An aldehyde oxidase mutant and its application in the synthesis of crotonic acid
By directing the evolutionary modification of aldehyde oxidase from Methylobacillus sp. MM3, an aldehyde oxidase mutant was constructed, which solved the problem of insufficient enzyme activity in the catalytic production of crotonic acid from aldehyde oxidase, and achieved a significant improvement in enzyme activity and efficient production of crotonic acid.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANGHAI HANHONG SCI CO LTD
- Filing Date
- 2022-05-12
- Publication Date
- 2026-05-29
AI Technical Summary
Existing methods for preparing crotonic acid from aldehyde oxidases have insufficient enzyme activity, making it difficult to meet the needs of industrial applications.
By directing the evolution of wild-type aldehyde oxidase from the genus Methylobacillus sp. MM3, mutating its 80th amino acid to valine or its 143rd amino acid to threonine, an aldehyde oxidase mutant was constructed. A recombinant vector and recombinant genetically engineered bacteria were then constructed to catalyze the preparation of crotonic acid from crotonaldehyde.
The modified aldehyde oxidase mutant significantly improved enzyme activity. The single-point mutant enzyme activity increased to 59.7 U/L and 48.9 U/L, while the two-point combination mutant enzyme activity increased to 80.5 U/L. The substrate conversion rate reached 96%, and the crotonic acid concentration reached 79 g/L.
Smart Images

Figure RE-GDA0003785230030000021
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosynthesis technology, specifically to an aldehyde oxidase mutant and its application in crotonic acid synthesis. Background Technology
[0002] Crotonic acid, also known as 2-butenoic acid, is an unsaturated fatty acid and a very important fine chemical intermediate, widely used in hairspray, bactericides, synthetic resins, and plasticizers. Currently, the typical production method for crotonic acid both domestically and internationally is the selective oxidation of crotonaldehyde, with catalysts generally consisting of precious metals, metal oxides, or strong acids. Compared to traditional chemical catalysis, biocatalysis offers advantages such as high selectivity, mild reaction conditions, environmental friendliness, and lower equipment requirements. With increasing environmental concerns, green and environmentally friendly biocatalysis has greater development potential.
[0003] However, research on aldehyde oxidases catalyzing the synthesis of crotonic acid from crotonaldehyde is still insufficient. Aldehyde oxidases (EC1.2.3.1) catalyze the oxidation of various aldehyde groups to generate the corresponding carboxylic acids, and are potential biocatalysts for the synthesis of crotonic acid and its derivatives from crotonaldehyde, possessing advantages such as mild reaction conditions, convenient process operation, and environmentally friendly operation. Summary of the Invention
[0004] The purpose of this invention is to modify the aldehyde oxidase gene using a directed evolution method, thereby increasing the enzyme activity of the modified aldehyde oxidase against crotonaldehyde, so that it meets the requirements for industrial application in the catalytic production of crotonic acid.
[0005] This invention provides an aldehyde oxidase mutant, which is obtained by single or double mutation of the amino acid sequence (SEQ ID NO.2) of wild-type aldehyde oxidase from the genus Methylobacillus sp. MM3, by mutating alanine at position 80 to valine or lysine at position 143.
[0006] Specifically, one of the mutants involves mutating valine at position 80 of the amino acid sequence shown in SEQ ID NO.2 to alanine, resulting in the amino acid sequence of the mutant aldehyde oxidase shown in SEQ ID NO.3. The other mutant involves mutating lysine at position 143 to threonine, resulting in the amino acid sequence of the mutant aldehyde oxidase shown in SEQ ID NO.4.
[0007] Furthermore, the 143rd lysine of the amino acid sequence shown in SEQ ID NO.3 was mutated to threonine to obtain a two-point combination mutant, and the amino acid sequence of the mutant aldehyde oxidase is shown in SEQ ID NO.5.
[0008] The present invention also relates to a recombinant vector constructed from the aldehyde oxidase mutant.
[0009] This invention provides a recombinant genetically engineered bacterium prepared by transformation of the recombinant vector.
[0010] Furthermore, this invention also provides an application of the aforementioned aldehyde oxidase mutant in the preparation of crotonic acid from crotonaldehyde. The wet bacterial cells obtained by inducing culture of recombinant engineered bacteria containing the aldehyde oxidase mutant encoding gene are used as the enzyme source, exogenous crotonaldehyde is used as the substrate, and a pH 7.5 PB buffer is used as the reaction medium to carry out the hydrolysis reaction. The reaction equation is as follows:
[0011]
[0012] Furthermore, in the above technical solution, the hydrolysis reaction is carried out under water bath temperature control and magnetic stirring conditions.
[0013] Further, in the above technical solution, the wet bacterial cells are prepared as follows: Genetically engineered bacteria containing the relevant bacteria are inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking for 12 h. The culture is then transferred to 500 mL of fresh LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking until the OD600 reaches 0.75-0.85. IPTG is then added to a concentration of 0.5 mM, and the culture is induced at 28°C for 16-18 h. After the culture is complete, the culture solution is centrifuged at 4000 rpm for 10 min, the supernatant is discarded, the bacterial cells are collected, and stored in a -70°C ultra-low temperature freezer for later use.
[0014] Beneficial effects of the invention
[0015] The catalytic activities of the single-point mutant aldehyde oxidases ALODase-A80V (amino acid sequence SEQ ID NO.2) and ALODase-K143T (amino acid sequence SEQ ID NO.3) were significantly improved compared with the wild-type enzyme activity (20 U / L), reaching 59.7 U / L and 48.9 U / L, respectively; the enzyme activity of the two-point combined mutant aldehyde oxidase ALODase-A80V / K143T (amino acid sequence SEQ ID NO.4) was increased by 4 times compared with the wild-type, reaching 80.5 U / L. Detailed Implementation
[0016] Unless otherwise specified, all experimental methods used in this invention are conventional. For specific gene cloning procedures, please refer to *Molecular Cloning: A Laboratory Manual*, edited by J. Sambrook et al. The recombinant *Escherichia coli* BL21(DE3) expressing the enzyme gene involved in this invention, and the pET-30a vector used, were purchased from TAKARA. Reagents used in the downstream catalytic process: Crotonaldehyde, purchased from Aladdin Chemical Reagent Co., Ltd.; other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. The three-letter or single-letter expression of amino acids used in this application follows the amino acid codes specified by IUPAC (Eur. J. Biochem., 138:9-37, 1984).
[0017] The formation of crotonic acid during the process was detected by high performance liquid chromatography (HPLC). The HPLC system was an Agilent 1260; the column model was an Agilent HC-C18(2), 5μm, 4.6mm×250mm; the mobile phase was 0.5% acetic acid solution: acetonitrile = 12:88; the detection wavelength was 215nm; the flow rate was 1.0mL / min; and the column temperature was 30℃.
[0018] Example 1
[0019] I. Construction of wild-type aldehyde oxidase recombinant expression strain
[0020] Beijing Qingke Xinyue Biotechnology Co., Ltd. was commissioned to provide codon optimization and gene synthesis services. The wild-type aldehyde oxidase (ALOD) gene from *Methylobacillus* sp. MM3 was synthesized, with the gene sequence shown in SEQ ID NO. 1 and the amino acid sequence shown in SEQ ID NO. 2. This gene was cloned into the restriction enzyme sites EcoRI and HindIII on the pET-30a(+) plasmid to obtain the pET-30a(+)-ALODase recombinant plasmid. The recombinant plasmid pET-30a(+)-ALODase was transfected into the host *Escherichia coli* BL21(DE3) to obtain the recombinant genetically engineered bacterium *E. coli* BL21(DE3)-pET-30a(+)-ALODase.
[0021] The genetically engineered strain E. coli BL21(DE3)-pET-30a(+)-ALODase was activated and cultured using LB medium. The specific formulation of LB medium was: 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl, dissolved in deionized water and brought to a final volume. The medium was then sterilized at 121°C for 20 min and set aside for use.
[0022] The solid culture medium is LB medium with 2% agar added.
[0023] The activation and culture protocol was as follows: A glycerol tube containing the engineered strain *E. coli* BL21(DE3)-pET-30a(+)-ALODase was streaked onto an LB agar plate (containing 50 μg / mL kanamycin) and incubated at 37°C for 12 h. A single colony was picked from the plate and inoculated into 5 mL of LB agar containing 50 μg / mL kanamycin, and incubated at 37°C and 200 rpm for 12 h. After obtaining the culture medium, plasmids were extracted according to the instructions of the plasmid extraction kit.
[0024] II. Construction of aldehyde oxidase mutant expression strains
[0025] Using the pET-30a(+)-ALODase plasmid extracted in step one as a template, site-directed mutations were introduced into the ALODase gene by whole plasmid PCR. The primers and PCR reaction systems used are shown in Table 1 and Table 2, respectively.
[0026] Table 1 Primers used for PCR
[0027] Primers Sequence (5'-3') ALKO-F1 AGGTGGTGATTGTGACCAAATTTGGCTTTGATCTGGATCCGGCGA ALKO-R1 GCCAAATTTGGTCACAATCACCACCTGGCCTTTAAACGGCACCAGC ALKO-F2 CGGGCGCGGTGACAGAACTGATTGCGGAAGGCAAAGTGAAACATTT ALKO-R2 CGCAATCAGTTTCTGTCACCGCGCCCGCCACATCTTCAATCGGCACG
[0028] Table 2 PCR amplification system
[0029] Components Volume (μL) PrimeSTAR 25.0 upstream primer 1.0 Downstream primer 1.0 plasmid template 0.5 ddH2O 22.5
[0030] Using pET-30a(+)-ALODase plasmid as a template, point mutation PCR was performed using the primers shown in Table 1. The PCR amplification system is shown in Table 2. PCR amplification conditions:
[0031] PCR amplification conditions:
[0032] 1) Pre-denaturation: 94℃ for 5 min;
[0033] 2) Denaturation: 94℃ for 10s; Annealing: 60℃ for 15s; Extension: 72℃ for 1min; 30 cycles in total;
[0034] 3) Extension: 72℃ for 10 minutes;
[0035] 4) Store at 4℃ for 1.0 h.
[0036] The single-point mutant pET-30a(+)-ALODase-A80V was obtained by amplification using the ALKO-F1 and ALKO-R1 primer pairs.
[0037] The single-point mutant pET-30a(+)-ALODase-K143T was obtained by amplification using the ALKO-F2 and ALKO-R2 primer pairs.
[0038] The double mutant pET-30a(+)-ALODase-A80V / K143T was obtained by amplification using two primer pairs: ALKO-F1, ALKO-R1 and ALKO-F2, ALKO-R2.
[0039] After PCR amplification, the amplification products were detected by 1.0% agarose gel electrophoresis, and the target band was purified and recovered using a DNA recovery and purification kit.
[0040] Table 3 Digestive System
[0041] reagents Volume (μL) PCR amplification products / plasmids 25μL DPNI 1μL 10×Buffer 2μL
[0042] Digestion conditions:
[0043] 1) 37℃: 1h;
[0044] 2) 85℃: 15min;
[0045] 3) Store at 4℃ for 2.0h.
[0046] The digested products were transformed into E. coli BL21(DE3) competent cells, and then sequenced by Beijing Qingke Xinyue Biotechnology Co., Ltd. The plasmids containing the correct sequencing results were expressed to obtain recombinant strains. Finally, the single-point mutant aldehyde oxidase ALO Dase-A80V (amino acid sequence SEQ ID NO.3) and ALODase-K143T (amino acid sequence SEQ ID NO.4) were obtained, and their expression strains were E. coli BL21(DE3)-pET-30a (+)-ALODase-A80V and E. coli BL21(DE3)-pET-30a(+)-ALODase-K143T, respectively.
[0047] Then, plasmid pET-30a(+)-ALODase-A80V was extracted and used as a template. Whole-plasmid PCR was performed using ALKO-F2 and ALKO-R2 primers to introduce a site-directed mutation into the ALODase-A80V gene, following the same procedure as the previous single-point mutation. The resulting aldehyde oxidase mutant ALODase-A80V / K143T with a two-point combination mutation was obtained. Its amino acid sequence is shown in SEQ ID NO. 5, and its expression strain is E. coli BL21(DE3)-pET-30a(+)-ALODase-A80V / K143T.
[0048] Example 2
[0049] I. Cultivation of engineered bacteria
[0050] The engineered bacteria containing the relevant gene were inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking for 12 h. The culture was then transferred to 500 mL of fresh LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking until the OD600 reached approximately 0.8. IPTG was then added to a concentration of 0.5 mM, and the culture was induced at 28°C for 16-18 h. After culturing, the culture was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, and the bacterial cells were collected and stored at -70°C for later use.
[0051] II. Determination of Enzyme Activity
[0052] After the culture was completed, the collected bacterial cells were washed twice with 0.25M PB buffer (pH=7.5). Then, the bacterial cells were resuspended in 2 times the fermentation broth volume of 0.25M PB buffer (pH=7.5), and the cells were sonicated to obtain crude enzyme solution for subsequent assays.
[0053] Enzyme activity definition: The 1961 International Enzyme Conference defined one unit of enzyme activity as the amount of enzyme that can convert 1 micromolar of substrate in 1 minute under specific conditions, or the amount of enzyme that can convert 1 micromolar of related groups in the substrate.
[0054] Aldehyde oxidase activity assay system: The total system volume was 5 mL. The reaction medium was pH 7.5 0.25 M phosphate buffer. The substrate was 4320 μL of 10 g / L crotonaldehyde. 430 μL of crude enzyme solution was added, and the reaction was carried out at 40 °C for 5 min. Then, 250 μL of 4 mol / L hydrochloric acid was added to terminate the reaction. 1 mL of the reaction solution was taken, centrifuged at 12000 rpm for 3 min, and the supernatant was analyzed by high performance liquid chromatography.
[0055] The results of the enzyme activity assays of wild-type and mutant aldehyde oxidases showed that the enzyme activities of the single-point mutant aldehyde oxidases ALODase-A80V and ALODase-K143T were significantly increased compared with the wild-type enzyme activity (20 U / L), reaching 59.7 U / L and 48.9 U / L, respectively; the enzyme activity of the two-point mutant aldehyde oxidase ALODase-A80V / K143T was nearly 4 times higher than that of the wild-type, reaching 80.5 U / L.
[0056] Example 3
[0057] Genetically engineered bacteria catalyze the production of crotonic acid from crotonaldehyde.
[0058] Fermentation broth of the genetically engineered E. coli BL21(DE3)-pET-30a(+)-ALO Dase-A80V constructed in Example 1 was collected by centrifugation at 4000 rpm / 10 min. 0.5 g of wet cells were weighed and resuspended in 30 mL of 0.25 M phosphate buffer (pH = 7.5) to disrupt the cells, obtaining crude enzyme solution which was added to a 50 mL round-bottom flask. 2.0 g of crotonaldehyde was weighed and added to the flask. A magnetic stirrer was turned on, and the reaction was carried out at 30 °C in a water bath. The pH was controlled at 7.5 using 4 M NaOH, and a trace amount of air was introduced. After 12 h of reaction, the contents of crotonaldehyde and crotonic acid in the reaction system were detected by liquid chromatography. The substrate conversion rate was 85%, and the crotonic acid concentration was 69.6 g / L.
[0059] Example 4
[0060] Genetically engineered bacteria catalyze the production of crotonic acid from crotonaldehyde.
[0061] Fermentation broth of the genetically engineered E. coli BL21(DE3)-pET-30a(+)-ALO Dase-K143T constructed in Example 1 was collected by centrifugation at 4000 rpm / 10 min. 0.5 g of wet cells were weighed and resuspended in 30 mL of 0.25 M phosphate buffer (pH = 7.5) to break the cells, and the crude enzyme solution was added to a 50 mL round-bottom flask. 2.0 g of crotonaldehyde was weighed and added to the flask. A magnetic stirrer was turned on, and the reaction was carried out at 35 °C in a water bath. The pH was controlled at 7.5 using 4 M NaOH, and a trace amount of air was introduced. After 17 h of reaction, the contents of crotonaldehyde and crotonic acid in the reaction system were detected by liquid chromatography. The substrate conversion rate was greater than 91%, and the crotonic acid concentration was 75 g / L.
[0062] Example 5
[0063] Genetically engineered bacteria catalyze the production of crotonic acid from crotonaldehyde.
[0064] Fermentation broth of the genetically engineered E. coli BL21(DE3)-pET-30a(+)-ALODase-A80V / K143T constructed in Example 1 was collected by centrifugation at 4000 rpm / 10 min. 0.5 g of wet cells were weighed and resuspended in 30 mL of 0.25 M phosphate buffer (pH = 7.5) to lyse the cells, obtaining crude enzyme solution which was added to a 50 mL round-bottom flask. 2.0 g of crotonaldehyde was weighed and added to the flask. A magnetic stirrer was turned on, and the reaction was carried out at 30 °C in a water bath for hydrolysis. The pH was controlled at 7.5 using 4 M NaOH, and a trace amount of air was introduced. After 24 h of reaction, the contents of crotonaldehyde and crotonic acid in the reaction system were detected by liquid chromatography. The substrate conversion rate was 96%, and the crotonic acid concentration was 79 g / L.
[0065] Comparative Example 1
[0066] The fermentation broth of the genetically engineered E. coli BL21(DE3)-pET-30a(+)-ALOD ase constructed in Example 1 was centrifuged at 4000 rpm for 10 min to collect the cells. 0.5 g of wet cells were weighed and resuspended in 30 mL of 0.25 M phosphate buffer (pH = 7.5) to lyse the cells, obtaining a crude enzyme solution which was added to a 50 mL round-bottom flask. 2.0 g of crotonaldehyde was weighed and added to the flask. A magnetic stirrer was turned on, and the reaction was carried out at 35 °C in a water bath for hydrolysis. The pH was controlled at 7.5 using 4 M NaOH, and a trace amount of air was introduced. After 24 h of reaction, the content of the corresponding products in the reaction system was detected by liquid chromatography. The conversion rate was 21.2%, and the concentration of crotonic acid was 18 g / L.
[0067] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. sequence list <110> Shanghai Hanhong Technology Co., Ltd. <120> An aldehyde oxidase mutant and its application in crotonic acid synthesis <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 993 <212> DNA <213> Methylobacillus flagellatum <400> 1 atgaaaaacc gcaccctggg caacagcggc ctggaagtga gcgcgctggg cctgggctgc 60 atgagcatga gcagcgcgta tggcccggcg ggcgataaaa ccgaaatgat tgcgctgatt 120 cgccgcgcgg tggatctggg cgtgaccctg tttgataccg cggaagtgta tggcccgttt 180 gtgaacgaag aactgctggg cgaagcgctg gtgccgttta aaggccaggt ggtgattgcg 240 accaaatttg gctttgatct ggatccggcg accgcgcagc gcaccggcgg cgtgaacagc 300 cgcccggaac atattaaagc ggtggcggaa gcgagcctga aacgcctgaa agtggatgcg 360 attgatctgc tgtatcagca tcgcgtggat ccgggcgtgc cgattgaaga tgtggcgggc 420 gcggtgaaag aactgattgc ggaaggcaaa gtgaaacatt ttggcctgag cgaaccgggc 480 attgaaaccg tgcgccgcgc gcatgcggtg cagccggtga ccgcggtgca gagcgaatat 540 agcctgtggt ggcgcggccc ggaaaccgaa ctgctgccga ccctggaaga actgggcatt 600 ggctttgtgc cgtttagccc gctgggcgcg ggctttctga ccggcaaaat ggatgaaaac 660 acccgctttg atagcagcga ttttcgcagc caggtgccgc gctttagccc ggatgcgctg 720 aaagcgaacg tggcgctggt ggcgctgatt cgcgaagtgg cggaaaccaa aggcgcgacc 780 ccggcgcaga ttgcgctgag ctggctgctg gcgcagaaac cgtggattgt gccgattccg 840 ggcaccacca aactgcatcg cctggaagaa aacctgggcg cggtggcgat tgaactgacc 900 gcggatgatc tgcagcgcat tgcgagcgcg gcgagcaaac tgcatctgga aggcgcgcgc 960 ctgccggaat atgcgctgaa aatgaccggc ctg 993 <210> 2 <211> 331 <212> PRT <213> Methylobacillus flagellatum <400> 2 Met Lys Asn Arg Thr Leu Gly Asn Ser Gly Leu Glu Val Ser Ala Leu 1 5 10 15 Gly Leu Gly Cys Met Ser Met Ser Ser Ala Tyr Gly Pro Ala Gly Asp 20 25 30 Lys Thr Glu Met Ile Ala Leu Ile Arg Arg Ala Val Asp Leu Gly Val 35 40 45 Thr Leu Phe Asp Thr Ala Glu Val Tyr Gly Pro Phe Val Asn Glu Glu 50 55 60 Leu Leu Gly Glu Ala Leu Val Pro Phe Lys Gly Gln Val Val Ile Ala 65 70 75 80 Thr Lys Phe Gly Phe Asp Leu Asp Pro Ala Thr Ala Gln Arg Thr Gly 85 90 95 Gly Val Asn Ser Arg Pro Glu His Ile Lys Ala Val Ala Glu Ala Ser 100 105 110 Leu Lys Arg Leu Lys Val Asp Ala Ile Asp Leu Leu Tyr Gln His Arg 115 120 125 Val Asp Pro Gly Val Pro Ile Glu Asp Val Ala Gly Ala Val Lys Glu 130 135 140 Leu Ile Ala Glu Gly Lys Val Lys His Phe Gly Leu Ser Glu Pro Gly 145 150 155 160 Ile Glu Thr Val Arg Arg Ala His Ala Val Gln Pro Val Thr Ala Val 165 170 175 Gln Ser Glu Tyr Ser Leu Trp Trp Arg Gly Pro Glu Thr Glu Leu Leu 180 185 190 Pro Thr Leu Glu Glu Leu Gly Ile Gly Phe Val Pro Phe Ser Pro Leu 195 200 205 Gly Ala Gly Phe Leu Thr Gly Lys Met Asp Glu Asn Thr Arg Phe Asp 210 215 220 Ser Ser Asp Phe Arg Ser Gln Val Pro Arg Phe Ser Pro Asp Ala Leu 225 230 235 240 Lys Ala Asn Val Ala Leu Val Ala Leu Ile Arg Glu Val Ala Glu Thr 245 250 255 Lys Gly Ala Thr Pro Ala Gln Ile Ala Leu Ser Trp Leu Leu Ala Gln 260 265 270 Lys Pro Trp Ile Val Pro Ile Pro Gly Thr Thr Lys Leu His Arg Leu 275 280 285 Glu Glu Asn Leu Gly Ala Val Ala Ile Glu Leu Thr Ala Asp Asp Leu 290 295 300 Gln Arg Ile Ala Ser Ala Ala Ser Lys Leu His Leu Glu Gly Ala Arg 305 310 315 320 Leu Pro Glu Tyr Ala Leu Lys Met Thr Gly Leu 325 330 <210> 3 <211> 331 <212> PRT <213> Methylobacillus flagellatum <400> 3 Met Lys Asn Arg Thr Leu Gly Asn Ser Gly Leu Glu Val Ser Ala Leu 1 5 10 15 Gly Leu Gly Cys Met Ser Met Ser Ser Ala Tyr Gly Pro Ala Gly Asp 20 25 30 Lys Thr Glu Met Ile Ala Leu Ile Arg Arg Ala Val Asp Leu Gly Val 35 40 45 Thr Leu Phe Asp Thr Ala Glu Val Tyr Gly Pro Phe Val Asn Glu Glu 50 55 60 Leu Leu Gly Glu Ala Leu Val Pro Phe Lys Gly Gln Val Val Ile Val 65 70 75 80 Thr Lys Phe Gly Phe Asp Leu Asp Pro Ala Thr Ala Gln Arg Thr Gly 85 90 95 Gly Val Asn Ser Arg Pro Glu His Ile Lys Ala Val Ala Glu Ala Ser 100 105 110 Leu Lys Arg Leu Lys Val Asp Ala Ile Asp Leu Leu Tyr Gln His Arg 115 120 125 Val Asp Pro Gly Val Pro Ile Glu Asp Val Ala Gly Ala Val Lys Glu 130 135 140 Leu Ile Ala Glu Gly Lys Val Lys His Phe Gly Leu Ser Glu Pro Gly 145 150 155 160 Ile Glu Thr Val Arg Arg Ala His Ala Val Gln Pro Val Thr Ala Val 165 170 175 Gln Ser Glu Tyr Ser Leu Trp Trp Arg Gly Pro Glu Thr Glu Leu Leu 180 185 190 Pro Thr Leu Glu Glu Leu Gly Ile Gly Phe Val Pro Phe Ser Pro Leu 195 200 205 Gly Ala Gly Phe Leu Thr Gly Lys Met Asp Glu Asn Thr Arg Phe Asp 210 215 220 Ser Ser Asp Phe Arg Ser Gln Val Pro Arg Phe Ser Pro Asp Ala Leu 225 230 235 240 Lys Ala Asn Val Ala Leu Val Ala Leu Ile Arg Glu Val Ala Glu Thr 245 250 255 Lys Gly Ala Thr Pro Ala Gln Ile Ala Leu Ser Trp Leu Leu Ala Gln 260 265 270 Lys Pro Trp Ile Val Pro Ile Pro Gly Thr Thr Lys Leu His Arg Leu 275 280 285 Glu Glu Asn Leu Gly Ala Val Ala Ile Glu Leu Thr Ala Asp Asp Leu 290 295 300 Gln Arg Ile Ala Ser Ala Ala Ser Lys Leu His Leu Glu Gly Ala Arg 305 310 315 320 Leu Pro Glu Tyr Ala Leu Lys Met Thr Gly Leu 325 330 <210> 4 <211> 331 <212> PRT <213> Methylobacillus flagellatum <400> 4 Met Lys Asn Arg Thr Leu Gly Asn Ser Gly Leu Glu Val Ser Ala Leu 1 5 10 15 Gly Leu Gly Cys Met Ser Met Ser Ser Ala Tyr Gly Pro Ala Gly Asp 20 25 30 Lys Thr Glu Met Ile Ala Leu Ile Arg Arg Ala Val Asp Leu Gly Val 35 40 45 Thr Leu Phe Asp Thr Ala Glu Val Tyr Gly Pro Phe Val Asn Glu Glu 50 55 60 Leu Leu Gly Glu Ala Leu Val Pro Phe Lys Gly Gln Val Val Ile Ala 65 70 75 80 Thr Lys Phe Gly Phe Asp Leu Asp Pro Ala Thr Ala Gln Arg Thr Gly 85 90 95 Gly Val Asn Ser Arg Pro Glu His Ile Lys Ala Val Ala Glu Ala Ser 100 105 110 Leu Lys Arg Leu Lys Val Asp Ala Ile Asp Leu Leu Tyr Gln His Arg 115 120 125 Val Asp Pro Gly Val Pro Ile Glu Asp Val Ala Gly Ala Val Thr Glu 130 135 140 Leu Ile Ala Glu Gly Lys Val Lys His Phe Gly Leu Ser Glu Pro Gly 145 150 155 160 Ile Glu Thr Val Arg Arg Ala His Ala Val Gln Pro Val Thr Ala Val 165 170 175 Gln Ser Glu Tyr Ser Leu Trp Trp Arg Gly Pro Glu Thr Glu Leu Leu 180 185 190 Pro Thr Leu Glu Glu Leu Gly Ile Gly Phe Val Pro Phe Ser Pro Leu 195 200 205 Gly Ala Gly Phe Leu Thr Gly Lys Met Asp Glu Asn Thr Arg Phe Asp 210 215 220 Ser Ser Asp Phe Arg Ser Gln Val Pro Arg Phe Ser Pro Asp Ala Leu 225 230 235 240 Lys Ala Asn Val Ala Leu Val Ala Leu Ile Arg Glu Val Ala Glu Thr 245 250 255 Lys Gly Ala Thr Pro Ala Gln Ile Ala Leu Ser Trp Leu Leu Ala Gln 260 265 270 Lys Pro Trp Ile Val Pro Ile Pro Gly Thr Thr Lys Leu His Arg Leu 275 280 285 Glu Glu Asn Leu Gly Ala Val Ala Ile Glu Leu Thr Ala Asp Asp Leu 290 295 300 Gln Arg Ile Ala Ser Ala Ala Ser Lys Leu His Leu Glu Gly Ala Arg 305 310 315 320 Leu Pro Glu Tyr Ala Leu Lys Met Thr Gly Leu 325 330 <210> 5 <211> 331 <212> PRT <213> Methylobacillus flagellatum <400> 5 Met Lys Asn Arg Thr Leu Gly Asn Ser Gly Leu Glu Val Ser Ala Leu 1 5 10 15 Gly Leu Gly Cys Met Ser Met Ser Ser Ala Tyr Gly Pro Ala Gly Asp 20 25 30 Lys Thr Glu Met Ile Ala Leu Ile Arg Arg Ala Val Asp Leu Gly Val 35 40 45 Thr Leu Phe Asp Thr Ala Glu Val Tyr Gly Pro Phe Val Asn Glu Glu 50 55 60 Leu Leu Gly Glu Ala Leu Val Pro Phe Lys Gly Gln Val Val Ile Val 65 70 75 80 Thr Lys Phe Gly Phe Asp Leu Asp Pro Ala Thr Ala Gln Arg Thr Gly 85 90 95 Gly Val Asn Ser Arg Pro Glu His Ile Lys Ala Val Ala Glu Ala Ser 100 105 110 Leu Lys Arg Leu Lys Val Asp Ala Ile Asp Leu Leu Tyr Gln His Arg 115 120 125 Val Asp Pro Gly Val Pro Ile Glu Asp Val Ala Gly Ala Val Thr Glu 130 135 140 Leu Ile Ala Glu Gly Lys Val Lys His Phe Gly Leu Ser Glu Pro Gly 145 150 155 160 Ile Glu Thr Val Arg Arg Ala His Ala Val Gln Pro Val Thr Ala Val 165 170 175 Gln Ser Glu Tyr Ser Leu Trp Trp Arg Gly Pro Glu Thr Glu Leu Leu 180 185 190 Pro Thr Leu Glu Glu Leu Gly Ile Gly Phe Val Pro Phe Ser Pro Leu 195 200 205 Gly Ala Gly Phe Leu Thr Gly Lys Met Asp Glu Asn Thr Arg Phe Asp 210 215 220 Ser Ser Asp Phe Arg Ser Gln Val Pro Arg Phe Ser Pro Asp Ala Leu 225 230 235 240 Lys Ala Asn Val Ala Leu Val Ala Leu Ile Arg Glu Val Ala Glu Thr 245 250 255 Lys Gly Ala Thr Pro Ala Gln Ile Ala Leu Ser Trp Leu Leu Ala Gln 260 265 270 Lys Pro Trp Ile Val Pro Ile Pro Gly Thr Thr Lys Leu His Arg Leu 275 280 285 Glu Glu Asn Leu Gly Ala Val Ala Ile Glu Leu Thr Ala Asp Asp Leu 290 295 300 Gln Arg Ile Ala Ser Ala Ala Ser Lys Leu His Leu Glu Gly Ala Arg 305 310 315 320 Leu Pro Glu Tyr Ala Leu Lys Met Thr Gly Leu 325 330
Claims
1. An aldehyde oxidase mutant, characterized in that, The mutant is one of the following: 1) alanine at position 80 of the amino acid sequence shown in SEQ ID NO.2 is mutated to valine, and the amino acid sequence is shown in SEQ ID NO.3; 2) lysine at position 143 of the amino acid sequence shown in SEQ ID NO.2 is mutated to threonine, and the amino acid sequence is shown in SEQ ID NO.4; 3) lysine at position 143 of the amino acid sequence shown in SEQ ID NO.3 is mutated to threonine, and the amino acid sequence is shown in SEQ ID NO.
5.
2. The recombinant vector constructed from the aldehyde oxidase mutant according to claim 1.
3. The recombinant genetically engineered bacteria prepared by transformation with the recombinant vector according to claim 2.
4. The application of the aldehyde oxidase mutant according to claim 1 in the preparation of crotonic acid from crotonaldehyde.
5. The application of the aldehyde oxidase mutant according to claim 4 in the preparation of crotonic acid from crotonaldehyde, characterized in that, The process includes the following steps: using wet bacterial cells obtained by inducing culture of recombinant engineered bacteria containing the gene encoding an aldehyde oxidase mutant as the enzyme source, using exogenous crotonaldehyde as the substrate, and using pH=7.5 PB buffer as the reaction medium, a hydrolysis reaction is carried out.
6. The application of the aldehyde oxidase mutant according to claim 5 in the preparation of crotonic acid from crotonaldehyde, characterized in that: The hydrolysis reaction was carried out under water bath temperature control and magnetic stirring conditions.
7. The application of the aldehyde oxidase mutant according to claim 5 in the preparation of crotonic acid from crotonaldehyde, characterized in that: The wet bacterial cells were prepared as follows: the genetically engineered bacteria containing the relevant gene were inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking for 12 h; then transferred to 500 mL of fresh LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C with shaking until the OD600 reached 0.75-0.85, IPTG was added to a concentration of 0.5 mM, and the cells were induced at 28°C for 16-18 h; after the culture was completed, the culture solution was centrifuged at 4000 rpm for 10 min, the supernatant was discarded, the bacterial cells were collected, and stored in an ultra-low temperature freezer at -70°C for later use.