcaccagtacattgtgaagtgccatggcaacacgcttctgccccagttcctggggatgtaccgagtcagtgtggacaacgaagacagctacatgcttgtgatgcgcaatatgtttagccaccgtcttcctgtgcacaggaagtatgacctcaagggttccctagtgtcccgggaagccagcgataaggaaaaggttaaagaattgcccacccttaaggatatggactttctcaacaagaaccagaaagtatatattggtgaagaggagaagaaaatatttctggagaagctgaagagagatgtggagtttctagtgcagct gaagatcatggactacagccttctgctaggcatccacgacatcattcggggctctgaaccagaggaggaagcgcccgtgcgggaggatgagtcagaggtggatggggactgcagcctgactggacctcctgctctggtgggctcct atggcacctccccagagggtatcggaggctacatccattcccatcggcccctgggcccaggagagtttgagtccttcattgatgtctatgccatccggagtgctgaaggagccccccagaaggaggtctacttcatgggcctcatt gatatccttacacagtatgatgctaagaagaaagcagctcatgcagccaaaactgtcaagcatggggctggggcagagatctctactgtccatccggagcagtatgctaagcgattcctggattttattaccaacatctttgccta 3'(SEQ ID NO:1)

[0073] In some respects, the modRNA described herein may comprise an RNA sequence having about 10% to about 99% of SEQ ID NO: 1. In other respects, the modRNA described herein may comprise an RNA sequence having at least 80% (i.e., about 80%, 85%, 90%, 95%, or 99%) of SEQ ID NO: 1.

[0074] In various embodiments, the compositions disclosed herein may at least include a modRNA encoding a gene expression regulator, wherein the regulation of gene expression may be a result of treatment with the modRNA disclosed herein. In some aspects, heart cells treated in vitro with the modRNA disclosed herein can regulate the expression of at least one gene compared to untreated heart cells. In some other aspects, heart cells treated in vitro with the modRNA disclosed herein can regulate the expression of the pip4k2c gene compared to untreated heart cells. In other aspects, heart cells treated in vitro with the modRNA disclosed herein can increase the expression of the pip4k2c gene compared to untreated heart cells. In still other aspects, heart cells treated in vitro with the modRNA disclosed herein can increase the expression of the pip4k2c gene by at least about 1 to about 50 times, about 5 to about 40 times, or about 10 to about 30 times compared to untreated heart cells. In other respects, compared with untreated heart cells, in vitro treatment of heart cells with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold. In other respects, compared with untreated heart cells, in vitro treatment of heart cells with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after modRNA treatment, approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days. In some other respects, compared to untreated hearts, in vitro treatment of cardiac cells with the modRNAs disclosed herein can increase the gene expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after approximately 0 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 12 days, about 14 days, about 16 days, about 18 days, about 20 days, about 21 days, or about 25 days after modRNA treatment. In some other respects, in vivo treatment of the heart with the modRNAs disclosed herein can regulate the gene expression of at least one gene compared to untreated hearts. In some other respects, in vivo treatment of the heart with the modRNAs disclosed herein can regulate the gene expression of pip4k2c compared to untreated hearts. In other respects, in vivo treatment of the heart with the modRNA disclosed in this paper increased the gene expression of pip4k2c compared with the untreated heart.In other respects, compared with an untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1 to about 50 times, about 5 to about 40 times, or about 10 to about 30 times. In other respects, compared with an untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 times. In other respects, compared with untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after about 0 hours to about 25 days, or about 12 hours to about 21 days following modRNA treatment. In some other respects, compared with untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the gene expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after approximately 0 hours, approximately 12 hours, approximately 1 day, approximately 2 days, approximately 3 days, about 6 days, approximately 7 days, about 8 days, about 9 days, about 10 days, about 12 days, about 14 days, about 16 days, about 18 days, about 20 days, about 21 days, or about 25 days after modRNA treatment.

[0075] In various embodiments, the compositions disclosed herein may at least include a modRNA encoding a gene expression regulator, wherein the regulation of gene expression following treatment with the disclosed modRNA may result in an increase in protein expression. In some aspects, in vitro treatment of cardiac cells with the disclosed modRNA may regulate the protein expression of at least one protein compared to untreated cardiac cells. In some other aspects, in vitro treatment of cardiac cells with the disclosed modRNA may regulate the protein expression of pip4k2c compared to untreated cardiac cells. In other aspects, in vitro treatment of cardiac cells with the disclosed modRNA may increase the protein expression of pip4k2c compared to untreated cardiac cells. In still other aspects, in vitro treatment of cardiac cells with the disclosed modRNA may increase the protein expression of pip4k2c by at least about 1 to about 50 times, about 5 to about 40 times, or about 10 to about 30 times compared to untreated cardiac cells. In other respects, compared with untreated cardiac cells, in vitro treatment of cardiac cells with the modRNA disclosed herein can increase the protein expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold. In other respects, compared with untreated cardiac cells, in vitro treatment of cardiac cells with the modRNA disclosed herein can increase the protein expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after modRNA treatment, approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days. In some other respects, compared to untreated hearts, in vitro treatment of cardiac cells with the modRNAs disclosed herein can increase the protein expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after approximately 0 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 12 days, about 14 days, about 16 days, about 18 days, about 20 days, about 21 days, or about 25 days following modRNA treatment. In some other respects, in vivo treatment of the heart with the modRNAs disclosed herein can regulate the protein expression of at least one protein compared to untreated hearts. In some other respects, in vivo treatment of the heart with the modRNAs disclosed herein can regulate the gene expression of pip4k2c compared to untreated hearts. In other respects, in vivo treatment of the heart with the modRNA disclosed in this paper can increase the protein expression of pip4k2c compared with the untreated heart.In other respects, in vivo treatment of the heart with the modRNA disclosed herein can increase the protein expression of pip4k2c by at least about 1 to about 50 times, about 5 to about 40 times, or about 10 to about 30 times compared to an untreated heart. In other respects, compared with untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the protein expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after about 0 hours to about 25 days, or about 12 hours to about 21 days following modRNA treatment. In some other respects, compared with untreated heart, in vivo treatment of the heart with the modRNA disclosed herein can increase the protein expression of pip4k2c by at least about 1-fold, about 5-fold, about 10-fold, about 15-fold, about 20-fold, about 25-fold, about 30-fold, about 35-fold, about 40-fold, about 45-fold, or about 50-fold after approximately 0 hours, approximately 12 hours, approximately 1 day, approximately 2 days, approximately 3 days, about 6 days, approximately 7 days, about 8 days, about 9 days, about 10 days, about 12 days, about 14 days, about 16 days, about 18 days, about 20 days, about 21 days, or about 25 days after modRNA treatment.

[0076] In some respects, in vivo treatment of the heart with the modRNA disclosed herein improves cardiac function compared to an untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c improves cardiac function compared to an untreated heart. In other respects, in vivo treatment of a heart with high heart failure (HF) with the modRNA encoding pip4k2c improves cardiac function compared to an untreated HF heart. In other respects, in vivo treatment of a heart with HF with the modRNA encoding pip4k2c can improve cardiac function by about 1% to about 26% or about 2% to about 20% compared to an untreated HF heart. In still other respects, in vivo treatment of a heart with HF with the modRNA encoding pip4k2c can improve cardiac function by about 1%, about 2%, about 5%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, or about 26% compared to an untreated HF heart. In several other respects, compared with untreated HF heart, in vivo treatment of HF heart with modRNA encoding pip4k2c can improve cardiac function by approximately 1% to approximately 26% or approximately 2% to approximately 20% after approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days following modRNA treatment. In still other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can improve cardiac function. In several other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can improve cardiac function by approximately 1% to approximately 26% or approximately 2% to approximately 20%. In several other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can improve cardiac function by approximately 1%, approximately 2%, approximately 5%, approximately 10%, approximately 12%, approximately 14%, approximately 16%, approximately 18%, approximately 20%, approximately 22%, approximately 24%, or approximately 26%. In still other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can improve cardiac function by approximately 1% to approximately 26% or approximately 2% to approximately 20% after approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days, following modRNA treatment.

[0077] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces cardiac fibrosis compared to untreated heart. In some other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces cardiac fibrosis compared to untreated heart. In some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces cardiac fibrosis compared to untreated HF heart. In some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reduce cardiac fibrosis by about 1% to about 26% or about 2% to about 20% compared to untreated HF heart. In still some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reduce cardiac fibrosis by about 1%, about 2%, about 5%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, or about 26% compared to untreated HF heart. In other respects, compared with untreated HF heart, in vivo treatment of HF heart with modRNA encoding pip4k2c can reduce cardiac fibrosis by about 1% to about 26% or about 2% to about 20% after about 0 hours to about 25 days, or about 12 hours to about 21 days, following modRNA treatment. In other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce cardiac fibrosis. In other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce cardiac fibrosis by about 1% to about 26% or about 2% to about 20%. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c reduced cardiac fibrosis by approximately 1%, approximately 2%, approximately 5%, approximately 10%, approximately 12%, approximately 14%, approximately 16%, approximately 18%, approximately 20%, approximately 22%, approximately 24%, or approximately 26%. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c reduced cardiac fibrosis by approximately 1% to approximately 26% or approximately 2% to approximately 20% approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days after modRNA treatment.

[0078] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can reverse cardiac hypertrophy compared to untreated heart. In some other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can reverse cardiac hypertrophy compared to untreated heart. In some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reverse cardiac hypertrophy compared to untreated HF heart. In some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reverse cardiac hypertrophy by about 1% to about 26% or about 2% to about 20% compared to untreated HF heart. In still some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reverse cardiac hypertrophy by about 1%, about 2%, about 5%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, or about 26% compared to untreated HF heart. In other respects, compared with untreated HF heart, in vivo treatment of HF heart with modRNA encoding pip4k2c can reverse cardiac hypertrophy by approximately 1% to approximately 26% or approximately 2% to approximately 20% after approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days, following modRNA treatment. In other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reverse cardiac hypertrophy. In other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reverse cardiac hypertrophy by approximately 1% to approximately 26% or approximately 2% to approximately 20%. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c reversed cardiac hypertrophy by approximately 1%, approximately 2%, approximately 5%, approximately 10%, approximately 12%, approximately 14%, approximately 16%, approximately 18%, approximately 20%, approximately 22%, approximately 24%, or approximately 26%. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c reversed cardiac hypertrophy by approximately 1% to approximately 26% or approximately 2% to approximately 20% after modRNA treatment, approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days.

[0079] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can regulate the fractional shortening (FS) compared to untreated hearts. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can increase the fractional shortening compared to untreated hearts. In other respects, in vivo treatment of HF hearts with the modRNA encoding pip4k2c can increase the fractional shortening compared to untreated HF hearts. In still other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can increase the fractional shortening compared to untreated DCM hearts. In other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can increase the fractional shortening by about 1% to about 26% or about 2% to about 20% compared to untreated DCM hearts. In several other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase the shortening fraction by approximately 1%, approximately 2%, approximately 5%, approximately 10%, approximately 12%, approximately 14%, approximately 16%, approximately 18%, approximately 20%, approximately 22%, approximately 24%, or approximately 26%. In still other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase the shortening fraction by approximately 1% to approximately 26% or approximately 2% to approximately 20% after modRNA treatment, approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days.

[0080] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can regulate the left ventricular end-diastolic diameter (LVIDd) compared to untreated hearts. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can reduce LVIDd compared to untreated hearts. In other respects, in vivo treatment of HF hearts with the modRNA encoding pip4k2c can reduce LVIDd compared to untreated HF hearts. In still other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can reduce LVIDd compared to untreated DCM hearts. In other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can reduce LVIDd by approximately 0.1 cm to approximately 2 cm or approximately 0.5 cm to approximately 1 cm compared to untreated DCM hearts. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce LVIDd by approximately 0.01 cm, approximately 0.05 cm, approximately 0.1 cm, approximately 0.2 cm, approximately 0.5 cm, approximately 0.8 cm, approximately 1.0 cm, approximately 1.2 cm, approximately 1.5 cm, approximately 1.8 cm, or approximately 2.0 cm. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce LVIDd by approximately 0.1 cm to approximately 2 cm or approximately 0.5 cm to approximately 1 cm approximately 0 hours to approximately 25 days after modRNA treatment, or approximately 12 hours to approximately 21 days after modRNA treatment.

[0081] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can modulate left ventricular end-systolic diameters (LVIDs) compared to untreated hearts. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can reduce LVIDs compared to untreated hearts. In other respects, in vivo treatment of HF hearts with the modRNA encoding pip4k2c can reduce LVIDs compared to untreated HF hearts. In still other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can reduce LVIDs compared to untreated DCM hearts. In other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can reduce LVIDs by approximately 0.1 cm to approximately 3 cm or approximately 0.5 cm to approximately 2 cm compared to untreated DCM hearts. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce LVIDs by approximately 0.01 cm, approximately 0.05 cm, approximately 0.1 cm, approximately 0.2 cm, approximately 0.5 cm, approximately 0.8 cm, approximately 1.0 cm, approximately 1.2 cm, approximately 1.5 cm, approximately 1.8 cm, approximately 2.0 cm, or approximately 3.0 cm. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce LVIDs by approximately 0.1 cm to approximately 3 cm or approximately 0.5 cm to approximately 2 cm approximately 0 hours to approximately 25 days after modRNA treatment, or approximately 12 hours to approximately 21 days after modRNA treatment.

[0082] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can regulate total heart weight (HW) compared to untreated heart. In some other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can reduce HW compared to untreated heart. In some other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c can reduce HW compared to untreated HF heart. In still some other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce HW compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce HW by about 0.1 mg to about 3 mg or about 0.5 mg to about 2 mg compared to untreated DCM heart. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce HW by approximately 0.01 mg, approximately 0.05 mg, approximately 0.1 mg, approximately 0.2 mg, approximately 0.5 mg, approximately 0.8 mg, approximately 1.0 mg, approximately 1.2 mg, approximately 1.5 mg, approximately 1.8 mg, approximately 2.0 mg, approximately 2.5 mg, or approximately 3.0 mg. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce HW by approximately 0.1 mg to approximately 3 mg or approximately 0.5 mg to approximately 2 mg after approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days following modRNA treatment.

[0083] In some respects, in vivo treatment of the heart with the modRNA disclosed herein can modulate the heart weight to tibia length ratio (HW / TL) compared to an untreated heart. In some other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c can reduce HW / TL compared to an untreated heart. In some other respects, in vivo treatment of a heart with high heart failure (HF) with the modRNA encoding pip4k2c can reduce HW / TL compared to an untreated heart with diabetic cerebral palsy (DCM). In some other respects, in vivo treatment of a heart with DCM with the modRNA encoding pip4k2c can reduce HW / TL by about 0.1 mg / mm to about 3 mg / mm or about 0.5 mg / mm to about 2 mg / mm compared to an untreated heart with DCM. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce HW / TL by approximately 0.01 mg / mm, approximately 0.05 mg / mm, approximately 0.1 mg / mm, approximately 0.2 mg / mm, approximately 0.5 mg / mm, approximately 0.8 mg / mm, approximately 1.0 mg / mm, approximately 1.2 mg / mm, approximately 1.5 mg / mm, approximately 1.8 mg / mm, approximately 2.0 mg / mm, approximately 2.5 mg / mm, or approximately 3.0 mg / mm. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce HW / TL by approximately 0.1 mg / mm to approximately 3 mg / mm or approximately 0.5 mg / mm to approximately 2 mg / mm after approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days, following modRNA treatment.

[0084] In some respects, in vivo treatment of the heart with the modRNA disclosed herein modally modulates the cross-sectional area of ​​the cardiomyocyte membrane compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the cross-sectional area of ​​the cardiomyocyte membrane compared to untreated heart. In other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the cross-sectional area of ​​the cardiomyocyte membrane compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the cross-sectional area of ​​the cardiomyocyte membrane compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the cross-sectional area of ​​the cardiomyocyte membrane by approximately 10 μm compared to untreated DCM heart.2 Approximately 100mm 2 Or about 10mm 2 Approximately 90mm 2 In several other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce the cross-sectional area of ​​cardiomyocyte membranes by approximately 10 μm compared to untreated DCM heart. 2 Approximately 50μm 2 Approximately 100μm 2 Approximately 500μm 2 Approximately 1mm 2 Approximately 5mm 2 Approximately 10mm 2 Approximately 20mm 2 Approximately 30mm 2 Approximately 40mm 2 Approximately 50mm 2 Approximately 60mm 2 Approximately 70mm 2 Approximately 80mm 2 Approximately 90mm 2 or about 100mm 2 In other respects, compared with untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce the cross-sectional area of ​​cardiomyocyte membrane by approximately 10 μm from approximately 0 hours to approximately 25 days after modRNA treatment, or from approximately 12 hours to approximately 21 days after modRNA treatment. 2 Approximately 100mm 2 Or about 10mm 2 Approximately 90mm 2 .

[0085] In some respects, in vivo treatment of the heart with the modRNA disclosed herein modally modulates the area of ​​fibrosis in the left ventricle compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the area of ​​fibrosis in the left ventricle compared to untreated heart. In other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the area of ​​fibrosis in the left ventricle compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the area of ​​fibrosis in the left ventricle compared to untreated DCM heart. In other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the area of ​​fibrosis in the left ventricle by approximately 30% to approximately 60% or approximately 40% to approximately 70% compared to untreated DCM heart. In several other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce the fibrotic area in the left ventricle by approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, or approximately 70%. In still other respects, compared to untreated DCM heart, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce the fibrotic area in the left ventricle by approximately 30% to approximately 60%, or approximately 40% to approximately 70% approximately 0 hours to approximately 25 days, or approximately 12 hours to approximately 21 days after modRNA treatment.

[0086] In some respects, in vivo treatment of the heart with the modRNA disclosed herein improves life expectancy (or “survival rate”) compared to subjects with untreated hearts. In some other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c increases life expectancy compared to subjects with untreated hearts. In some other respects, in vivo treatment of HF with the modRNA encoding pip4k2c increases life expectancy compared to subjects with untreated HF hearts. In still some other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c increases life expectancy compared to subjects with untreated DCM hearts. In some other respects, in vivo treatment of DCM hearts with the modRNA encoding pip4k2c can increase life expectancy by approximately 5% to approximately 100% compared to the life expectancy of subjects with untreated DCM hearts. In several other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase the life expectancy of subjects by approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or approximately 100% compared to the life expectancy of subjects with untreated DCM heart. In still other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase the life expectancy of subjects by approximately 5% to approximately 100% from approximately 0 hours to approximately 25 days after modRNA treatment, compared to the life expectancy of subjects with untreated DCM heart. In several other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase the life expectancy of subjects by approximately 5% to approximately 100% from approximately 0 hours, approximately 1 day, approximately 5 days, approximately 10 days, approximately 15 days, approximately 20 days, or approximately 25 days after modRNA treatment, compared to the life expectancy of subjects with untreated DCM heart. In other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can increase life expectancy of subjects by approximately 5% to approximately 100% at approximately 19, 20, 21, 22, 23, 24, or 25 days after modRNA treatment, compared to the survival rate of subjects with untreated DCM heart.

[0087] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces gene expression of at least one marker of cardiac hypertrophy compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces gene expression of at least one marker of cardiac hypertrophy compared to untreated heart. In still other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces gene expression of at least one marker of cardiac hypertrophy compared to untreated HF heart. In yet another other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces gene expression of at least one marker of cardiac hypertrophy compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces gene expression of at least one marker of cardiac hypertrophy by at least half compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce gene expression of at least one marker of cardiac hypertrophy, selected from atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP), compared to untreated DCM heart.

[0088] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces the gene expression of at least one metalloproteinase (MMP) compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the gene expression of at least one MMP compared to untreated heart. In still other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the gene expression of at least one MMP compared to untreated HF heart. In yet another respect, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the gene expression of at least one MMP compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the gene expression of at least one MMP by at least half compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce gene expression of at least one MMP selected from MMP2, MMP3, MMP7 and MMP9 compared to untreated DCM heart.

[0089] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces the gene expression of at least one fibrosis marker compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the gene expression of at least one fibrosis marker compared to untreated heart. In still other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the gene expression of at least one fibrosis marker compared to untreated HF heart. In yet another other respect, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the gene expression of at least one fibrosis marker compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the gene expression of at least one fibrosis marker by at least half compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce gene expression of at least one fibrosis marker selected from the following: Col1a1 (collagen, type I, α1), Col1a2 (collagen, type I, α2), and Col3a1 (collagen, type III, α1) compared to untreated DCM heart.

[0090] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces the gene expression of TGFβ1 (transforming growth factor β1) compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the gene expression of TGFβ1 compared to untreated heart. In still other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the gene expression of TGFβ1 compared to untreated HF heart. In yet another respect, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the gene expression of the TGFβ1 marker compared to untreated DCM heart. In other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the gene expression of TGFβ1 by at least half compared to untreated DCM heart.

[0091] In some respects, in vivo treatment of the heart with the modRNA disclosed herein reduces the gene expression of at least one extracellular matrix protein compared to untreated heart. In other respects, in vivo treatment of the heart with the modRNA encoding pip4k2c reduces the gene expression of at least one extracellular matrix protein compared to untreated heart. In still other respects, in vivo treatment of HF heart with the modRNA encoding pip4k2c reduces the gene expression of at least one extracellular matrix protein compared to untreated HF heart. In yet another other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c reduces the gene expression of at least one extracellular matrix protein compared to untreated DCM heart. In still other respects, in vivo treatment of DCM heart with the modRNA encoding pip4k2c can reduce the gene expression of at least one extracellular matrix protein by at least half compared to untreated DCM heart. In some other respects, in vivo treatment of DCM heart with modRNA encoding pip4k2c can reduce gene expression of at least one extracellular matrix protein selected from the following: fibronectin 1 (FN1) and connective tissue growth factor (CTGF) compared to untreated DCM heart.

[0092] In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can inhibit at least one signaling pathway activated in the heart failure (HF). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can inhibit at least one signaling pathway activated in the heart disease (DCM). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can attenuate at least one signaling pathway activated in the heart failure (HF). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can attenuate at least one signaling pathway activated in the heart disease (DCM). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can inhibit at least two signaling pathways activated in the heart failure (HF). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can inhibit at least two signaling pathways activated in the heart disease (DCM). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can attenuate at least two signaling pathways activated in the heart failure (HF). In some aspects, in vivo treatment of the heart with the modRNA disclosed herein can attenuate at least two signaling pathways activated in the heart disease (DCM). In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one signaling pathway selected from the mTORC1 and TGF-β pathways activated in the heart heart (HF). In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one signaling pathway selected from the mTORC1 and TGF-β pathways activated in the heart meridian (DCM). In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one signaling pathway selected from the mTORC1 and TGF-β pathways activated in the heart heart (HF). In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one signaling pathway selected from the mTORC1 and TGF-β pathways activated in the heart meridian (DCM). In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit both the mTORC1 and TGF-β pathways in the heart. In some respects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate both the mTORC1 and TGF-β pathways in the heart. In some respects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one downstream target of the mTORC1 pathway in the heart. In some respects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one downstream target of the mTORC1 pathway in the heart. In some respects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one downstream target of the TGF-β pathway in the heart.In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one downstream target of the TGF-β pathway in the heart. In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one downstream target of the mTORC1 pathway and at least one downstream target of the TGF-β pathway in the heart. In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can inhibit at least one downstream target of the mTORC1 pathway and attenuate at least one downstream target of the TGF-β pathway in the heart. In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one downstream target of the mTORC1 pathway and attenuate at least one downstream target of the TGF-β pathway in the heart. In some aspects, in vivo treatment of the heart with the modRNA encoding pip4k2c disclosed herein can attenuate at least one downstream target of the mTORC1 pathway and attenuate at least one downstream target of the TGF-β pathway in the heart.

[0093] (b) Pharmaceutically acceptable carriers and excipients

[0094] In various embodiments, the compositions disclosed herein may further comprise one or more pharmaceutically acceptable diluents, excipients, or carriers. As used herein, a pharmaceutically acceptable diluent, excipient, or carrier is a substance suitable for administration to a subject without causing undesirable biological effects or interacting with any component of the composition comprising it in an adverse manner. Pharmaceutically acceptable diluents, carriers, and excipients may include, but are not limited to, physiological saline, Ringer's solution, phosphate solution, or buffers, buffered saline, and other carriers known in the art. Pharmaceutical compositions may also include stabilizers, antioxidants, colorants, other pharmaceutical or medicinal agents, carriers, adjuvants, preservatives, stabilizers, wetting agents, emulsifiers, solution cocatalysts, salts, solubilizers, defoamers, antioxidants, dispersants, surfactants, and combinations thereof.

[0095] In various embodiments, the compositions disclosed herein include pharmaceutical compositions comprising at least one modRNA encoding at least one heart-specific gene. In various embodiments, the compositions disclosed herein include pharmaceutical compositions comprising at least one modRNA encoding at least one heart-specific protein. In various embodiments, the compositions disclosed herein include pharmaceutical compositions comprising at least one modRNA encoding pip4k2c.

[0096] In some embodiments, the pharmaceutical compositions disclosed herein may be formulated in a conventional manner using one or more physiologically acceptable carriers, the carriers comprising excipients and adjuvants that facilitate the processing of the active ingredient into a pharmaceutically usable formulation. In other embodiments, the appropriate formulation of the pharmaceutical compositions disclosed herein may depend on the chosen route of administration. In all aspects, any known techniques, carriers, and excipients may be used where appropriate and as understood in the art. An overview of the pharmaceutical compositions described herein can be found, for example, in Hoover, John E., R. EMINGTON'S P HARMACEUTICAL S CIENCES , Mack Publishing Co., Easton, Pa. 1995; Liberman, HA and Lachman, L., Eds., P HARMACEUTICAL D OSAGE F ORMS Marcel Decker, New York, NY, 1980; and P HARMACEUTICAL D OSAGE F ORMS AND D RUG D ELIVERY S YSTEMS The contents of Seventh Ed. (Lippincott Williams & Wilkins 1999) are incorporated herein by reference in their entirety.

[0097] In various embodiments, the pharmaceutical compositions described herein may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and adjuvants that facilitate the processing of genetically modified endothelial progenitor cells into pharmaceutically usable formulations. In other embodiments, any known techniques, carriers, and excipients may be used where appropriate and as understood in the art.

[0098] In various embodiments, the pharmaceutical compositions described herein may be aqueous suspensions comprising one or more polymers as suspending agents. In some aspects, the polymers comprising the pharmaceutical compositions described herein may include: water-soluble polymers, such as cellulose polymers like hydroxypropyl methylcellulose; water-insoluble polymers, such as cross-linked carboxyl-containing polymers; mucosal adhesive polymers selected from, for example, carboxymethyl cellulose, carbomer (acrylic acid polymer), poly(methyl methacrylate), polyacrylamide, polycarbophil, acrylate / butyl acrylate copolymer, sodium alginate, and dextran; or combinations thereof. In other aspects, the compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total polymer amount based on the total weight of the composition as one or more suspending agents.

[0099] In various embodiments, the pharmaceutical compositions disclosed herein may include viscous formulations. In some aspects, the viscosity of the composition may be increased by adding one or more gelling agents or thickeners. In other aspects, the compositions disclosed herein may include one or more gelling agents or thickeners in an amount sufficient to provide a sufficiently viscous formulation to be retained on the treated tissue. In still other aspects, the compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of one or more gelling agents or thickeners. In yet another aspect, suitable thickeners may be hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyvinylpyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, or sodium hyaluronate. In other aspects, viscosity enhancers can be gum arabic, agar, magnesium aluminum silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, carbopol, xanthan gum, cellulose, microcrystalline cellulose (MCC), caryopsis, chitin, carboxymethyl chitosan, chondrus, dextrose, red algae gum, gelatin, guar gum, lithium montmorillonite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, corn starch, wheat starch, rice starch, and potato starch. Gelatin, Dahaizi gum, xanthan gum, astragalus gum, ethyl cellulose, ethyl hydroxyethyl cellulose, ethyl methyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethyl methyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate), oxy-based polygelatin, pectin, polygelatin peptides, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropyl methyl cellulose (HPMC), sodium carboxymethyl cellulose (CMC), silica, polyvinylpyrrolidone (PVP: povidone) (dextrose, maltodextrin, and sucralose) or combinations thereof. In certain embodiments, a suitable thickener may be carboxymethyl cellulose.

[0100] In various embodiments, the pharmaceutical compositions disclosed herein may include additional agents or additives selected from the group consisting of surfactants, detergents, solvents, acidifiers, alkalizers, buffers, tension modifiers, ionic additives that effectively increase the ionic strength of a solution, antibacterial agents, antibiotics, antifungals, antioxidants, preservatives, electrolytes, defoamers, oils, stabilizers, enhancers, etc. In some aspects, the pharmaceutical compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of one or more agents by weight of the total composition. In other aspects, one or more of these agents may be added to improve the performance, efficacy, safety, shelf life, and / or other properties of the muscarinic antagonist compositions of the present invention. In some preferred aspects, the additives will be biocompatible and will not be irritating, abrasive, or allergenic.

[0101] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more acidifiers. As used herein, an "acidifier" refers to a compound used to provide an acidic medium. Such compounds include, but are not limited to, acetic acid, amino acids, citric acid, fumaric acid and other alpha-hydroxy acids, such as hydrochloric acid, ascorbic acid and nitric acid, and other acids known to those skilled in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In other aspects, the compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the composition, of one or more acidifiers.

[0102] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more alkalizing agents. As used herein, an alkalizing agent is a compound used to provide an alkaline medium. Such compounds include, but are not limited to, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, trihydroxyethylamine, and triethanolamine, as well as other substances known to those skilled in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base may be used. In other aspects, the compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of one or more alkalizing agents by weight of the total composition.

[0103] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more antioxidants. As used herein, an "antioxidant" is an agent that inhibits oxidation and is therefore used to prevent the formulation from deteriorating due to oxidative processes. Such compounds include, but are not limited to, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphite, thioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, and sodium metabisulfite, as well as other substances known to those skilled in the art. In some aspects, the compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the composition of one or more antioxidants.

[0104] In other embodiments, the pharmaceutical compositions disclosed herein may include buffer systems. As used herein, a “buffer system” is a composition comprising one or more buffers, wherein a “buffer” is a compound used to resist pH changes upon dilution or addition of an acid or base. Buffers include, but are not limited to, potassium metaphosphate, potassium phosphate, monobasic sodium acetate, anhydrous sodium citrate and sodium citrate dihydrate, and other substances known to those skilled in the art. In some aspects, any pharmaceutically acceptable organic or inorganic buffer may be used. In another aspect, the compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the composition, of one or more buffers. In other aspects, the amount of one or more buffers may depend on the desired pH level of the composition. In some embodiments, the pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In other embodiments, the pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6. In a preferred embodiment, the compositions disclosed herein may have a pH greater than about 6.8.

[0105] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more preservatives. As used herein, a "preservative" means an agent or combination of agents that inhibits, reduces, or eliminates bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include parabens A, propylparaben, isopropanol, and combinations thereof. In some aspects, any pharmaceutically acceptable preservative may be used. In other aspects, the pharmaceutical compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the composition, representing one or more preservatives.

[0106] In other embodiments, the pharmaceutical compositions disclosed herein may include one or more surface-acting reagents or detergents. In some aspects, the surface-acting reagents or detergents may be synthetic, natural, or semi-synthetic. In other aspects, the compositions disclosed herein may include anionic detergents, cationic detergents, zwitterionic detergents, amphoteric detergents, acid-base facultative detergents, nonionic detergents having a steroidal framework, or combinations thereof. In still other aspects, the pharmaceutical compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of one or more surface-acting reagents or detergents.

[0107] In various embodiments, the pharmaceutical compositions disclosed herein may include one or more stabilizers. As used herein, a "stabilizer" means a compound used to stabilize an active agent against a physical, chemical, or biochemical process that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, but are not limited to, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, nicotinamide, sodium acetyltryptophan, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycol, sodium caprylate, and sodium saccharin, as well as other substances known to those skilled in the art. In some aspects, the pharmaceutical compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the total weight of the composition, of one or more stabilizers.

[0108] In other embodiments, the pharmaceutical compositions disclosed herein may include one or more tensile agents. As used herein, a “tensile agent” refers to a compound that can be used to adjust the tensile strength of a liquid formulation. Suitable tensile agents include, but are not limited to, glycerol, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose, and other substances known to those skilled in the art or of ordinary skill. The permeate content in the composition may be expressed in milliosmol / L. Permeate content can be measured using methods known in the art. In some preferred embodiments, the permeate content of the compositions disclosed herein is calculated using a vapor pressure reduction method. In some respects, the amount of one or more tensile agents, including those of the pharmaceutical compositions disclosed herein, can result in a composition permeation of: about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L, or about 250 mOsm / L to about 320 mOsm / L. In other respects, the compositions herein may have permeation ranges of about 100 mOsm / kg to about 1000 mOsm / kg, about 200 mOsm / kg to about 800 mOsm / kg, about 250 mOsm / kg to about 500 mOsm / kg, or about 250 mOsm / kg to about 320 mOsm / kg, or about 250 mOsm / kg to about 350 mOsm / kg, or about 280 mOsm / kg to about 320 mOsm / kg. In some embodiments, the pharmaceutical compositions described herein have an osmotic pressure of about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L. In other aspects, the pharmaceutical compositions disclosed herein may include at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of one or more tension modifiers by weight of the total composition.

[0109] (c) Dosage Forms

[0110] In some embodiments, the pharmaceutical compositions disclosed herein can be formulated for parenteral administration by injection. In some aspects, parenteral administration by injection may be via bolus injection and / or continuous infusion. In some embodiments, the pharmaceutical compositions disclosed herein can be formulated for parenteral administration by intracardiac injection. As used herein, the term "intracardiac injection" refers to an injection administered directly to the myocardium or ventricle. In some other embodiments, the pharmaceutical compositions disclosed herein can be formulated for parenteral administration by catheter-based intracoronary infusion. In still other embodiments, the pharmaceutical compositions disclosed herein can be formulated for parenteral administration by pericardial injection.

[0111] In various embodiments, the pharmaceutical compositions disclosed herein as injectable formulations may be present in unit dosage forms. In some aspects, the unit dosage form may be in ampoules and / or in multi-dose containers. In other aspects, the pharmaceutical compositions disclosed herein may be suspensions, solutions, or emulsions in oily or aqueous carriers. In still other aspects, the pharmaceutical compositions disclosed herein may contain a formulary agent, such as a suspension, stabilizer, and / or dispersant. In yet another aspect, the pharmaceutical compositions disclosed herein may be present in unit-dose or multi-dose containers. Non-limiting examples of unit-dose or multi-dose containers include sealed ampoules and vials. On one hand, the pharmaceutical compositions disclosed herein may be in the form of powders requiring only immediate addition of a sterile liquid carrier before use, or stored under lyophilized (freeze-dried) conditions. In other aspects, the pharmaceutical compositions disclosed herein may be immediate injectable solutions, and suspensions may be prepared from sterile powders, granules, tablets, or combinations thereof. In still other aspects, the pharmaceutical compositions disclosed herein may be cryogenically frozen prior to storage. As used herein, “cryogenic freezing” means and / or describes cryogenically preserved biological samples frozen in a manner that preserves their viability and allows for subsequent thawing when needed while maintaining viability. In some respects, the pharmaceutical compositions disclosed herein can be cryogenically frozen and stored for up to 1 week, up to 4 weeks, up to 8 weeks, up to 16 weeks, up to 25 weeks, up to 50 weeks, up to 100 weeks, or up to 200 weeks while maintaining viability.

[0112] In various embodiments, the pharmaceutical compositions described herein for parenteral administration may include aqueous and non-aqueous (oil-based) sterile injectable solutions of the composition, which may contain antioxidants, buffers, antibacterial agents, and solutes to make the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions, which may include suspending agents and thickeners. In some aspects, the pharmaceutical compositions described herein may include lipophilic solvents or loads. Non-limiting examples of loads include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. In various embodiments, the pharmaceutical compositions described herein may be aqueous injectable suspensions. In some aspects, the pharmaceutical compositions described herein may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. In other aspects, the pharmaceutical compositions described herein may include suitable stabilizers or agents that increase the solubility of enzymes and clarifying agents to allow the preparation of highly concentrated solutions.

[0113] (II) Use of the composition

[0114] In various embodiments, the compositions disclosed herein are effective in treating heart disease when administered to a subject in need. In other embodiments, the compositions disclosed herein are effective in treating heart failure (HF) when administered to a subject in need. In still other embodiments, the compositions disclosed herein are effective in treating dilated cardiomyopathy (DCM) when administered to a subject in need. In other embodiments, the compositions disclosed herein are effective in improving at least one symptom of DCM when administered to a subject in need.

[0115] Suitable subjects include humans, livestock, companion animals, laboratory animals, or zoological animals. In one embodiment, the subject may be a rodent, such as a mouse, rat, guinea pig, etc. In another embodiment, the subject may be a livestock. Non-limiting examples of suitable livestock may include pigs, cattle, horses, goats, sheep, llamas, and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets, such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, "zoological animal" refers to an animal found in zoos. Such animals may include non-human primates, large cats, wolves, and bears. In a particular embodiment, the animal is a laboratory animal. Non-limiting examples of laboratory animals may include rodents, canines, felines, and non-human primates. In some embodiments, the animal is a rodent. Non-limiting examples of rodents may include mice, rats, guinea pigs, etc. In a preferred embodiment, the subject is a human.

[0116] In various embodiments, the subject in need may have been diagnosed with at least one heart disease. In some aspects, the subject may have heart failure (HF). Subjects with HF can be identified by routine medical examinations such as laboratory tests, EKG, ECG, echocardiography, stress testing, MRI, coronary angioplasty, myocardial biopsy, organ function tests, CT scan, or ultrasound. In some embodiments, the subject to be treated by the methods described herein may be a patient who has experienced or is currently receiving therapy for the treatment of HF. Subjects suspected of having any HF may exhibit one or more symptoms of HF. Subjects at risk of HF may be subjects with one or more risk factors for the disorder, such as carrying a gene mutation associated with HF but not exhibiting disease symptoms at the time of treatment. Subjects to be treated by the methods described herein may have HF classified according to, but not limited to, the New York Heart Association classification. For example, the New York Heart Association classification is based on a measure of symptoms, categorizing heart failure (HF) into four classes: Class I, where the subject has no symptoms; Class II, where the subject can perform daily activities without difficulty but becomes breathless or fatigued upon exertion; Class III, where the subject may have difficulty performing daily activities; and the most severe Class IV, where the subject experiences shortness of breath even at rest. Subjects to be treated using the methods described in this article may have HF classified according to, but not limited to, the American College of Cardiology / American Heart Association guideline. For example, the American College of Cardiology / American Heart Association guideline uses a stage-based classification system that uses letters A through D and includes categories for subjects at risk of developing heart failure. Using these guidelines, subjects with several risk factors for heart failure but without signs or symptoms of heart failure are classified as Stage A; subjects with heart disease but without signs or symptoms of heart failure are classified as Stage B; subjects with heart disease and experiencing or having experienced signs or symptoms of heart failure are classified as Stage C; and subjects with advanced heart failure requiring special treatment are classified as Stage D.

[0117] In other aspects, the subject may have DCM or be suspected of having DCM. In other embodiments, the subject may experience at least one symptom of DCM. In some aspects, the symptom of DCM may be fatigue. In other aspects, the symptom of DCM may be dyspnea. In other aspects, the symptom of DCM may be edema. In still other aspects, the symptom of DCM may be ascites. In other aspects, the symptom of DCM may be chest pain. In still other aspects, the symptom of DCM may be a heart murmur.

[0118] In some cases, subjects to be treated using the methods disclosed herein may have previously been treated for general HF and / or DCM. In other cases, subjects to be treated have HF and have experienced or are experiencing another therapy for HF. Non-limiting examples include medication, surgery, enzyme replacement therapy, hematopoietic stem cell (HSC) transplantation, substrate-reducing molecular therapy, molecular chaperone therapy, adeno-associated virus gene therapy, HSC-mediated lentiviral vector gene therapy, or the combination therapies disclosed herein. Examples of medications used to treat heart failure (HR) may include, but are not limited to, angiotensin-converting enzyme (ACE) inhibitors (i.e., enalapril, lisinopril, captopril), angiotensin II receptor blockers (i.e., losartan, valsartan, candesartan), beta-blockers (i.e., carvedilol, metoprolol, bisoprolol), diuretics (i.e., furosemide, thiazide, spironolactone), inotropes, and digoxin. Examples of surgical procedures used to treat HR may include, but are not limited to, coronary artery bypass grafting, heart valve repair or replacement, valvuloplasty, implantable cardioverter-defibrillator (ICD), cardiac resynchronization therapy (CRT), biventricular pacing, ventricular assist devices (VAD), and heart transplantation. Previous HR treatments may be complete. Alternatively, the previous HR therapy may still be ongoing. In some implementations, the subject may exhibit systemic improvements (e.g., complete or partial) related to HR following the previous therapy.Additional useful agents and therapies can be found in the following: Physician's Desk Reference, 59.sup.th edition, (2005), Thomson PDR, Montvale NJ; Gennaro et al., Eds. Remington's The Science and Practice of Pharmacy, 20.sup.th edition, (2000), Lippincott Williams and Wilkins, Baltimore Md.; Braunwald et al., Eds. Harrison's Principles of Internal Medicine, 15.sup.th edition, (2001), McGraw Hill, NY; Berkow et al., Eds. The Merck Manual of Diagnosis and Therapy, (1992), Merck Research Laboratories, Rahway NJ.

[0119] The compositions disclosed herein can reduce and / or reverse DCM-induced cardiac fibrosis compared to untreated subjects with the same disease condition and predicted outcomes. In some aspects, DCM-induced cardiac fibrosis can be reduced by about 20% to about 40% after administration of the compositions disclosed herein.

[0120] The compositions disclosed herein can reduce and / or reverse DCM-induced left ventricular dilatation compared to untreated subjects with the same disease condition and predicted outcomes. In some aspects, DCM-induced left ventricular dilatation can be reduced by about 20% to about 40% after administration of the compositions disclosed herein.

[0121] In some embodiments, treating a subject in vivo with a composition comprising a modRNA encoding pip4k2c, as disclosed herein, can inhibit at least one overactive signaling pathway, wherein the inhibited signaling pathway is not overactive in healthy subjects. In some aspects, treating a subject in vivo with a composition comprising a modRNA encoding pip4k2c, as disclosed herein, can inhibit at least one signaling pathway selected from the mTORC1 pathway and the TGF-β pathway. In some other aspects, treating a subject in vivo with a composition comprising a modRNA encoding pip4k2c, as disclosed herein, can inhibit both the mTORC1 and TGF-β signaling pathways.

[0122] In some embodiments, a composition comprising a modRNA encoding pip4k2c, as disclosed herein, can be used in vivo to treat a subject in need in combination with another agent that can inhibit the mTORC1 and / or TGF-β signaling pathways. In some instances, the composition comprising a modRNA encoding pip4k2c can be administered in combination with rapamycin. In some instances, the composition comprising a modRNA encoding pip4k2c can be administered in combination with SB4311542.

[0123] In some embodiments, administration of a modRNA encoding pip4k2c to the heart tissue of a subject in need replaces treatment with at least one inhibitor of the mTORC1 pathway. In some aspects, administration of a modRNA encoding pip4k2c to the heart tissue of a subject in need replaces treatment with rapamycin. In some aspects, administration of a modRNA encoding pip4k2c to the heart tissue of a subject in need is equally effective in treating heart failure compared to subjects treated with mTORC1 inhibitors who have the same disease symptoms and predicted outcomes. In other aspects, administration of a modRNA encoding pip4k2c to the heart tissue of a subject in need is equally effective in treating heart failure compared to subjects treated with rapamycin who have the same disease symptoms and predicted outcomes.

[0124] (III) Method of using the composition

[0125] Other embodiments of this disclosure are methods of administering the disclosed compositions to a subject in need, wherein the administration is for the treatment of heart disease. Still other embodiments of this disclosure are methods of administering the disclosed compositions to a subject in need, wherein at least one symptom of heart disease improves by at least 25% within one month following administration.

[0126] (a) Application method

[0127] In various embodiments, the compositions disclosed herein can be administered via parenteral administration. As used herein, “administered via parenteral administration” means administered via a route other than the digestive tract. In some embodiments, the compositions disclosed herein can be administered via parenteral injection. In some aspects, administration of the disclosed compositions via parenteral injection may be via subcutaneous, intramuscular, intravenous, intraperitoneal, intracardiac, intra-articular, or intracavitary injection. In other aspects, administration of the disclosed compositions via parenteral injection may be via slow or bolus injection methods known in the art. In some embodiments, the route of administration via parenteral injection may be determined by the target location. In some aspects, the compositions disclosed herein may be formulated for parenteral administration via intracardiac injection. In some other aspects, the compositions disclosed herein may be formulated for parenteral administration via catheter-based intracoronary infusion. In still other aspects, the compositions disclosed herein may be formulated for parenteral administration via pericardial injection.

[0128] In various embodiments, the dosage of the disclosed composition to be applied is not particularly limited and may be appropriately selected depending on conditions such as the purpose of prevention and / or treatment, the type of disease, the subject's weight or age, the severity of the disease, etc. In other embodiments, the application of a dose of the disclosed composition may include a therapeutically effective amount of the disclosed composition. As used herein, the term "therapeutically effective" refers to the amount of the applied composition that treats heart disease, reduces the presentation of at least one symptom associated with heart disease, reverses / prevents cardiac fibrosis, reverses / prevents dilation of at least one ventricle, reduces total heart weight, improves cardiac function, enhances survival, or a combination thereof.

[0129] As used herein, a “therapeutic effective amount” means the amount of each active agent (here, the modRNA encoding pip4k2c) required, alone or in combination with one or more other active agents, to confer a therapeutic effect on a subject. As those skilled in the art will appreciate, the effective amount varies depending on the route of administration, the use of excipients, and the co-use with other active agents. For example, an “effective amount” of the modRNA encoding pip4k2c may be the amount of a compound, alone or in combination with other agents, that produces the desired response (e.g., extended lifespan, delayed weight loss, improvement of one or more HR symptoms, and / or reduction of cardiac function decline). This may involve only a temporary slowing of disease progression, although more preferably, it involves permanently stopping disease progression. This can be monitored by conventional methods or by diagnostic methods according to the invention discussed herein. The desired response to treatment of a disease or condition may also be a delay in the onset of the disease or condition.

[0130] Of course, these dosages will depend on the specific condition being treated, its severity, individual patient parameters including age, physical condition, body type, sex, and weight, the duration of treatment, the nature of concurrent therapies (if applicable), the specific route of administration, and similar factors within the knowledge and experience of the healthcare professional. These factors are well known to those skilled in the art and can be addressed through no more than routine experimentation. Generally, the maximum dose of a single component or combination thereof is preferred, i.e., the highest safe dose based on reasonable medical judgment. However, those skilled in the art will understand that patients may adhere to lower or tolerable doses for medical, psychological, or virtually any other reason. The exact dosage and regimen can be determined by a physician.

[0131] The therapeutically effective amount of the disclosed composition to be delivered to a subject may be an amount that will not cause undesirable systemic side effects. In various embodiments, the administered composition as disclosed herein may comprise about 5% to about 95%, about 15% to about 85%, or about 25% to about 75% of modRNA based on the total weight of the composition. In other embodiments, the administered composition as disclosed herein may comprise about 5% to about 95%, about 15% to about 85%, or about 25% to about 75% of modRNA encoding pip4k2c based on the total weight of the composition.

[0132] (b) Frequency of application

[0133] In some embodiments, the disclosed composition may be administered once to a subject with this need. In some embodiments, the disclosed composition may be administered more than once to a subject with this need. In other embodiments, a second administration of the disclosed composition may be performed after a first administration of the disclosed composition. In some embodiments, a second and third administration of the disclosed composition may be performed after a first administration of the disclosed composition. In some embodiments, a second, third, and fourth administration of the disclosed composition may be performed after a first administration of the disclosed composition. In some embodiments, a second, third, fourth, and fifth administration of the disclosed composition may be performed after a first administration of the disclosed composition.

[0134] The number of times the composition can be administered to a subject in need may depend on the judgment of a medical professional, the severity of the heart condition, and the subject's response to the formulation. In some embodiments, the compositions disclosed herein may be administered continuously; alternatively, the administered drug dose may be temporarily reduced or suspended for a period of time (i.e., a "drug rest day"). In some aspects, the length of the drug rest day may vary from 2 days to 1 year, with examples including 2 days, 1 week, 1 month, 6 months, and 1 year. In other aspects, the dose reduction during the drug rest day may be 10%–100%, with examples including 10%, 25%, 50%, 75%, and 100%.

[0135] In various embodiments, the required daily dose of the compositions disclosed herein may be a single dose or as fractions administered simultaneously (or over a short period of time) or at appropriate intervals. In other embodiments, the compositions disclosed herein may be administered to a subject about once daily, about twice daily, or about three times daily. In still other embodiments, the compositions disclosed herein may be administered to a subject at least once daily; at least once daily for about 2 days; at least once daily for about 3 days; at least once daily for about 4 days; at least once daily for about 5 days; at least once daily for about 6 days; at least once daily for about 1 week; at least once daily for about 2 weeks; at least once daily for about 3 weeks; at least once daily for about 4 weeks; at least once daily for about 8 weeks; at least once daily for about 12 weeks; at least once daily for about 16 weeks; at least once daily for about 24 weeks; at least once daily for about 52 weeks and thereafter. In a preferred embodiment, the compositions disclosed herein may be administered to a subject about once every four weeks.

[0136] In some embodiments, the disclosed composition may be initially applied, followed by the application of one or more different compositions or treatment regimens. In other embodiments, the disclosed composition may be applied after the application of one or more different compositions or treatment regimens.

[0137] (IV) Kit

[0138] This disclosure also provides a kit for treating heart failure as described herein. The kit for therapeutic use as described herein may include one or more containers comprising a modified mRNA (modRNA) encoding phosphatidylinositol type 2 4-phosphate kinase γ (pip4k2c). The modRNA encoding pip4k2c may be formulated into a pharmaceutical composition.

[0139] In some embodiments, the kit may additionally include instructions for using the modRNA encoding pip4k2c in any of the methods described herein. The included instructions may include a description of administering the modRNA encoding pip4k2c or a pharmaceutical composition comprising the modRNA to a subject to achieve the desired activity in the subject. The kit may further include a description of selecting suitable subjects for treatment based on determining whether the subject requires treatment. In some embodiments, the instructions include a description of administering the modRNA encoding pip4k2c or a pharmaceutical composition comprising the modRNA to a subject who has or is suspected of having heart failure.

[0140] Instructions for use relating to the use of a modRNA encoding pip4k2c or a pharmaceutical composition comprising such a modRNA (such as those described herein) typically include information about the intended therapeutic dose, dosing regimen, and route of administration. Containers may be unit doses, bulk packaging (e.g., multi-dose packaging), or subunit doses. Instructions for use provided with kits disclosed herein are typically written instructions on a label or packaging insert. The label or packaging insert indicates that the pharmaceutical composition is intended for the treatment, delay of onset, and / or alleviation of disease or ailment in subjects.

[0141] The kits described herein are available in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, etc. Packaging is also intended for use with specific devices such as inhalers, nasal delivery devices, or infusion devices. The kits may have sterile access ports (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). Containers may also have sterile access ports. The modRNA encoding pip4k2c can be considered the active agent.

[0142] The kit may optionally include additional components, such as buffers and explanatory information. The kit may optionally include additional agents for use in conjunction with the modRNA encoding pip4k2c disclosed herein. Typically, the kit includes a container and a label on the container or one or more page inserts, or a label or one or more page inserts associated with the container. In some embodiments, this disclosure provides an article of manufacture comprising the contents of the kit described above.

[0143] General technology

[0144] Unless otherwise stated, the practice of this disclosure will employ conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the scope of the art. These techniques are well explained in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1989) Academic Press; Animal CellCulture(RIFreshney,ed.1987);Introduction to Cell and Tissue Culture(JPMather and PERoberts,1998)Plenum Press;Cell and Tissue Culture:Laboratory Procedures(A.Doyle,JBGriffiths,and DGNewell,eds.1993-8)J.Wileyand Sons;Methods in Enzymology(Academic Press,Inc.);Handbook of ExperimentalImmunology(DMWeir and CCBlackwell, eds.): Gene Transfer Vectors for Mammalian Cells (JMMiller and MPCalos, eds., 1987); Current Protocols in Molecular Biology (FMAusubel, et al. eds. 1987); PCR: The Polymerase ChainReaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (JEColigan et al., eds. 1987);, 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (DN Glover ed.1985); Nucleic Acid Hybridization (BD Hames & S.J. Higgins, eds. (1985>>) Transcription and Translation (BD Hames & S.J. Higgins, eds. (1984>>) Animal Cell Culture (RI Freshney, ed. (1986>>) Immobilized Cells and Enzymes (lRL Press, (1986>>) and B. Perbal, A practical Guide To Molecular Cloning (1984); FMAusubel et al. (eds.).

[0145] Without further elaboration, it is believed that those skilled in the art can fully utilize the invention based on the above description. Therefore, the following detailed description should be interpreted as illustrative only and does not limit the remainder of this disclosure in any way. All publications cited herein for the purposes or subject matter are incorporated herein by reference.

[0146] Example

[0147] The following embodiments are included to illustrate preferred embodiments of this disclosure. Those skilled in the art will understand that the techniques disclosed in the following embodiments represent techniques discovered by the inventors that work well in the practice of this disclosure, and therefore can be considered to constitute preferred modes of practice. However, those skilled in the art will understand that many changes can be made to the specific embodiments disclosed in this disclosure and similar or analogous results can still be obtained without departing from the spirit and scope of this disclosure.

[0148] Introduction of Examples 1-5

[0149] Heart disease is a major health problem worldwide, contributing to an increasing socioeconomic burden (Go et al., Circulation 129, e28-e292 (2014), the contents of which are incorporated herein by reference). Dilated cardiomyopathy (DCM) is a condition caused by genetic or non-genetic exposures, in which the heart becomes enlarged and unable to pump blood effectively (Weintraub et al., L...). ANCET 390, 400-414 (2017, the contents of which are incorporated herein by reference). Pathological hypertrophy occurs in response to persistent cardiac overload and is usually accompanied by increased fibrosis, immune response, cardiac panic, and subsequent heart failure (HF) (Dargie et al., H EART 91 Suppl 2,ii3-6,31,43-38 (2005, the contents of which are incorporated herein by reference). Therefore, revealing the mechanomyochemical pathways triggered by pathological stressors (e.g., DCM) could enable the development of new treatments for heart failure (HF) in general, particularly remedies for DCM.

[0150] Pip4k2c is type 2 phosphatidylinositol-5-phosphate 4-kinase (PI5P4K), which converts phosphatidylinositol-5-phosphate to phosphatidylinositol 4,5-bisphosphate in mammals. The mammalian gene PI5P4K encodes three enzymes—PI5P4Kα, PI5P4Kβ, and PI5P4Kγ—which play important roles in development, homeostasis, and disease (Gupta et al., PNAS 110, 5963-5968 (2013); Mackey et al., S...). CI S IGNAL 7,ra104(2014); and Mathre et al.,B IOSCI R EP 39 (2019), the contents of which are incorporated herein by reference. Pip4k2c is primarily expressed in the kidneys, brain, heart, and testes (Clarke et al., JCOMP N EUROL 517,296-312(2009);Al-Ramahi et al.,E LIFE 6 (2017); and Clarke et al., A M JP HYSIOL R ENAL P HYSIOL 295, F1422-1430 (2008), the contents of which are incorporated herein by reference.

[0151] Furthermore, Pip4k2c exhibits inhibition of mTORC1 signaling. The mTORC1 signaling pathway is one of the main signaling pathways that induce cardiac hypertrophy after stress overload. Additionally, TGF-β signaling plays an important role in the pathogenesis of cardiac fibrosis. Until now, it has been unclear whether Pip4k2c affects mTORC1 and TGF-β signaling in heart disease. As shown in Examples 1-5 below, increased Pip4k2c expression significantly attenuates and / or prevents cardiac hypertrophy and fibrosis in failing hearts, and improves cardiac function by inhibiting mTORC1 and TGF-β activity, two independent signaling pathways activated in heart failure and other heart diseases.

[0152] Example 1. Pip4k2c expression in human heart disease.

[0153] To investigate the role of Pip4k2c in heart disease, Pip4k2c mRNA and protein expression were analyzed in heart tissues of human subjects (“patients”) with hypertrophic (CH) and dilated cardiomyopathy (DCM). Specifically, Pip4k2c expression was detected in: 1) left ventricular tissue from a failed human heart obtained from a patient with end-stage heart failure during heart transplantation; and 2) normal heart samples obtained from a donor who died from a non-health-related cause (e.g., a motor vehicle accident) and whose heart was unsuitable for transplantation for non-cardiac reasons. Figure 1A Informed consent is obtained from potential donor patients before collecting heart tissue.

[0154] Pip4k2c mRNA expression was measured using real-time quantitative PCR (qRT-PCR) on RNA isolated from the patient's heart. Briefly, total RNA was isolated using the RNeasy mini kit (Qiagen) and reverse transcribed using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. qRT-PCR analysis was performed on a Mastercycler realplex 4Sequence Detector (Eppendorf) using the anthocyanin dye SYBR Green (N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3)-benzothiazolyl-2-yl)methyl]-1-phenylquinoline-1-onthiol-2-yl]-N-propylpropane-1,3-diamine). Data were normalized to 18S ribosomal RNA (18S) expression (endogenous control) where appropriate. Foldwise changes in gene expression were measured by... The method (Applied Biosystems Prism 7700 Users Bulletin No. 2, the disclosure of which is incorporated herein) was determined and presented relative to an internal control. The qRT-PCR primer sequences used in the embodiments of this disclosure are provided in Table 1.

[0155] Table 1: Primer sequences for qRT-PCR

[0156]

[0157]

[0158] like Figure 1B The study showed that Pip4k2c mRNA levels were significantly lower in the hearts of patients with chronic heart disease (CH) and diabetic pulmonary vascular disease (DCM) compared to non-failed (NF) left ventricular (LV) myocardium.

[0159] Next, Pip4k2c protein expression in the LV myocardium of cardiac samples was measured by Western blot analysis. Briefly, total protein was isolated from the tissue by homogenization. Next, equal amounts of protein were separated and blotted onto polyvinylidene fluoride (PVDF) membranes using a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) system on a 4%–15% Mini-PROTEAN TGX unstained gradient gel (Bio-Rad). The membranes were blocked (5% defatted dry milk [DM]) in Tris-buffered saline (TBS; 50 mM Tris-HCl [pH 7.4], 150 mM NaCl) at room temperature (25 °C ± 3 °C) for 1 hour, and then incubated overnight (~12 hours) at 4 °C with a first antibody diluted in TBS with 5% DM. The following first antibodies were used for specific protein detection at the corresponding dilutions of the examples disclosed herein using Western blot analysis: anti-Pip4k2c (1:1,000, Proteintech, #17077-1-AP); anti-Phospho-p70 S6 kinase (Thr389)(P-p70s6k) (1:2,000, Cell Signaling, #9205); p70S6 kinase (p70s6k) (1:2,000, Cell Signaling, #9202); anti-GAPDH (horseradish peroxidase [HRP] conjugate 1:3,000, Cell Signaling, #8884); and mouse monoclonal anti-β-actin (horseradish peroxidase [HRP] conjugate 1:3,000, #12262; Cell Signaling). Anti-rabbit and anti-mouse HRP conjugate second antibodies (Sigma-Aldrich) were also used. Display antigen and / or antibody complexes (Bio-Rad) using the ChemiDocTouch imaging system. Figure 1C-1D The study showed that the Pip4k2c protein level in LV myocardium from patients with CH and DCM was significantly lower than that in non-failed (NF) LV myocardium.

[0160] The expression of local Pip4k2c protein in the LV myocardium of human heart samples was also measured by immunostaining of frozen heart sections collected from the hearts of patients with CH, DCM, and NF. Briefly, frozen human heart sections were rehydrated in phosphate-buffered saline (PBS) for 5 min, followed by permeabilization with PBS containing 0.1% Triton X100 (PBST) for 7 min. The slides were then treated with 3% H2O2 for 5 min. After washing three times with PBST for 5 min each time, the samples were blocked for 2 h at room temperature with PBS + 5% Donkey normal serum + 0.1% Triton X100 (PBSST). Next, the primary antibody was diluted in PBSST and then added to the samples. The slides were then incubated overnight (~12 h) at 4 °C. The slides were washed with PBST (5 times, 4 min each time) and then incubated for 2 h at room temperature with a secondary antibody (Invitrogen, 1:200) diluted in PBST. Samples were further washed with PBST (3 times, 5 minutes each) and stained for 7 minutes with DAPI (4',6-diamidinyl-2-phenylindole; 1 μg / ml) diluted in PBST or Hoechst 33342 (1 μg / ml). After washing 5 times with PBST for 4 minutes each and once with tap water (4 minutes), slides were fixed with mounting medium (VECTASHIELD) for imaging. Stained slides were stored at 4°C. All staining was performed on 3–8 hearts / groups, 2–3 sections / heart. Fluorescence images were captured at 10X, 20X, and 40X magnification using a Zeiss fluorescence microscope. Compared with non-failed LV myocardium, Pip4k2c immunostaining (primarily localized to both myocytes and non-myocytes) was reduced in human LV myocardium in diseased individuals. Figure 1E-1J Therefore, the data show that Pip4k2c expression is significantly reduced in patients with CH and DCM. Figure 1K ).

[0161] Example 2. Pip4k2c expression in a mouse model of heart failure.

[0162] To investigate the consequences of decreased Pip4k2c expression observed in the patient's myocardium in Example 1, a mouse model of heart failure was generated and analyzed to confirm comparable decreased Pip4k2c expression.

[0163] Transverse aortic constriction (TAC) is a mouse model of cardiac hypertrophy and heart failure induced by pressure overload. TAC initially leads to compensatory cardiac hypertrophy, typically associated with a temporary increase in cardiac contractility. However, over time, the response to chronic hemodynamic overload becomes maladaptive, resulting in cardiac dilation and heart failure. The mouse TAC model has been widely used as a valuable tool for mimicking human cardiovascular disease and elucidating the fundamental signaling processes involved in the development of cardiac hypertrophy and heart failure. Compared to other known experimental models of heart failure to date, the TAC model provides a more reproducible model of human cardiac hypertrophy and a more gradual temporal progression of heart failure (de Almeida et al., JV). IS E XP .2010 Apr 21;(38), the entire contents of which are incorporated into this article).

[0164] Here, 8-week-old male C57BL / 6j or Swiss Webste (CFW) mice (both strains purchased from Charles River's laboratory) underwent TAC surgery, as described by Lee et al., N. ATURE The disclosure described in 519,472-476 (2015) is incorporated herein in its entirety with minor modifications. In summary, mice were anesthetized with buprenorphine (0.1 mg / kg subcutaneously (sc)) and isoflurane 60 minutes prior to intubation. Thoracotomy was performed between the second and third ribs, and the aortic arch was narrowed using a ligation suture over a 27-gauge (G) cannula. Mice were kept in warm cages under direct supervision for 2–4 hours until fully recovered from anesthesia. In sham surgery, only the thoracic cavity was opened, but aortic ligation was not performed. Heart size and function were analyzed by pulsed-wave Doppler echocardiography, followed by TAC / sham surgery, and then euthanasia. Mice were then sacrificed to determine parameters of cardiac hypertrophy and fibrosis, among others. Throughout the experiment, the surgeons were unaware of the treatment groups.

[0165] To assess mRNA and protein expression, mice subjected to TAC and sham surgery were euthanized on days 0, 4, 7, 7, and 21, and their hearts were harvested from the animals. Figure 2A The methods for measuring mRNA expression by qRT-PCR and protein expression by Western blot analysis are the same as those described in Example 1. Figure 2B-2C The study showed that, compared to the hearts of mice that underwent sham surgery, the Pip4k2c protein level in the hearts of TAC mice was significantly decreased 5 days post-surgery. Similarly, Figure 2DThe study showed that, compared with the hearts of mice that underwent sham surgery, the level of Pip4k2c mRNA in the hearts of TAC mice was significantly reduced 5 days after surgery.

[0166] To analyze the distribution of Pip4k2c in different cardiac cells, cardiomyocytes (CMs) and cardiac fibroblasts were isolated from both sham-operated and TAC-operated mice at different time points post-surgery (days 7 and 21). Following previous findings in Magadum et al., C... ELL R ES 27, 1002-1019 (2017) and Sassi et al., N AT C OMMUN The method described in 8,1614 (2017), which uses the standard Langendorff method to isolate mouse cardiomyocytes (CM) and cardiac fibroblasts, is incorporated herein by reference in its entirety. Briefly, the heart was excised, the aorta was cannulated, and buffer A (in mM: 113NaCl, 4.7KCl, 0.6KH₂PO₄, 0.6Na₂HPO₄, 1.2MgSO₄, 12NaHCO₃, 10KHCO₃, 10HEPES, 30Taurine) was infused. For cell dissociation, the buffer contained type II collagenase. After dissociation, the cell suspension was incubated at 37°C for 10 minutes to precipitate the cardiomyocytes. The supernatant and pellet rich in cardiac fibroblasts were then resuspended in buffer B (47.5 ml perfusion buffer A, 2.5 ml FCS, 62.5 ml, 10 μM CaCl2) and centrifuged for 5 minutes (400 x g). The suspension was then resuspended in 5% fetal bovine serum (FCS) Dulbecco modified Eagle medium (DMEM) and plated on 6 cm culture dishes for further study. For CM and / or fibroblast counts, three different counts / samples and three hearts / groups were performed using a hemocytometer, and the average was taken. The total number of CM and / or fibroblasts counted was approximately 150–200 cells / amplitude (10 μl aliquots were taken from the total cell volume obtained after digestion using a wide-bore pipette). Nuclei of the cultured cells were counted using α-actin (CM marker), vimentin (fibroblast marker, green), and Hoechst 33342 or DAPI. For nucleus counting, approximately 1 x 10^6 cells are counted per sample. 3 CMs and / or fibroblasts, using 3-4 independent samples per group. Nucleus counts are plotted as the percentage of CMs and / or fibroblasts counted. Figure 2F-2K ).

[0167] Using the method described in Example 1, the mRNA levels of Pip4k2c in CM and cardiac fibroblasts isolated from sham-operated and TAC-manipulated mice were measured by qRT-PCR at 7 and 21 days post-operation. Figure 2E The study showed that the mRNA level of Pip4k2c was significantly decreased in both CM and fibroblasts after TAC.

[0168] The mRNA level of Pip4k2c was also measured in neonatal rat CM (RNCM) treated with the agonist phenylephrine (PE) (a known drug for inducing CM hypertrophy). This is similar to previous work by Engel et al., C... IRC R ES 85,294-301 (1999) and Magadum et al., C ELL R ES The RNCM isolated from the hearts of 3-day-old (P3) neonatal rats as described in 27,1002-1019 (2017) is incorporated herein by reference in its entirety. Briefly, neonatal rat ventricle RNCM was isolated from 4-day-old Sprague Dawley rats (Jackson) using multiple digestions with 0.14 mg / mL collagenase II. After each digestion, the supernatant was collected in horse serum. The total cell suspension was centrifuged at 300 g for 5 min. The supernatant was discarded, and the cells were resuspended in DMEM medium containing 0.1 mM ascorbic acid, 0.5% insulin-transferrin-selenium (100X), penicillin (100 U / mL), and streptomycin (100 μg / mL). The cells were plated in plastic culture dishes for 90 min until most non-RNCMs adhered to the dish and the RNCMs remained in suspension. The RNCMs were then plated at 1 × 10⁻⁶ cells / mL. 5 Cells / well were seeded in 24-well plates. Isolated RNCMs were incubated in DMEM medium containing 5% horse serum for 48 hours, followed by treatment with phenylephrine (20 μg / ml) or DMSO for 5 days. RNCMs were then harvested for mRNA isolation and qRT-PCR to measure Pip4k2c mRNA expression. Figure 3A ).like Figure 3B The study showed that basal Pip4k2c mRNA expression decreased in neonatal P3 rat CM treated with phenylephrine (PE).

[0169] Pip4k2c was also expressed in neonatal mouse (P8) heart cells isolated and cultured in vitro from cells isolated from mouse hearts, following the method described above for RNCM isolation. Figure 3CAfter 3 days of cell culture, cells were stained with α-actin (CM marker), vimentin (fibroblast marker), and Hoechst 33342 or DAPI for nucleus counting. Figure 3D-3H The results show that Pip4k2c expression is localized in mouse CM.

[0170] Therefore, the data showed that Pip4k2c expression was reduced in the mouse heart after TAC, which was very similar to what was observed in human patients with CH and DCM in Example 1.

[0171] Example 3. Cardiac hypertrophy and fibrosis loss induced in Pip4k2c mice after TAC.

[0172] To investigate the role of Pip4k2c during heart development and in disease, heart development was monitored in germline-deleted Pip4k2c (Pip4k2c- / -) mice. - / - The mice were commercially purchased from Jackson Laboratories (Pip4k2c). tm1b(KOMP)Wtsi To analyze WT or Pip4k2c - / - Heart development in mice, obtaining embryonic mice at the E18 stage ( Figures 4A-4B Embryonic mouse body weight and heart weight were calculated, and images of these mice and their hearts were taken using a bright-field microscope. The data showed that, compared to WT mice, no significant decrease in mouse viability, growth, or heart weight was observed in E18Pip4k2c- / - mice during heart development. Figures 4C-4D ),weight( Figure 4E Heart weight to body weight ratio (HW / BW) Figure 4F ) or number of CMs ( Figure 4G Significant changes in ).

[0173] To analyze the effects of Pip4k2c on CH and fibrosis, the methods described in Example 2 were used to test 8-12 week old wild-type (WT) and Pip4k2c-treated animals. - / - Mice underwent either TAC or sham surgery. WT or Pip4k2c mice were evaluated after sham surgery. - / -Cardiac function in mice was assessed and analyzed after 21 days. In short, left ventricular size and function were evaluated by transthoracic two-dimensional echocardiography (ECHO). Mice were examined on-site using a GE Cares machine (V7R5049) equipped with a 40MHz mouse ultrasound probe. Mice were anesthetized with a mixture of 1-2% isoflurane in air and imaging was performed on days 2 and 28 after LAD ligation. Ejection fraction and shortening fraction were calculated as percentages of diastolic volume (EDV) and end-systolic volume (ESV) on M-mode ultrasound scans. The following formulas were used: Ejection fraction % = (EDV - ESV) / ​​EDV * 100, and shortening fraction % = (End-diastolic left ventricular internal size (LVIDd) - End-systolic left ventricular internal size (LVIDs)) / LVIDd * 100. Echocardiography was performed on 4-10 nine-heart / treatment groups. Figures 5A-5D Data show that, compared to WT mice, Pip4k2c - / - Mice showed deterioration of cardiac function 21 days after TAC. Pip4k2c was observed after TAC. - / - The percentage of ejection fraction (%EF) and percentage of shortening (%FS) were significantly reduced in mice, but the sham-operated WT and Pip4k2c were significantly reduced. - / - No significant changes were observed in mice. Figure 5E and 5H Pip4k2c after TAC - / - The left ventricular end-systolic diameter (LVID) and left ventricular end-diastolic diameter (LVIDd) were significantly increased in mice. Figure 5F-5G ).

[0174] WT / Pip4k2c mice operated on with WT TAC mice or sham-operated mice - / - Compared to mice, Pip4k2c after TAC - / - The heart weight / tibia length (TL) ratio in mice was significantly increased. Figure 6A ), and after TAC, Pip4k2c - / - The hearts of the mice were larger than those of the WT mice. Figure 6B-6E At the end of each experiment, the ratio of heart weight to tibia length was measured using a standard scale. This ratio was calculated as the ratio of heart tissue weight to mouse tibia length—weight in grams (mg) and length in millimeters.

[0175] Hematoxylin and eosin (H&E) staining was also performed to assess WT and Pip4k2c after TAC. - / -Overall morphological changes in mice. To assess cardiac histology, the heart was excised, briefly washed in PBS, perfused with perfusion buffer, weighed, and fixed overnight in 4% PFA (paraformaldehyde) at 4°C. The next day, the heart was washed with PBS and incubated overnight in 30% sucrose. Next, the heart was placed in the optimal cutting temperature compound (OCT compound), frozen, and stored at -80°C. Heart blocks were sectioned transversely or longitudinally at 8–9 μm using a cryostat. Slides were further treated for evaluation using immunostaining (see Example 1) or histological staining using hematoxylin and eosin (H&E) and Sirius red / fast green staining. For H&E staining, longitudinal heart sections frozen with OCT were dried at room temperature for 30 min to 1 h, then hydrated in PBS for 10 min. Slides were held in hematoxylin stain for 2 min and washed with tap water for 5 min. The sections were then placed in eosin solution for 1 min and washed with tap water for 5 min. The slides were transferred to PBS for 5 min. Next, the sections were dehydrated in 100% ethanol for 1 minute and then in xylene for 1 minute. Finally, the sections were fixed under coverslips with VectorShield and images were taken using a bright-field microscope. Figure 6F-6I The H&E staining of these hearts shows Pip4k2c. - / - Mice subjected to sham surgery showed no significant changes after TAC induction, while Pip4k2c... - / - The mouse heart is larger, with a significantly larger cavity size.

[0176] Next, WT and Pip4k2c were measured after TAC by wheat germ lectin (WGA) staining. - / - CM size in mouse heart sections. Briefly, cryopreserved heart sections were dried at room temperature for 30–60 minutes and dehydrated with PBS for 10 minutes. Next, WGA (50 μm) was applied for 1 hour. Sections were washed three times with PBS for 5 minutes each time and then mounted with mounting medium. For CM size quantification, images were captured at 20X or 40X magnification, and the area of ​​each cell was determined using the ImageJ program. Quantitative analysis involved counting multiple regions from 3–6 independent hearts / groups and 3 sections / hearts (~50 cells per evaluation region, ~250 cells per sample total). Images show Pip4k2c under sham-operated manipulation. - / - The size of CM did not change significantly in WT mice. Figures 7A-7C However, 21 days after TAC, in Pip4k2c - / - The size of CM was significantly increased in mice. Figures 7D-7E ).

[0177] WT and Pip4k2c were measured after TAC using the qRT-PCR method described in Example 1. - / -mRNA expression of hypertrophy markers (atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP)), fibrosis markers (Col1a1 (collagen, type I, α1), Col1a2 (collagen, type I, α2), and Col3a1 (collagen, type III, α1)), extracellular matrix proteins (FN1 (fibronectin 1)), TGFβ1 (transforming growth factor β1), and metalloproteinases (MMP2, MMP3, MMP7, and MMP9) in the mouse heart. Comparison with WT TAC model and sham-operated WT or Pip4k2c. - / - Compared to mice, Pip4k2c after TAC - / - The expression of both ANP and BNP was increased in mice. Figures 8A-8B This indicates that Pip4k2c loss induced cardiac hypertrophy after TAC. (Pip4k2c loss after TAC) - / - The mRNA expression of fibrosis markers (Col1a1, Col1a2, and Col3a1), extracellular matrix protein (FN1), TGFβ1, and metalloproteinases (MMP2, MMP3, MMP7, and MMP9) was significantly increased in mice. Figure 8C-8D Importantly, Pip4k2c deletion did not significantly alter the expression of other Pip4k2s (Pip4k2a and Pip4k2b) in the heart. Figure 8E ).

[0178] Next, WT and Pip4k2c were assessed after TAC by Sirius Red / Fixed Green immunostaining of heart sections. - / - Fibrosis in mouse hearts. Briefly, cryopreserved heart sections were dried at room temperature for 1 hour and incubated with Bouin solution at 58°C for 1 hour. The sections were then washed with tap water for 5 minutes to remove yellowing. The sections were stained with 0.1% Fast Green for 20 minutes at room temperature and rinsed with 1% acetic acid for 1 minute at room temperature. Next, the slides were washed with tap water for 5 minutes. The sections were further stained with 0.1% Sirius Red for 30 minutes at room temperature. The slides were dehydrated sequentially by passing them through 70% ethanol for 30 seconds, 100% ethanol for 1 minute, and 100% xylene for 3 minutes. The slides were covered with coverslips using permount mounting medium. Images were taken using a bright-field microscope. Figure 9A-9K The results show that, compared with WT mice after TAC, Pip4k2c - / - Fibrosis was significantly increased in mice; while sham-operated WT or Pip4k2c mice showed significantly increased fibrosis. - / - No significant changes were observed in the mice. Importantly, compared to other treatment groups, Pip4k2c showed improvement after TAC. - / - The survival rate of mice decreased significantly. Figure 10FACS analysis of the distribution of immune cells in the heart of KO-Pip4k2c or WT patients 21 days after MI showed no significant difference in immune cell infiltration into the heart. Figures 31A-31E ).

[0179] To examine the effect of the lack of Pip4k2c expression in CM after TAC injury, CMS were isolated from the hearts of pip4k2c+ / + twin control (WT) or pip4k2c- / - (KO-Pip4k2c) mice 21 days after TAC injury, following the methods described in the examples herein. Figure 11A-11D The isolated mouse CM is shown after immunostaining with the CM sarcoma structural proteins α-actin and troponin T. The size (cross-sectional area) of the isolated CM was evaluated by WGA immunostaining according to the methods described in other embodiments herein. Figure 11E-11F Quantitative analysis of WGA-stained sections showed that the CM area was increased in CM isolated from TAC-treated pip4k2c- / - mice compared to CM isolated from WT mice after TAC. Figure 11G The method disclosed in Example 1 was used to perform qRT-PCR on isolated CMs harvested from WT and pip4k2c- / - mice after TAC to assess the mRNA expression levels of the hypertrophy markers ANP and BNP. Figure 11H The results showed that, compared with CMs isolated from WT mice after TAC, the expression of both ANP and BNP was significantly increased in CMs isolated from pip4k2c- / - mice after TAC.

[0180] In summary, the data indicate that the absence of Pip4k2c during development has no significant impact on heart development, but the absence of Pip4k2c... - / - In adult mice, TAC induces CH and fibrosis, leading to deterioration of cardiac function and causing 70% of mice to die 21 days after TAC.

[0181] Example 4. Pip4k2c modRNA expression in the heart reversed cardiac hypertrophy and fibrosis in a TAC mouse model.

[0182] modRNA is a novel gene expression tool, and its in vitro chemical synthesis, using N1-methylpseudouridine-5'-triphosphate (1-mψU) to 100% replace uridine, results in lower immunogenicity, higher RNase resistance, and more efficient translation in cells and tissues compared to unmodified mRNA (Kariko et al. M). OL T HER16,1833-1840 (2008), the entire contents of which are incorporated herein by reference. Protein expression begins within minutes, peaks at 12 to 48 hours, and persists for 8-12 days in vitro and in mouse hearts (Zangi et al., Nat Biotechnol 31,898-907 (2013); Zangiet al., Circulation 135,59-72 (2017); Magadum et al., Mol Ther Nucleic Acids 13,133-143 (2018), the entire contents of which are incorporated herein by reference).

[0183] To observe the effects of Pip4k2c overexpression on cardiac fibrosis and hypertrophy in a TAC mouse model, chemically modified Pip4k2c modRNA was first generated. An inverse-inverse cap analogue was used. A custom ribonucleotide blend of -O-Me-m7G(5')ppp(5')G (6mM, TriLink Biotechnologies), guanosine triphosphate (1.5mM, Life Technology), adenosine triphosphate (7.5mM, Life Technology), cytidine triphosphate (7.5mM, Life Technology), and N1-methylpseudouridine-5'-triphosphate (7.5mM, TriLink Biotechnologies) was transcribed in vitro from a plasmid template (see Table 2 for a complete list of open reading frame sequences used to prepare modRNA), as previously described in Kondrat et al., M ETHODS M OL B IOL The contents of 1521,127-138 (2017) are incorporated herein in their entirety.

[0184] Table 2: Open reading frame sequences used for modRNA production

[0185]

[0186]

[0187]

[0188] mRNA was purified using the Megaclear kit (Life Technology) and treated with a thermosensitive phosphatase (New England Biolabs), followed by a second purification using the Megaclear kit. mRNA was quantified using Nanodrop (ThermoScientific), precipitated with ethanol and ammonium acetate, and resuspended in 10 mM TrisHCl and 1 mM EDTA.

[0189] In vitro ( Figure 12A ) and in the body ( Figure 12B The chemically modified Pip4k2c modRNA was prepared and expressed. This is similar to what was previously discussed by Sultana et al., M... OL T HER In vivo modRNA transfection is described in 25,1306-1315 (2017). Briefly, a sucrose citrate buffer containing 20 μl sucrose in nuclease-free water (0.3 g / ml) was mixed with 20 μl citrate (0.1 M pH = 7) and 20 μl modRNA of varying concentrations in saline to a total volume of 60 μl. The transfection mixture was injected directly into the myocardium (3 separate injections, 20 μl each). For in vitro transfection, RNAiMAX transfection reagent (Life Technologies) was used according to the manufacturer's recommendations. Figure 12C-12D The results showed that Pip4k2c expression was increased in rat CM after transfection with Pip4k2cmodRNA in vitro compared with transfection with control luciferase (Luc) modRNA.

[0190] Following transarterial chemoembolization (TAC) in WT mice, either luciferase (Luc) or Pip4k2c modRNA was injected, and the protein Pip4k2c in the heart was measured 24 hours after modRNA injection. The biodistribution of modRNA in the mouse heart after TAC was evaluated using Cre recombinase (Cre) modRNA and mTmG mice. Figures 32A-32B This demonstrates that in the TAC model, modRNA delivery of Cre resulted in over 40% LV transfection. A significant increase in Pip4k2c protein expression was observed using Western blot analysis as described in Example 1. Figures 13A-13D As described in Example 3, cardiac function was analyzed using ECHO 21 days after luc or Pip4k2c modRNA injection. Figures 14A-14B In mice following TAC, compared with luc, mice injected with Pip4k2c modRNA showed significantly increased δ% and percentage of left ventricular ejection fraction shortening. Figure 14C14F and 14I). Interestingly, there were no significant changes in the diameter of the left ventricular posterior wall during diastole and systole. Figure 14J and 14K In mice injected with Pip4k2c modRNA after TAC, LVIDd and LVIDs were significantly increased. Figure 14D-14E And 14H-14H). Furthermore, 21 days after TAC, mice injected with Pip4k2cmodRNA showed reduced heart size, indicating a decrease in CH ( Figures 15A-15B Mice injected with Pip4k2c modRNA after TAC showed a significantly reduced HW / TL ratio. Figure 15C WGA staining of heart sections, as described in previous examples, showed a significant reduction in CM size in mice injected with Pip4k2c modRNA. Figures 16A-16C ).

[0191] The mRNA expression of CH markers such as ANP and BNP (as measured by qRT-PCR, as described in Example 1) was significantly decreased. Figure 17A These results confirm that overexpression of Pip4k2c modRNA after TAC reverses cardiac hypertrophy. The mRNA expression of Col1a1, Col1a2, Col3a1, FN1, MMP2, MMP3, MMP7, and MMP9 also decreased significantly. Figure 17B-17C Importantly, TGF-β (a major regulator of fibrosis) was significantly downregulated. Figure 17B Sirius Red / Fixed Green was performed as described in the examples above to evaluate TAC lesions and fibrosis area 21 days after delivery of Luc or Pip4k2c modRNA. Figures 18A-18C The analysis of fibrosis in mice injected with luc or Pip4k2c modRNA after TAC showed a significant decrease in fibrotic area in mice injected with Pip4k2c modRNA. Furthermore, at 21 days post-TAC, the survival rate of mice injected with Pip4k2c modRNA was significantly improved (100% survival compared to 60% survival in mice injected with luc). Figure 19 ).

[0192] To investigate the kinetics of fibroblast proliferation and fibrosis, fibroblasts were harvested from WT or Pip4k2c cells 21 days after TAC. - / - Fibroblasts were isolated from the hearts of mice and cultured using the methods described in previous examples for further processing. Fibroblast number and proliferation were analyzed after 3 days (by pH 3, an immunostaining marker of mitosis). Compared to WT mice after TAC, fibroblasts from Pip4k2c... - / -The number of fibroblasts and the proliferation rate of fibroblasts isolated from mice were significantly higher. Figure 20A-20J Pip4k2c - / - Collagen synthesis and extracellular matrix protein mRNA markers in mouse fibroblasts (measured by qRT-PCR according to the procedure detailed in Example 1) were also significantly upregulated. Figures 21A-21E In vitro, Pip4k2c was treated with a TGF-β inhibitor (SB431542) or Pip4k2c modRNA or transfected with TAC. - / - After mouse fibroblasts were implanted, a significant decrease in the number and proliferation of fibroblasts was observed. Figure 20A-20J Furthermore, the mRNA expression of fibrosis markers (as measured by qRT-PCR) was also downregulated by TGF-β inhibitors or Pip4k2c modRNA. Figures 21A-21E Compared to luc, the number of fibroblasts isolated from the hearts of mice injected with Pip4k2c modRNA was lower at 21 days post-TAC. Similarly, fibroblast proliferation rate and fibrosis markers were also downregulated (data not shown).

[0193] In vitro data showed that inhibition of Pip4k2c induces cardiac fibrosis via the TGF-β pathway, and that overexpression of Pip4k2c modRNA or inhibition of TGF-β by chemical inhibitors reduced fibrosis in the TAC mouse model. These data combined demonstrate that injection of Pip4k2c modRNA in the TAC mouse model significantly reversed cardiac hypertrophy and fibrosis, improved cardiac function, and increased mouse survival.

[0194] Example 5. Pip4k2c regulates cardiac hypertrophy through mTORC1 signal transduction.

[0195] To analyze the Pip4k2c-induced molecular pathway following TAC, protein lysates were first isolated from the hearts of WT or Pip4k2c- / - mice (from sham-operated or TAC-manipulated mice) harvested 21 days post-operation using the methods described in previous examples herein. The lysates were then subjected to Western blot analysis (as described in Example 1) to determine the phosphorylated proteins and total protein expression of molecular targets within the mTORC1 pathway.

[0196] The protein level of P-p70s6k (phosphorylated ribosomal protein S6 kinase β-1 (S6K1)) was significantly increased in Pip4k2c- / - mice after TAC. Figures 22A-22BThe P-p70s6k protein is known to be a marker of the mTORC1 pathway. Increased P-p70s6k kinase response represents hypertrophic activity. Therefore, the data suggest that Pip4k2c negatively regulates the mTORC1 pathway in the heart after TAC.

[0197] Inhibition of the mTORC1 pathway in Pip4k2c- / - mice may provide clues to the role of the mTORC1 pathway in post-TAC CH induced by Pip4k2c. To investigate this, the mTORC1 pathway in Pip4k2c- / - mice was inhibited by administration of rapamycin (a known mTORC1 chemical inhibitor). For rapamycin treatment in these animals, rapamycin solution (50 mg / mL) was diluted in a loading medium [5% (vol / vol) Tween-80, 5% (vol / vol) PEG 400 (polyethylene glycol, molecular weight 400)] in 1×PBS. Rapamycin (3 mg·kg⁻¹·d⁻¹) was administered to mice daily before and after TAC via intravenous injection. Rapamycin was administered before TAC up to 1 week after TAC. Figure 23 ).

[0198] Following the method described in previous embodiments, ECHO was performed on days 0, 7, 14, and 21 after TAC to assess cardiac function. Figures 24A-24B Data showed that, compared with the load, the fractional shortening (cardiac function) in mice treated with rapamycin partially improved over time. Figure 24C Furthermore, both the LVIDd and LVIDs parameters improve partially over time. Figure 24D-24E ). 21 days after TAC, mice treated with rapamycin showed reduced heart size and HW / TL ratio compared to mice treated with the accumulator. Figures 25A-25B In mice treated with rapamycin, the ratio of lung weight to tibia length decreased 21 days after TAC, indicating that rapamycin inhibits the mTORC1 pathway in the TAC mouse model. Figure 25C ).

[0199] WGA staining was performed according to the methods described in the previous examples herein to evaluate the size (cross-sectional area) of the heart (CM) 21 days after TAC injury in the presence of a typtic or rapamycin-treated mouse. The CM size in the heart of rapamycin-treated mice was smaller compared to that of mice treated with a typtic. Figures 26A-26C ).

[0200] Twenty-one days after TAC, hearts were harvested from rapamycin-treated mice treated with the loading apparatus, and RNA was isolated and subjected to qRT-PCT as described in Example 1. ANP, BNP, and TGF-β1 mRNA expression were decreased ( Figure 27A and 27B ).

[0201] Next, following the method described in the previous embodiments, fibrosis in these mice was assessed by Sirius red / Fixed green immunostaining of heart sections. The area of ​​fibrosis in the hearts of mice treated with rapamycin was significantly lower than that in mice treated with a loading apparatus ( Figures 28A-28C ).

[0202] To assess the regulation of TGFβ1 by Pip4k2c, TGFβ1 was evaluated using Western blotting 21 days after TAC. Figure 30A and 30B The results showed that TGFβ1 levels were significantly higher in KO-Pip4k2c mice than in WT and sham-operated WT or KO-Pip4k2c mice, indicating that Pip4k2c negatively regulates the TGFβ1 pathway in the heart after TAC. Overall data suggest that inhibition of the Pip4k2c-induced mTORC1 pathway after TAC, and rapamycin treatment in the heart, partially reversed cardiac function and cardiac hypertrophy in Pip4k2c- / - mice.

[0203] To further investigate the TGFβ1 molecular pathway in KO-Pip4k2c mice undergoing TAC, SB4311542, a potent and selective inhibitor of transforming growth factor-β (TGF-β) type I receptor / ALK5, was administered daily to KO-Pip4k2c mice undergoing TAC. For SB4311542 treatment, a stock solution of SB4311542 (10 mM) was diluted in a loading medium in ethanol. SB4311542 (10 mg / kg / day) was administered intravenously to mice daily for 23 days (from day 2 before TAC to the end of the experiment (day 21)). SB4311542, like rapamycin, partially reduced the adverse effects of KO-Pip4k2c. More specifically, SB4311542 treatment improved cardiac function, such as by a significant increase in FS% at day 21 after TAC compared to KO-Pip4k2c mice treated with the loading medium. Figure 30C-30D And LVIDd and LVIDs Figure 30E-30G The results showed a significant reduction, as confirmed. CF evaluation 21 days after TAC, following SB4311542 or load delivery, revealed that KO-Pip4k2c mice treated with SB4311542 had a smaller ratio of heart weight (HW / TL) to tibia length (or LW / TL) compared to the load. Figure 30H and 30I This was accompanied by a significant decrease in the area of ​​fibrosis (12.5% ​​fibrosis in LV compared to 4%). Figure 30J-30LThese results indicate that SB4311542 delivery in the KO-Pip4k2c heart after TAC can partially compensate for the loss of Pip4k2c, which induces fibrosis via the TGFβ1 pathway.

[0204] To investigate the molecular pathway of Pip4k2c-induced prevention of CF after TAC, mutant Pip4k2c modRNA was prepared, in which the N-terminal motif (VMLLPDD) was replaced by the mutant motif EIFLPNN. Figure 33A This mutation eliminates Pip4k2c's ability to inhibit the mTOR pathway. Pip4k2c was compared to mutant Pip4k2c modRNA using a TAC mouse model. Unlike Pip4k2c, mutant Pip4k2c did not significantly alter cardiac function compared to the Luc control modRNA. Figures 33B-33E ) or CH( Figure 33F In addition, 21 days after TAC, cardiac fibroblasts were isolated from WT or KO-Pip4k2c hearts and sorted (for CD90, fibroblast markers), and treated with DMSO (control) or a TbetaR1 / ALK5 inhibitor (SB431542) or Pip4k2c modRNA or mutant Pip4k2c modRNA. The expression of fibroblast fibrosis markers was evaluated, namely TGFβ1 (2 days after treatment). Figure 33I-33K Total collagen (3 days after treatment) Figure 33L These analyses indicate that, similar to SB431542, Pipk2c inhibits TGFβ1, while the mutant Pip4k2c does not, and its behavior is very similar to that of KO-Pip4k2c cardiac fibroblasts. These findings suggest that Pip4k2c negatively regulates TGFβ1 in cardiac fibroblasts via its N-terminal motif (VMLLPDD), thereby reducing their proliferative and fibrotic activities. Figure 33M and 33N Overall, our data suggest that Pip4k2c modRNA inhibits the mTORC1 pathway in cardiac CM and the TGFβ1 pathway in cardiac fibroblasts after TAC, thereby reducing CH and CF, resulting in better cardiac function and survival after TAC injury.

[0205] Discussion of Examples 1-5

[0206] Examples 1-5 of this paper demonstrate unexpected results showing that Pip4k2c expression is highly regulated in both chronic hemorrhage (CH) and diabetic fibrosis (DCM), and that Pip4k2c deficiency in mice induces CH and fibrosis in mice after transarterial cerebrovascular accident (TAC). Overexpression of Pip4k2c in the heart of a mouse TAC-inducing model reversed cardiac hypertrophy, reversed fibrosis, and improved cardiac function, thereby improving survival in mice with impaired heart function. Pip4k2c deficiency did not lead to any major detrimental phenotypes during cardiac development, cardiac homeostasis, or cardiac function; however, the amount of Pip4k2c protein in the heart decreased with age in mice (data not shown). Recent studies have shown that Pip4k2c- / - mice develop normally, are not protected against obesity, insulin resistance, or diabetes, and instead develop an enhanced immune response.

[0207] The mTOR pathway is a major regulator of protein synthesis, growth, and metabolism, activated after cardiac stress overload and regulated by growth factors, energy levels, cellular stress, and amino acids. In aged mice (over 8 months old), Pip4k2c deletion induces the mTORC1 pathway in immune cells, but does not cause significant differences in undamaged (sham-operated) adult hearts. However, compared to age-matched WT mice, the activation level of mTORC1 in the hearts of 2-month-old Pip4k2c- / - mice after TAC is much higher. This suggests that stress or excessive stress is required to strongly activate the mTORC1 pathway in the hearts of Pip4k2c- / - mice. Inhibiting the mTORC1 pathway with chemicals or drugs to counteract the Pip4k2c- / -TAC mouse phenotype may have side effects, as these are broader chemicals, while mTORC1 gene regulation, particularly at tissue-specific locations, is crucial. Pip4k2c modRNA expression in the heart of mice following TAC has shown beneficial effects on cardiac function and cardiac outcomes—indicating that Pip4k2c modRNA may have a therapeutic benefit for heart disease. Expression of modRNA in the heart provides a safer, transient, controlled, dose-dependent, and flexible approach to gene delivery. Pip4k2c and mTOR proteins are universally expressed in mammalian cells; therefore, the data in Examples 1 through 5 have implications beyond the heart, including the potential therapeutic role of Pip4k2c and Pip4k2c modRNA delivery in hypertrophic and fibrotic diseases and / or in which modulation of Pip4k2c and mTORC1 alterations is involved.

[0208] Here, we demonstrate for the first time the role of Pip4k2c in cardiac fibrosis, characterized by abnormal thickening of the heart valves due to inappropriate fibroblast proliferation and excessive deposition of extracellular matrix in the myocardium. In the heart following transarterial fibrosis (TAC), Pip4k2c deficiency induces significant fibrosis, while fibrosis, fibrosis markers, and TGF-β expression are reduced upon injection of Pip4k2c modRNA into the heart (in vivo) and Pip4k2c- / - fibroblasts (in vitro) and / or by inhibition of the TGF-β pathway with a TGF-β inhibitor. The data in this paper suggest that Pip4k2c can modulate the progression of fibrosis in other fibrotic diseases, and that the administration of Pip4k2c modRNA may also serve as an effective therapeutic approach.

[0209] Figure 29 This study demonstrates how administration of Pip4k2c modRNA significantly attenuates and / or prevents cardiac hypertrophy and fibrosis in failing hearts and improves cardiac function by inhibiting the activity of mTORC1 and TGF-β, two independent signaling pathways activated in heart failure and other heart diseases. ModRNA is a transient, safe, controlled, dose-dependent gene delivery method administered only to the heart to upregulate paracrine factors such as VEGF-A, IGF1, and mutant human FSTL1, for propagating cardiac vascularization, protection, or regeneration after myocardial infarction (MI), but not for targeting diabetic cerebrovascular disease (DCM) or heart failure in patients with chronic heart disease (CH) and fibrosis. The novel gene delivery of Pip4k2c modRNA to the heart and the subsequent induction of cardioprotective effects in a TAC mouse model support the use of modRNA as a gene delivery system for treating heart disease.

[0210] Other implementation methods

[0211] All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be used to replace alternative features for the same, equivalent, or similar purposes. Therefore, unless otherwise expressly stated, each disclosed feature is merely an example of a general series of equivalent or similar features.

[0212] Based on the above description, those skilled in the art can readily determine the essential features of the present invention, and various changes and modifications can be made to the present invention to suit various uses and conditions without departing from the spirit and scope of the invention. Therefore, other embodiments are also within the scope of the claims.

[0213] Equivalent form

[0214] While several inventive embodiments have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing functions and / or achieving results and / or one or more advantages described herein, and each such variation and / or modification is considered to fall within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are exemplary, and actual parameters, dimensions, materials, and / or configurations will depend on one or more specific applications using the teachings of this invention. Those skilled in the art will recognize or be able to identify many equivalent forms of the particular inventive embodiments described herein using only conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented as examples only, and embodiments of the invention may be practiced in ways different from those specifically described and claimed within the scope of the appended claims and their equivalents. The inventive embodiments of this disclosure pertain to each individual feature, system, article, material, kit, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, kits, and / or methods is included within the scope of this disclosure, provided that such features, systems, articles, materials, kits, and / or methods do not contradict each other.

[0215] As defined and used herein, all definitions should be understood to take precedence over dictionary definitions, definitions in referenced and incorporated documents, and / or the conventional meaning of the defined terms.

[0216] All references, patents and patent applications disclosed herein are incorporated by reference to each cited subject, and in some cases, the entire document may be included.

[0217] Unless otherwise expressly stated, the indefinite article “a / an” as used herein in the specification and claims shall be understood to mean “at least one / an”.

[0218] The phrase “and / or” as used in this specification and claims should be understood to mean “one or two” of the elements so combined, that is, elements that exist together in some cases and separately in others. Multiple elements listed with “and / or” should be interpreted in the same way, that is, “one or more” of the elements so combined. Other elements may optionally be present in addition to those specifically specified by the phrase “and / or,” whether related to or unrelated to those specifically specified elements. Thus, as a non-limiting example, when used in conjunction with open-ended language such as “comprising,” a reference to “A and / or B” may refer only to A (optionally including elements other than B) in one embodiment; in another embodiment, only to B (optionally including elements other than A); in yet another embodiment, both A and B (optionally including other elements); and so on.

[0219] As used in the specification and claims herein, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating entries in a list, “or” or “and / or” should be interpreted as inclusive, meaning it includes at least one of the number of elements or the list of elements, but also includes more than one element, and optionally, additional unlisted entries. Only terms that are explicitly stated otherwise, such as “only one” or “just one,” or when used in the claims, “consisting of…”, will refer to including only one of the number of elements or the list of elements. In general, when prefixed with exclusive terms such as “any,” “one of,” “only one of…,” or “just one,” the term “or” as used herein should only be interpreted as indicating an exclusive alternative (i.e., “one or the other but not both”). “Substantially consisting of…” as used in the claims should have the conventional meaning used in the field of patent law.

[0220] As used in the specification and claims herein, when referring to a list of one or more elements, the phrase “at least one” should be understood to mean at least one element selected from one or more elements in the list of elements, but does not necessarily include each and every element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically specified in the list of elements referred to by the phrase “at least one,” whether related to or unrelated to those specifically specified elements. Thus, as a non-limiting example, “at least one of A and B” (or equivalently, “at least one of A or B”, or equivalently, “at least one of A and / or B”) can mean, in one embodiment, at least one, optionally including more than one, A, where B is absent (and optionally including elements other than B); in another embodiment, at least one, optionally including more than one, B, where A is absent (and optionally including elements other than A); in yet another embodiment, at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

[0221] It should also be understood that, unless otherwise expressly stated, in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order of the steps or actions of the stated method. sequence list <110> The Icahn School of Medicine at Mount Sinai <120> Gene delivery system for treating heart failure <130> PPI22170714US <150> US 62 / 933,681 <151> 2019-11-11 <160> 37 <170> PatentIn version 3.5 <210> 1 <211> 1265 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 1 atggcgtcct cctcggtccc accagccacg gtatcggcgg cgacagcagg ccccggccca 60 ggtttcggct tcgcctccaa gaccaagaag aagcatttcg tgcagcaagaa ggtgaaggtg 120 ttccgggcgg ccgacccgct ggtgggtgtg ttcctgtggg gcgtagccca ctcgatcaat 180 gagctcagcc aggtgcctcc cccggtgatg ctgctgccag atgactttaa ggccagctcc 240 aagatcaagg tcaacaatca ccttttccac agggaaaatc tgcccagtca tttcaagttc 300 aaggagtatt gtccccaggt cttcaggaac ctccgtgatc gatttggcat tgatgaccaa 360 gattacttgg tgtcccttac ccgaaacccc cccagcgaaa gtgaaggcag tgatggtcgc 420 ttccttatct cctacgatcg gactctggtc atcaaagaag tatccagtga ggacattgct 480 gacatgcata gcaacctctc caactatcac footcattg tgaagtgcca tggcaacacg 540 cttctgcccc agttcctggg gatgtaccga gtcagtgtgg your account cagctacatg 600 660 ggttccctag tgtcccggga agccagcgat aagaaaagg ttaaagaatt gcccaccctt 720 aaggatatgg actttctcaa caagaaccag aaagtatata ttggtgaaga ggagaagaaa 780 atatttctgg agaagctgaa gagagatgtg gagtttctag tgcagctgaa gatcatggac 840 tacagccttc tgctaggcat ccacgacatc attcggggct ctgaaccaga ggaggaagcg 900 cccgtgcggg aggatgagtc agaggtggat ggggactgca gcctgactgg acctcctgct 960 ctggtgggct cctatggcac ctccccagag ggtatcggag gctacatcca ttcccatcgg 1020 cccctgggcc caggagagtt tgagtccttc attgatgtct atgccatccg gagtgctgaa 1080 ggagcccccc agaaggaggt ctacttcatg ggcctcattg atatccttac acagtatgat 1140 gctaagaaga aagcagctca tgcagccaaa actgtcaagc atggggctgg ggcagagatc 1200 tctactgtcc atccggagca gtatgctaag cgattcctgg attttattac caacatcttt 1260 gccta 1265 <210> 2 <211> 20 <212> DNA <213> Artificial sequence [[ID=*28]]<220> <223> Synthetic sequence <400> 2 ggagactatg gcgtcctcct 20 <210> 3 <211> 20 <212> DNA Note: There seems to be an error in the original text where the tag <220> has an asterisk (*) in the translation. It should be removed as it's not part of the original tag. If this is not a mistake, please clarify. <213> Artificial sequence <220> <223> synthetic sequence <400> 3 ccggaacacc ttcactttct 20 <210> 4 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 4 agtccctgcc ctttgtacac a 21 <210> 5 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 5 gatccgaggg cctcacta 18 <210> 6 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 6 aggaagccga ggttttaact g 21 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 7 aggacgctca taagtgtcac c 21 <210> 8 <211> 19 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 8 ctggcaagaa gggagatga 19 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 9 caccatccaa accactgaaa 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 10 aggtcttcct ggagctgatg 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 11 ccccacaggg ccttctttac 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 12 gtggggtaga gagtgggtca 20 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 13 tgctgtgccc agatgtagag 20 <210> 14 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 14 acagcaaatt cacttacaca gttc 24 <210> 15 <211> 19 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 15 ctcattgcct tgcgtgttt 19 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 16 aggaagccga ggttttaact g 21 <210> 17 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 17 aggaagccga ggttttaact g 21 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 18 cagaacacca gcctcatcaa 20 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 19 gctccttctt cagctcctca 20 <210> 20 <211> 19 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 20 gcttccaggc atattggag 19 <210> twenty one <211> 19 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty one gggggcatga cctcatctt 19 <210> twenty two <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty two aagggtctgg ctgctttg 18 <210> twenty three <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty three cagccaggac ttcctcttaa tg 22 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty four aggacgctca taagtgtcac c 21 <210> 25 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 25 aggaagccga ggttttaact g 21 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 26 gctgccattt ctaataaaga 20 <210> 27 <211> 18 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 27 gcacttcctt tcacaaag 18 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 28 ttgaaggatg gcaagtatgg 20 <210> 29 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 29 cgaaggcatg acctagagtg t 21 <210> 30 <211> 27 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 30 aaggacggcc ttctggcaca cgccttt 27 <210> 31 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 31 gtggtatagt gggacacata gtgg 24 <210> 32 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 32 gagatcaagg ccaatgttcg gagg 24 <210> 33 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 33 cggtagtact tattgcccaa g 21 <210> 34 <211> 17 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 34 cctgtccaaa ctaaggc 17 <210> 35 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequence <400> 35 ggttttctca tagatggcg 19 <210> 36 <211> 3354 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequence <400> 36 atgacggctg cgcaggtgag caccgcttcc gggtcgggct tcggagtcgc ggctagctcc 60 cgcttccact cgctcgggtg cgcgggagac tatggcgtcc tcctccgtcc ctcccgccac 120 cgcacccgcg gcagctggag gccccggccc gggattcggc ttcgcctcca aaaccaagaa 180 gaagcatttc gtacagcaga aagtgaaggt gttccgggcc gcggacccgc tggtgggcgt 240 gttcctgtgg ggcgtcgctc actcgatcaa tgagctcagc caggtaccgc ccccagtgat 300 gttgctgcca gatgacttta aagccagctc caagatcaag gtcaacaatc actttttcca 360 tagagaaaat cttcccagtc atttcaagtt caaggagtat tgtccccagg tcttcaggaa 420 cctgagagat cggtttgcca tcgatgatca cgattacttg gtgtccctta ctcgaagccc 480 cccaagcgaa actgaaggca gtgatggccg tttccttatc tcctatgacc gcactctggt 540 catcaaggaa gtgtcgagcg aagatattgc ggatatgcac agcaacctct ccaactacca 600 ccagtacata gtgaaatgtc atggcaacac gcttctgccc cagttcctgg gcatgtaccg 660 agtcagtgta gaaaatgaag acagctacat gctcgtgatg cgcaatatgt ttagtcatcg 720 tcttcctgtg cataggaagt atgacctcaa gggctctcta gtgtcccggg aagccagcga 780 taaggaaaag gttaaagaac tgccaacact aaaggatatg gactttctta acaagaacca 840 gaaagtgtat attggtgaag aagaaaagaa agtattcctg gagaagctga agcgagatgt 900 ggagtttcta gtgcagctga agatcatgga ctacagcctc ctgttgggca tccacgacat 960 catccggggc tctgaacccg aggaagagg gcctgtgagg gaggaggagt ctgagtggga 1020 tggggactgt aacctggctg gacctcccgc cctggtgggc tcctatggta cctcccctga 1080 gggtatcgga ggctacatcc attcccaccg gccactgggc ccaggagagt ttgagtcctt 1140 catcgatgtc tatgctatcc ggagtgcgga ggggggccccc cagaaggagg tgtatttcat 1200 gggcctcatt gacattctga cacagtatga tgccaagaag aaagcagctc atgcagccaa 1260 gactgtcaag cacggggcgg gggcagagat ctccactgtc catcctgagc agtatgctaa gcgattcctg gactttattg ccaacatctt tgcctaagag gctgcctgac tccagggtga 1380 ttgcggcttt atgttggagg tggcgggttc tgagaggctt aggggagctg gacttggccg 1440 ttacttctct tctttgctaa attcaggctg caggctcctt ccatccaaat aacttccttc tggtggatag ggttttctcg cccaccccag acatacactg tccttctctcc ccttgtccat 1560 ttctctgccc tccctccttg ctcccagtaa gccctcctgc ttctttagag tgttattgtc 1620 gactcttcta agtgccttga tctttgaaaa atatcttgtt tctatgaaat aggaggagct gggggagggg ttgtttgcca tcttcgggac ctgactgaac agtggacttg gctcaagcaa ctgcctggat gcacttttgc tgagtggaag aaactgaatg tctggatttt gctgatactt ttatggggca ctttgtggca tgcttcctcc ctggtaagcc ctggaatgga gggctttcag gatgctccag atgtgggtgc aggcattcac acatggacag tctggcctgg aggtcaggtg gggagtggtc agcaggctgg cacctcacaa ggcaggacct aagcctaagc ggacttttgt gactatgcag atgatggaga aggtccctgt ggagcaacga ctgttcccga ctgttcccgt 2040 tctcccaccc caccccaccc cacgtccacc tctttctgtg agcactttgg gtgcaggagc 2100 ccagaggcta gcggtgcccg agcttaggtg caggtgtgag actcgggctg ctcttcccac 2160 aaccctgtgc cttgctggtg agcagggaga gcagtagagg ccgggacagg tcggagtgca 2220 gggttcattg cctgggtgac accctttctt cctgtctcac tactcctggg cttctttcta 2280 gcagagggga acagtaccat ctccataatt tggggaggat agagctctcg agtgaaggag 2340 cctccgcatc cctggggcat gtgtacctag aactccccct ccttctcaaa accctttctg 2400 gttggagttg ttattctgtc ccatcttcca ctgctaatgt gtctcccagg ggacagatgg 2460 ccttctttgt catctcccct ctccgccccc agagaggagt cagagccata actcaatcca 2520 cccagtcctc tccaaagaca gctgaatatt aatgcacgcc atcctcagaa tggagaggac 2580 ctgctaggca tcttagctct cccagctcgt gcctgtaaag ccagcactca ggaggctctg 2640 agagttcaag tccagcctgg gctactgagt gagacctggt ctcaggaaca ctccaaatag 2700 gtttgggttt gagcgctgga gatcatagct gagttggtag tgtgcttgcc tagcatgtac 2760 aaagctctgg gatccacccc cagcaccact taagccaggc gtggcggtgc acgcctgcac 2820 tcctggccct gggaagtagt ggtaagcagg atggggcatt caaggtcatc gccagttagt 2880 tacttgacga ggttgaggcc agccaaggaa acaggagacc atcttgggga aaatgattct 2940 aaggagagat agattgtctt tgtctctgcc taaagccttt ggaagcaagc cactcatctt 3000 cgctgtttgg cgctctggag gtggggtggg cattgaaggc aaggagctgc tttgctgtgt 3060 gtccatgagg tcctcaggga gaagcccacc tccctcacca aaggaagcag caagatgggt 3120 gcccggttgg ggtgggtggg acctgctgag tctcccatcc ctcaagcaac ctttcccctg 3180 ttgaatgcaa taagtgactc cggtccctta acaactgggg tctcaccgtg cggctgtggt 3240 cgtgggcagt gttgccatct tcacttactg cttccgtttt ccatctgttt tgttaataaa 3300 atatgtatat ttactcccga tatcacaata aaataaatta tttgatctaa gtca 3354<0001​​​​​​​​​ <223> Synthetic sequence <400> 37 atggccgatg ctaagaacat taagaagggc cctgctccct tctaccctct ggaggatggc 60 accgctggcg agcagctgca caaggccatg aagaggtatg ccctggtgcc tggcaccatt 120 gccttcaccg atgcccacat tgaggtggac atcacctatg ccgagtactt cgagatgtct 180 gtgcgcctgg ccgaggccat gaagaggtac ggcctgaaca ccaaccaccg catcgtggtg 240 tgctctgaga actctctgca gttcttcatg ccagtgctgg gcgccctgtt catcggagtg 300 gccgtggccc ctgctaacga catttacaac gagcgcgagc tgctgaacag catgggcatt 360 tctcagccta ccgtggtgtt cgtgtctaag aagggcctgc agaagatcct gaacgtgcag 420 aagaagctgc ctatcatcca gaagatcatc atcatggact ctaagaccga ctaccagggc 480 ttccagagca tgtacacatt cgtgacatct catctgcctc ctggcttcaa cgagtacgac 540 ttcgtgccag agtctttcga cagggacaaa accattgccc tgatcatgaa cagctctggg 600 tctaccggcc tgcctaaggg cgtggccctg cctcatcgca ccgcctgtgt gcgcttctct 660 cacgcccgcg accctatttt cggcaaccag atcatccccg acaccgctat tctgagcgtg 720 gtgccattcc accacggctt cggcatgttc accaccctgg gctacctgat ttgcggcttt 780 cgggtggtgc tgatgtaccg cttcgaggag gagctgttcc tgcgcagcct gcaagactac 840 aaaattcagt ctgccctgct ggtgccaacc ctgttcagct tcttcgctaa gagcaccctg 900 atcgacaagt acgacctgtc taacctgcac gagattgcct ctggcggcgc cccactgtct 960 aaggaggtgg gcgaagccgt ggccaagcgc tttcatctgc caggcatccg ccagggctac 1020 ggcctgaccg agaaccag cgccattctg attaccccag agggcgacga caagcctggc 1080 gccgtgggca aggtggtgcc attcttcgag gccaaggtgg tggacctgga caccggcaag 1140 accctgggag tgaaccagcg cggcgagctg tgtgtgcgcg gccctatgat tatgtccggc 1200 tacgtgaata accctgaggc caaacgcc ctgatcgaca aggacggctg gctccactct 1260 ggcgacattg cctactggga cgaggacgag cacttcttca tcgtggaccg cctgaagtct 1320 ctgatcaagt acaagggcta ccaggtggcc ccagccgagc tggagtctat cctgctgcag 1380 caccctaaca ttttcgacgc cggagtggcc ggcctgcccg acgacgatgc cggcgagctg 1440 cctgccgccg tcgtcgtgct ggaacacggc aagaccatga ccgagaagga gatcgtggac 1500 tatgtggcca gccaggtgac aaccgccaag aagctgcgcg gcggagtggt gttcgtggac 1560 gaggtgccca agggcctgac cggcaagctg gacgcccgca agatccgcga gatcctgatc 1620 aaggctaaga aaggcggcaa gatcgccgtg taa 1653

Claims

1. Use of a modified mRNA in the preparation of a medicament for treating heart failure in a subject, wherein the modified mRNA encodes type 2 phosphatidylinositol-5-phosphate 4-kinase γ, and wherein the modified mRNA is a modRNA.

2. Use according to claim 1, wherein, The use includes administering the modified mRNA to the heart tissue of the subject and, after the administration, increasing the gene expression of phosphatidylinositol-5-phosphate 4-kinase γ.

3. The use according to claim 2, wherein, One day after administration, the gene expression of phosphatidylinositol-5-phosphate 4-kinase γ increased to at least 5-fold.

4. The use according to claim 3, wherein, In the heart tissue of subjects who require this, the level is increased to at least 5 times and sustained for at least 8 days.

5. The use according to claim 1, wherein, The use includes administering the modified mRNA to the heart tissue of the subject and, after the administration, inhibiting the activity of mammalian target of rapamycin complex 1, transforming growth factor β, or a combination thereof.

6. The use according to claim 5, wherein, Following administration, mammalian target of rapamycin complex 1 and transforming growth factor β were inhibited.

7. The use according to claim 1, wherein, The intended use includes administering the modified mRNA to the heart tissue of the subject and, compared with an untreated subject having the same disease condition and predicted outcome, the administration increases life expectancy by at least 10%.

8. The use according to claim 1, wherein, The use includes administering the modified mRNA to the heart tissue of the subject and, compared with an untreated subject having the same disease condition and predicted outcome, the administration resulted in an improvement in heart function of at least 10%.

9. The use according to claim 1, wherein, The use includes administering the modified mRNA to the heart tissue of the subject and, compared with an untreated subject having the same disease condition and predicted outcome, the administration reduces cardiac fibrosis by at least 5%.

10. The use according to claim 1, wherein, The use includes administering the modified mRNA to the heart tissue of the subject and, compared with an untreated subject having the same disease condition and predicted outcome, the administration reverses cardiac hypertrophy by at least 10%.

11. The use according to claim 1, wherein, The stated purpose is to treat dilated cardiomyopathy.

12. Use of a gene delivery system in the preparation of a medicament for treating heart failure, wherein the system comprises a modified mRNA encoding phosphatidylinositol type 2 phosphokinase γ, said modified mRNA being a modRNA.

13. The use according to claim 12, wherein, The modified mRNA encoding type 2 phosphatidylinositol-5-phosphate 4-kinase γ was locally applied to cardiac tissue.

14. The use according to claim 13, wherein, The modified mRNA encoding phosphatidylinositol-5-phosphate 4-kinase γ was locally applied to cardiac tissue to increase the expression of phosphatidylinositol-5-phosphate 4-kinase γ.

15. The use according to claim 13, wherein, The modified mRNA encoding type 2 phosphatidylinositol-5-phosphate 4-kinase γ inhibits mammalian target of rapamycin complex 1, transforming growth factor β, or a combination thereof in cardiac tissue.

16. The use according to claim 12, wherein, The gene delivery system further includes a delivery agent.

17. The use according to claim 16, wherein, The delivery agent targets cardiac tissue.

18. The use according to claim 12, wherein, The drug is formulated for intracardiac injection.

19. The use according to claim 12, wherein, The drug is used to treat dilated cardiomyopathy.

20. The use according to claim 1, wherein, When the modified mRNA is applied topically to the heart tissue of a subject in need, it does not elicit an immune response compared to exogenous RNA; and, Gene expression of phosphatidylinositol-5-phosphate 4-kinase γ increased after at least one administration.

21. The use according to claim 20, wherein, The topical application should be performed at least once every 20 days.

22. The use according to claim 20, wherein, Life expectancy increased by at least 40% 20 days after a single topical application compared to untreated subjects with the same disease symptoms and predicted outcomes.

23. The use according to claim 20, wherein, The treatment is for dilated cardiomyopathy.

Images