Method for efficiently preparing nicotinamide mononucleotide and fusion protein

By forming a fusion protein of nicotinamide ribokinase and ATP cycling enzyme as a catalyst, the efficient catalytic production of NMN from nicotinamide ribokinase under low ATP conditions was achieved, solving the problem of low NMN production efficiency in existing technologies and reducing production costs and extraction difficulty.

CN115637262BActive Publication Date: 2026-03-27HUBEI GRAND LIFE SCI & TECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202111076885.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-14
Publication Date
2026-03-27
Estimated Expiration
2041-09-14

AI Technical Summary

Technical Problem

There is a lack of efficient methods for producing β-nicotinamide mononucleotide (NMN) in the current technology, especially when ATP consumption is high and the subsequent extraction is difficult, making it difficult to achieve efficient production.

Method used

Nicotinamide ribokinase (NRK) and ATP cycling enzymes are linked together to form a fusion protein. Using this protein as a catalyst, the fermented fusion protein catalyzes the production of NMN from nicotinamide ribose under minimal ATP conditions, thus achieving ATP recycling.

Benefits of technology

It improved the production efficiency of NMN, reduced the amount of ATP required, reduced the workload of separation and purification, and achieved high conversion rate and low-cost production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003262567570000131
    Figure BDA0003262567570000131
  • Figure BDA0003262567570000141
    Figure BDA0003262567570000141
  • Figure BDA0003262567570000161
    Figure BDA0003262567570000161
Patent Text Reader

Abstract

The present application provides a fusion protein and its application in preparing a catalyst for producing nicotinamide mononucleotide, wherein the fusion protein comprises a nicotinamide riboside kinase (NRK) and an ATP recycling enzyme connected by a linker. The present application also provides a protein combination and its application, wherein the protein combination comprises the nicotinamide riboside kinase (NRK) and the ATP recycling enzyme in the fusion protein. The present application further provides a nucleic acid encoding the fusion protein or the protein combination, a recombinant expression vector containing the nucleic acid, a transformant containing the nucleic acid or the recombinant expression vector, and their applications. The present application also provides a method for efficiently preparing nicotinamide mononucleotide, which uses the fusion protein or the protein combination, and has the progress effects of high enzyme activity, high substrate concentration and high reaction efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biosynthesis, and particularly relates to a method for efficiently preparing nicotinamide mononucleotide, a fusion protein or a protein combination for preparing nicotinamide mononucleotide, and an isolated nucleic acid encoding the fusion protein, a vector containing the nucleic acid, and a transformant. BACKGROUND

[0002] Nicotinamide mononucleotide (NMN) is a substance existing in vivo, which is converted into nicotinamide adenine dinucleotide (NAD+, also known as coenzyme I), an important substance for the survival of biological cells, after being adenosylated by nicotinamide nucleotide adenylyltransferase. A research published in Science in March 2017 by David Scinclair's research team showed that the increase of NAD+ in mice reversed the signs of aging of the tissues and muscles of old mice, which indicated that human rejuvenation is no longer a dream. Since NAD+ has a large molecular weight and cannot be taken orally into cells, it mainly depends on the synthesis of cells in vivo, and the synthesis amount is very low. However, with the research on the small molecule substance NMN, the precursor of NAD+, it is found that the consumption of NMN can effectively increase the content of NAD+ in vivo, and significantly inhibit the metabolism caused by aging, so that NMN has become a "fountain of youth". So far, it has been found that nicotinamide mononucleotide has many medical and health care uses such as delaying aging, treating old-age diseases such as Parkinson's disease, regulating insulin secretion, affecting the expression of mRNA, etc.

[0003] The main methods for synthesizing NMN at present include chemical synthesis and biological catalysis. The chemical method is high in cost and causes serious environmental pollution, and has been gradually replaced by the biological catalysis method. Compared with the chemical method, the biological enzyme method for catalyzing the production of NMN is more efficient, lower in cost, and energy-saving and environmentally friendly. At present, there are three biological catalysis methods for producing NMN. The first method is to use nicotinamide riboside (NR) as a raw material to generate NMN under the supply of ATP through ribosylnicotinamide kinase (EC 2.7.1.22, abbreviated as NRK enzyme). The second method is to use nicotinamide, ribose and ATP as substrates to generate NMN through D-ribokinase (EC 2.7.1.15), ribose phosphate pyrophosphokinase (EC 2.7.6.1), and nicotinamide phosphoribosyltransferase (EC.2.4.2.12). The third method is to use adenosine or AMP, ATP, and nicotinamide as raw materials to generate NMN through adenosine kinase (EC 2.7.1.20) (not needed when AMP is used as a raw material), adenine phosphate ribosyltransferase (EC 2.4.2.7), and nicotinamide phosphoribosyltransferase (EC.2.4.2.12).

[0004] The second and third methods described above finally generate NMN from 5-phosphoribosyl-1-pyrophosphate (PRPP) and nicotinamide through nicotinamide phosphoribosyltransferase (EC.2.4.2.12). Since the catalysis of nicotinamide phosphoribosyltransferase is a reversible reaction, NMN can also be hydrolyzed during the synthesis of NMN, and the reaction conversion rate is low. At the same time, the synthesis of the intermediate PRPP compound is difficult to achieve, and PRPP is unstable, resulting in very low yield, which is not conducive to the reaction and has become the main limiting condition of the reaction.

[0005] The first method described above directly uses nicotinamide riboside as a raw material, and has high substrate conversion rate, high yield, and high product purity. In the future, it will become the mainstream method for producing NMN. At present, a new nicotinamide riboside kinase and its mutants have been disclosed as industrial enzymes for catalyzing the synthesis of beta-nicotinamide mononucleotide (patent number: CN110373398A). However, under the condition of a single NRK, the use amount of ATP is large, the cost is high, and the post-extraction is difficult.

[0006] Studies have shown that there are enzyme systems in some bacteria that can regenerate ATP using polyphosphoric acid or its salt. The enzyme system includes polyphosphoric acid kinase (EC 2.7.4.1, Ppk), adenosine kinase (EC 2.7.4.3, Adk) and polyphosphoric acid adenosine phosphate transferase (EC 2.7.4.-, Pap), wherein Ppk catalyzes the reaction of ADP with polyphosphoric acid or its salt to generate ATP, Adk catalyzes the reaction of 2 molecules of ADP to generate 1 molecule of ATP and 1 molecule of AMP, and Pap catalyzes the reaction of AMP with polyphosphoric acid or its salt to generate ADP. They can all help to recycle the ATP consumed in the enzymatic reaction, greatly reducing the amount of ATP used in the production process. The present invention collectively refers to the three enzymes as "ATP recycling enzymes". There are patents that have established a recovery system for these ATP recycling enzymes and have proven to be suitable for large-scale industrial production (Patent No. CN105861598A).

[0007] In addition, an enzyme-catalyzed synthesis method of β-nicotinamide mononucleotide has been disclosed (Patent No. CN112795606A), which uses adenosine, nicotinamide, ATP or its salt, polyphosphoric acid kinase, magnesium ions and polyphosphoric acid salt as raw materials to synthesize β-nicotinamide mononucleotide under the catalysis of purine-nucleoside phosphorylase (EC 2.4.2.1, abbreviated as PNP) and nicotinamide ribosyl kinase NRK, and the ADP generated in the reaction process is regenerated to ATP under the action of polyphosphoric acid kinase, thereby reducing the production cost.

[0008] However, there is a lack of a method for further improving the production efficiency of NMN in the art. SUMMARY

[0009] The technical problem solved by the present application is to overcome the lack of an efficient method for producing β-nicotinamide mononucleotide (NMN) in the art, and to provide a method for efficiently preparing nicotinamide mononucleotide and a fusion protein.

[0010] The present application links nicotinamide ribosyl kinase (NRK) and ATP recycling enzyme into a fusion protein with a linker, and ferments the fusion protein. The fermentation of the obtained fusion protein as a catalyst not only can efficiently catalyze the reaction of nicotinamide ribose (NR) or its chloride to generate NMN, but also can realize the recycling of ATP at the same time, greatly reducing the amount of ATP used, reducing the workload of separation and purification, and improving the production efficiency of NMN.

[0011] The technical principle of the present application is that a nicotinamide riboside kinase (NRK) gene and an ATP recycling enzyme (polyphosphate kinase, Ppk) gene are connected by a linker to form a fusion protein gene, the gene is transformed into an expression strain to obtain a fusion protein (enzyme) with the functions of NRK and Ppk and a strain containing the fusion protein (enzyme), and the strain obtained by fermentation or the enzyme obtained by crushing the strain is used as a catalyst to complete the efficient conversion of NR to NMN under the condition of extremely small ATP and using cheaper sodium hexametaphosphate to provide phosphate groups.

[0012] One of the technical solutions of the present application is to provide a fusion protein, which comprises a nicotinamide riboside kinase NRK and an ATP recycling enzyme.

[0013] In some preferred embodiments, the ATP recycling enzyme is Ppk.

[0014] Preferably, the Ppk is derived from Escherichia coli, and the NRK is derived from Haemophilus influenzae.

[0015] More preferably, the amino acid sequence of the NRK is shown as SEQ ID NO: 1, and the amino acid sequence of the Ppk is shown as SEQ ID NO: 2.

[0016] In some more preferred embodiments, the NRK and the Ppk are connected by or without a linker L.

[0017] Preferably, the structure of the fusion protein is NRK-L-Ppk or Ppk-L-NRK.

[0018] And / or, the amino acid sequence of the L is shown as SEQ ID NO: 3.

[0019] The second technical solution of the present application is to provide a protein combination comprising the nicotinamide riboside kinase NRK and the ATP recycling enzyme in any of the above fusion proteins.

[0020] The third technical solution of the present application is to provide an isolated nucleic acid encoding any of the above fusion proteins or any of the above protein combinations; preferably, when the isolated nucleic acid comprises NRK, Ppk and / or L, the nucleotide sequence encoding the NRK is shown as SEQ ID NO: 4; the nucleotide sequence encoding the Ppk is shown as SEQ ID NO: 5, and the nucleotide sequence encoding the L is shown as SEQ ID NO: 6.

[0021] The fourth technical solution of the present application is to provide a recombinant expression vector comprising the above-mentioned isolated nucleic acid.

[0022] Preferably, the NRK and Ppk are on the same recombinant expression vector.

[0023] More preferably, the backbone plasmid of the recombinant expression vector is pET28a(+).

[0024] The expression vector, after being transformed into a suitable host strain, can express any one of the fusion proteins or any one of the protein combinations.

[0025] The fifth technical solution of the present application provides a transformant, which comprises the isolated nucleic acid or the recombinant expression vector.

[0026] Preferably, the transformant is Escherichia coli.

[0027] Preferably, the Escherichia coli is E. coli BL21 (DE3).

[0028] The transformant can be fermented to obtain a slurry containing any one of the fusion proteins or any one of the protein combinations, which can be used for efficient preparation of nicotinamide mononucleotide.

[0029] The sixth technical solution of the present application provides a method for preparing a fusion protein, which comprises culturing the transformant to express the fusion protein.

[0030] The seventh technical solution of the present application provides a method for preparing NMN, which comprises using any one of the fusion proteins or any one of the protein combinations to catalyze a reaction of nicotinamide riboside or a salt thereof and ATP or a salt thereof to produce NMN.

[0031] Preferably, the reaction further comprises magnesium ions and polyphosphate.

[0032] More preferably, the nicotinamide riboside is nicotinamide riboside chloride, the ATP or a salt thereof is ATP disodium salt, the magnesium ions are from MgCl2, and the polyphosphate is sodium hexametaphosphate; the reaction time is 0.5-2 hours, the reaction pH is 4.0-7.0, and the reaction temperature is 28-40℃.

[0033] Further more preferably, in the reaction, the ATP or a salt thereof is 8mM, the magnesium salt is 50mM, the pure nicotinamide riboside or nicotinamide riboside chloride is 80mM, the sodium hexametaphosphate is 8mM, and 10%-20% of the reaction volume of the slurry containing any one of the fusion proteins or any one of the protein combinations is added, and the reaction time is 1.5-2 hours.

[0034] And / or, the pH is 5.5, and the reaction temperature is 40℃.

[0035] The eighth technical solution of the present invention is: to provide the application of any of the above-mentioned fusion proteins or any combination of the above-mentioned proteins in the preparation of catalysts for the production of nicotinamide mononucleotides.

[0036] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0037] The reagents and raw materials used in this invention are all commercially available.

[0038] The positive and progressive effects of this invention are as follows:

[0039] 1. The fusion protein constructed or the protein combination used in this invention has high activity, and more than 89% conversion can be achieved directly using crude NR or its chloride (purity of 40-50%).

[0040] 2. According to publicly available literature, most existing technologies have substrate concentrations of no more than 50 mM, while the substrate concentration in this invention can reach 80 mM, which improves production efficiency by at least 60%.

[0041] 3. The fusion protein constructed in this invention not only achieves the simultaneous expression of NRK enzyme and Ppk enzyme in a 1:1 ratio, but also the functional subunits of the two enzymes are not far apart. That is, when the ATP cycling enzyme regenerates ATP, it can be immediately used to convert NR to NMN by the converting enzyme, resulting in higher reaction efficiency.

[0042] 4. The nucleotide sequences of NRK and Ppk enzymes were optimized according to the optimal codons of E. coli, resulting in better enzyme expression. Attached Figure Description

[0043] Figure 1 This is a schematic diagram of the reaction pathway in this invention, which utilizes NRK enzyme to catalyze the NR reaction to obtain NMN, and utilizes Ppk enzyme to achieve ATP cycle regeneration during this process.

[0044] Figure 2 This is a map of the expression plasmids for the enzyme constructed in this invention. Among them, Figure 2 A represents the NRK enzyme expression plasmid map. Figure 2 B represents the Ppk enzyme expression plasmid map. Figure 2 C represents the expression plasmid map of the NRK and Ppk fusion protein.

[0045] Figure 3To verify the normal expression of the protein carried by the target gene in each expression plasmid in the bacteria in vitro, a protein gel map was constructed. Among them, the fusion protein was obtained by expression of the BL21 (DE3) strain containing the plasmid pET28a-fusion protein; Ppk was obtained by expression of the BL21 (DE3) strain containing the plasmid pET28a-Ppk; NRK was obtained by expression of the BL21 (DE3) strain containing the plasmid pET28a-NRK. DETAILED DESCRIPTION

[0046] The present application is further illustrated by the following examples without limiting the present application to the described examples. The experimental methods in the following examples without specific conditions are selected according to the conventional methods and conditions, or according to the product instructions.

[0047] Example 1 Construction of fusion protein gene expression strain

[0048] 1. First, the amino acid sequences of NRK, Ppk and linker were obtained by functional gene search on NCBI: NRK amino acid sequence (SEQ ID NO: 1), Ppk amino acid sequence (SEQ ID NO: 2) and flexible linker amino acid sequence (SEQ ID NO: 3).

[0049] NRK amino acid sequence (SEQ ID NO: 1):

[0050] MGFTTGREFHPALRMRAKYNAKYLGTKSEREKYFHLAYNKHTQFLRYQEQIMSKTKEKKVGVIFGKFYPVHTGHINMIYEAFSKVDELHVIVCSDTVRDLKLFYDSKMKRMPTVQDRLRWMQQIFKYQKNQIFIHHLVEDGIPSYPNGWQSWSEAVKTLFHEKHFEPSIVFSSEPQDKAPYEKYLGLEVSLVDPDRTFFNVSATKIRTTPFQYWKFIPKEARPFFAKTVAILGGESSGKSVLVNKLAAVFNTTSAWEYGREFVFEKLGGDEQAMQYSDYPQMALGHQRYIDYAVRHSHKIAFIDTDFITTQAFCIQYEGKAHPFLDSMIKEYPFDVTILLKNNTEWVDDGLRSLGSQKQRQQFQQLLKKLLDKYKVPYIEIESPSYLDRYNQVKAVIEKVLNEEEISELQNTTFPIKGTSQ

[0051] Ppk amino acid sequence (SEQ ID NO: 2):

[0052] MGQEKLYIEKELSWLSFNERVLQEAADKSNPLIERMRFLGIYSNNLDEFYKVRFAELKRRIIISEEQGSNSHSRHLLGKIQSRVLKADQEFDGLYNELLLEMARNQIFLINERQLSVNQQNWLRHYFKQYLRQHITPILINPDTDLVQFLKDDYTYLAVEIIRGDTIRYALLEIPSDKVPRFVNLPPEAPRRRKPMILLDNILRYCLDDIFKGFFDYDALNAYSMKMTRDAEYDLVHEMEASLMELMSSSLKQRLTAEPVRFVYQRDMPNALVEVLREKLTISRYDSIVPGGRYHNFKDFINFPNVGKANLVNKPLPRLRHIWFDKAQFRNGFDAIRERDVLLYYPYHTFEHVLELLRQASFDPSVLAIKINIYRVAKDSRIIDSMIHAAHNGKKVTVVVELQARFDEEANIHWAKRLTEAGVHVIFSAPGLKIHAKLFLISRKENGEVVRYAHIGTGNFNEKTARLYTDYSLLTADARITNEVRRVFNFIENPYRPVTFDYLMVSPQNSRRLLYEMVDREIANAQQGLPSGITLKLNNLVDKGLVDRLYAASSSGVPVNLLVRGMCSLIPNLEGISDNIRAISIVDRYLEHDRVYIFENGGDKKVYLSSADWMTRNIDYRIEVATPLLDPRLKQRVLDIIDILFSDTVKARYIDKELSNRYVPRGNRRKVRAQLAIYDYIKSLEQPE

[0053] Flexible linker amino acid sequence (SEQ ID NO: 3):

[0054] KESGSVSSEQLAQFRSLD

[0055] The amino acid sequences are then translated into DNA sequences, and optimized according to the optimal codons of E. coli: the DNA sequence encoding NRK (SEQ ID NO: 4), the DNA sequence encoding Ppk (SEQ ID NO: 5), and the DNA sequence encoding the flexible linker (SEQ ID NO: 6) are obtained.

[0056] The DNA sequence encoding NRK (SEQ ID NO: 4):

[0057]

[0058] The DNA sequence encoding Ppk (SEQ ID NO: 5):

[0059]

[0060] DNA sequence encoding flexible linker (SEQ ID NO: 6):

[0061] AAGGAAAGCGGGAGTGTTTCGAGTGAACAGCTGGCGCAGTTTAGAAGTTTGGAT

[0062] The NRK gene (SEQ ID NO: 4) was first connected with the restriction sites BamHI and EcoRI, respectively, by PCR, and then connected to the plasmid pET28a by enzyme digestion and ligation. The primers were designed as follows:

[0063] NRK-BamHI-F: cgcGGATCCATGGGTTTTACCACAGGACG (SEQ ID NO: 7)

[0064] NRK-EcoRI-R: ggccttaagAATTTGGGAGGTGCCTTTTATTGGAA (SEQ ID NO: 8)

[0065] The obtained plasmid is shown in Figure A. Figure 2

[0066] The Ppk gene (SEQ ID NO: 5) was first connected with the restriction sites EcoRI and HindIII, respectively, by PCR, and then connected to the plasmid pET28a by enzyme digestion and ligation. The primers were designed as follows:

[0067] Ppk-EcoRI-F: CCGGAATTCATGGGACAGGAGAAATTG (SEQ ID NO: 9)

[0068] Ppk-HindIII-R: CCCAAGCTTCTCTGGCTGTTCCAACG (SEQ ID NO: 10)

[0069] The obtained plasmid is shown in Figure B. Figure 2

[0070] 2. A specific flexible linker (SEQ ID NO: 6) was connected between the NRK and Ppk gene sequences. The connection of the NRK gene and the Ppk gene with the linker was performed by overlap PCR (OEPCR), and the primers for NRK+linker and linker+Ppk were designed as follows:

[0071] ​​NRK-BamHI-F: cgcGGATCCATGGGTTTTACCACAGGACG (SEQ ID NO: 11)

[0072] NRK-linker-R: CTCCCGCTTTCCTTTTGGGAGGTGCC (SEQ ID NO: 12)

[0073] Linker-Ppk-F: GTTTAGAAGTTTGGATGGACAGGAGAAATTG (SEQ ID NO: 13)

[0074] Ppk-HindIII-R: CCCAAGCTTCTCTGGCTGTTCCAACG (SEQ ID NO: 14)

[0075] After OEPCR, the fusion protein gene with BamHI and HindIII enzyme cutting point sites at the head and tail is obtained.

[0076] 3. The recombined gene is connected to the expression plasmid pET28a(+) by enzyme cutting and connection, and the obtained expression fusion protein plasmid map is shown in FIG. C. Figure 2

[0077] 4. The expression plasmid is transformed into bacteria Escherichia coli BL21(DE3) with foreign gene function expression in vivo;

[0078] 5. The protein electrophoresis is used to verify that the target gene carried by each expression plasmid constructed can be normally expressed in vivo, and the protein gel map is shown in FIG. D. Figure 3

[0079] Example 2 Fermentation production of fusion protein

[0080] 1. Fermentation process:

[0081] 1) Single colony is inoculated in a culture medium containing yeast powder, proteose peptone and sodium chloride, and shake flask culture is carried out at 37°C for 8h.

[0082] 2) The first-stage shake flask is expanded to a second-stage shake flask, and culture is carried out at 37°C for 3-7h.

[0083] 3) The second-stage shake flask is inoculated in a culture medium containing proteose peptone, yeast powder, glycerol, disodium hydrogen phosphate dodecahydrate, potassium dihydrogen phosphate, ammonium chloride, anhydrous sodium sulfate, magnesium sulfate, antifoaming agent, and fermentation culture is carried out at 37°C for 6-10h, and ammonia water and glycerol are supplemented during the process.

[0084] ​​4) When the OD600 of the fermentation broth is 20-30, add IPTG (the final concentration of IPTG is 1 mM), and culture at 25°C, keeping the dissolved oxygen at 25-40% and the glycerol concentration at about 2 g / L during the culture process, until the fermentation is complete.

[0085] 2) After the fermentation is complete, centrifuge the fermentation broth at 7000 x g for 10 min, collect the precipitate, and store the precipitate in a refrigerator at -20°C for more than 24 hours, and obtain the bacterial slurry after thawing at room temperature. When fresh bacteria are used directly, the bacteria need to be subjected to a wall-breaking treatment such as ultrasonic or homogenization to obtain the wall-broken bacterial slurry.

[0086] Example 3: Preparation of NMN from pure NR

[0087] The following six reaction systems (reaction systems a, b, c, d, e and f) were used to catalyze the preparation of NMN from pure NR. The reactions are shown in Figure 1 .

[0088] Reaction system a (reaction system using NRK enzyme alone, SEQ ID NO: 4):

[0089] ATP or salt thereof 8 mM, magnesium salt 50 mM, pure NR 80 mM, hexametaphosphoric acid or salt thereof 8 mM, after the solution is prepared, the pH of the solution is adjusted to 5.5, 10% of the bacterial slurry of NRK enzyme derived from Haemophilus influenzae is added to the reaction volume, the reaction temperature is kept at 40°C, and the reaction is carried out, and the yield of NMN is monitored by HPLC, so as to calculate the conversion rate of NR to NMN. After 2 h of conversion, the reaction solution is removed by centrifugation to remove the enzyme, and the reaction solution is sequentially subjected to anion resin and cation resin to remove the residual ATP and its series (ADP, AMP) in the reaction solution. During the removal process, the residual amount of ATP and its series in the liquid after passing through the resin is monitored by HPLC, and when the residual amount of ATP and its series in the HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the used resin is calculated.

[0090] Reaction system b (reaction system using one bacterium and two enzymes, SEQ ID NO: 4+SEQ ID NO: 5):

[0092] The enzyme added in this reaction system is 10% of the bacterial slurry containing NRK enzyme and Ppk enzyme in the reaction volume, and the other reaction conditions are exactly the same as those of reaction system a.

[0093] Reaction system c (reaction system using a fusion protein enzyme, SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5):

[0094] The enzyme added in this reaction system is 10% of the reaction volume of the bacterial slurry containing the NRK enzyme from Kluyveromyces marxianus, and 10% of the reaction volume of the bacterial slurry containing the Ppk enzyme from Escherichia coli, and the other reaction conditions are exactly the same as those of reaction system a.

[0095] Reaction system d (reaction system using a combination of NRK enzyme from Kluyveromyces marxianus and Ppk enzyme from Escherichia coli, SEQ ID NO: 16 and SEQ ID NO: 5):

[0096] The enzyme added in this reaction system is 10% of the reaction volume of the bacterial slurry containing the NRK enzyme from Kluyveromyces marxianus, and 10% of the reaction volume of the bacterial slurry containing the Ppk enzyme from Escherichia coli, and the other reaction conditions are exactly the same as those of reaction system a.

[0097] Reaction system e (reaction system using a combination of NRK enzyme from Kluyveromyces marxianus and Ppk enzyme from Pseudomonas aeruginosa, SEQ ID NO: 16 and SEQ ID NO: 17):

[0098] The enzyme added in this reaction system is 10% of the reaction volume of the bacterial slurry containing the NRK enzyme from Kluyveromyces marxianus, and 10% of the reaction volume of the bacterial slurry containing the Ppk enzyme from Pseudomonas aeruginosa, and the other reaction conditions are exactly the same as those of reaction system a.

[0099] Reaction system f (reaction system using a combination of NRK enzyme from Haemophilus influenzae and Ppk enzyme from Escherichia coli, SEQ ID NO: 4 and SEQ ID NO: 5):

[0100] The enzyme added in this reaction system is 10% of the reaction volume of the bacterial slurry containing the NRK enzyme from Haemophilus influenzae, and 10% of the reaction volume of the bacterial slurry containing the Ppk enzyme from Escherichia coli, and the other reaction conditions are exactly the same as those of reaction system a.

[0101] Under a single variable, the conversion rate of NR of the six reaction systems, the required amount of anion resin and cation resin per 100 g of product after removal of ATP, and the required amount of anion resin and cation resin per 100 g of product after removal of ATP were determined and calculated, and the results are shown in the following table:

[0102]

[0103]

[0104] As can be seen from Example 3, when pure NR is used as the substrate and NRK enzyme is used alone, the catalytic conversion rate of NR is too low (system a, 11.2%), the catalytic conversion rate of the protein combination of the double-bacteria double-enzyme system (system f) constructed by the application can reach 92.3%, which is better than that of other protein combinations (72.4% of system d and 82.5% of system e), and when the combination is constructed into a double-enzyme system of one bacterium and non-fusion protein (system b), the catalytic conversion rate is better (95.5%), and when the combination is constructed into a double-enzyme system of one bacterium and fusion protein (system c), the catalytic conversion rate is best (99.8%). In addition, compared with other reaction systems in this example, the amount of cation and anion resins used in the fusion protein (system c) is the lowest, which reduces the cost of the production process. As can also be seen, under the condition that the substrate concentration is 80 mM, only the combination of NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli can achieve a conversion efficiency of more than 90%, and the catalytic efficiency and activity of other enzymes are not as good as that of the combination of NRK enzyme derived from Haemophilus influenzae and Ppk enzyme derived from Escherichia coli. In addition, through the comparison of conversion rate and the amount of anion and cation resins, it can be found that the higher the conversion rate, the lower the amount of resins required for purification.

[0105] Example 4: Preparation of NMN from 40% NR chloride crude product

[0106] The following six reaction systems (reaction systems a1, b1, c1, d1, e1 and f1) were used respectively to catalyze the preparation of NMN from 40% NR chloride. The amount of substances added in the reaction system was calculated according to the amount of pure NR contained in the crude product NR.

[0107] Reaction system a1 (reaction system using NRK enzyme alone, SEQ ID NO: 4):

[0108] 80 mM ATP or salt thereof, 50 mM magnesium salt, 80 mM of 40% NR chloride, after being configured into a solution, the pH of the solution was adjusted to 5.5, 20% of the reaction volume of the bacterial slurry of NRK enzyme derived from Haemophilus influenzae was added, the reaction temperature was maintained at 40°C, and the reaction was carried out. The yield of NMN was monitored by HPLC to calculate the conversion rate of NR to NMN. After 2 hours of conversion, the reaction solution was removed by ultrafiltration to remove the enzyme, and then anion resin and cation resin were used to remove the residual ATP and its series (ADP, AMP) in the reaction solution. During the removal process, the residual amount of ATP and its series in the liquid after passing through the resin was monitored by HPLC. When the residual amount of ATP and its series in HPLC was ≤0.05%, it was considered that the removal was completed, and the volume of the resin used was calculated.

[0109] Reaction system b1 (reaction system using a double-enzyme system of one bacterium, SEQ ID NO: 4+SEQ ID NO: 5):

[0110] The ATP or salt thereof added to this reaction system is 8 mM, the enzyme added is 20% of the reaction volume of the slurry containing the NRK enzyme and the Ppk enzyme derived from K. marxianus, and the other reaction conditions are exactly the same as those of reaction system a1.

[0111] Reaction system c1 (reaction system using a fusion protein enzyme, SEQ ID NO: 4 + SEQ ID NO: 6 + SEQ ID NO: 5):

[0112] The ATP or salt thereof added to this reaction system is 8 mM, the enzyme added is 20% of the reaction volume of the slurry containing the NRK enzyme and the Ppk enzyme derived from K. marxianus, and the other reaction conditions are exactly the same as those of reaction system a1.

[0113] Reaction system d1 (reaction system using a combination of NRK enzyme derived from K. marxianus and Ppk enzyme derived from E. coli, SEQ ID NO: 16 and SEQ ID NO: 5):

[0114] The ATP or salt thereof added to this reaction system is 8 mM, the enzyme added is 20% of the reaction volume of the slurry containing the NRK enzyme and the Ppk enzyme derived from K. marxianus, and the other reaction conditions are exactly the same as those of reaction system a1.

[0115] Reaction system e1 (reaction system using a combination of NRK enzyme derived from K. marxianus and Ppk enzyme derived from P. aeruginosa, SEQ ID NO: 16 and SEQ ID NO: 17):

[0116] The ATP or salt thereof added to this reaction system is 8 mM, the enzyme added is 20% of the reaction volume of the slurry containing the NRK enzyme and the Ppk enzyme derived from K. marxianus, and the other reaction conditions are exactly the same as those of reaction system a1.

[0117] Reaction system f1 (reaction system using a combination of NRK enzyme derived from H. influenzae and Ppk enzyme derived from E. coli, SEQ ID NO: 4 and SEQ ID NO: 5):

[0118] The ATP or salt thereof added to this reaction system is 8 mM, the enzyme added is 20% of the reaction volume of the slurry containing the NRK enzyme and the Ppk enzyme derived from K. marxianus, and the other reaction conditions are exactly the same as those of reaction system a1.

[0119] The conversion rate of NR, the amount of anion resin and cation resin required per 100 g of product after removal of ATP in six reaction systems were determined and calculated, and the results are shown in the following table:

[0120]

[0121] As can be seen from Example 4, when the content of NR chloride is 40%, under the same conditions, the conversion rate in the system with only NRK enzyme added is only 10.1% even if 1 equivalent of ATP is added, while the yield of the enzyme combination in the prior art (d1 system) is only 67.2%, and the yield of the enzyme combination according to the present application (f1 system) can reach 89.3%. In addition, if the enzyme combination according to the present application is linked by a linker to form a fusion protein (c1 system), the yield can reach 96.7%. In addition, compared with other reaction systems in this example, the fusion protein (c1 system) has the lowest amount of anion and cation resin, reducing the cost of the production process.

[0122] Example 5: Preparation of NMN from NR chloride with a content of 70% using fusion protein enzyme (SEQ ID NO: 4+SEQ ID NO: 6+SEQ ID NO: 5) or fusion protein enzyme (SEQ ID NO: 16+SEQ ID NO: 6+SEQ ID NO: 17) to screen the optimal reaction time

[0123] The following five reaction systems (reaction systems a2, b2, c2 and d2, e2) were used to catalyze the preparation of NMN from NR chloride with a content of 70%. The amount of substances added in the reaction system was calculated according to the amount of pure NR contained in the crude NR chloride.

[0124] Reaction system a2:

[0125] NMN was prepared using a fusion protease (SEQ ID NO:4+SEQ ID NO:6+SEQ ID NO:5) catalyzing 70% NR chloride. The reaction mixture consisted of 8 mM ATP or its salt, 50 mM magnesium salt, 80 mM 70% NR chloride, and 8 mM hexametaphosphate or its salt. The pH was adjusted to 5.5, and 10% (by volume) of the fusion protein-containing bacterial sludge was added. The reaction was carried out at 40°C, and the NMN yield was monitored by HPLC. The conversion rate from NR to NMN was calculated. After 30 min of conversion, the reaction solution was subjected to ultrafiltration to remove the enzyme. Residual ATP and its derivatives (ADP, AMP) were then removed sequentially by anion exchange resin and cation exchange resin. During the removal process, the residual ATP and its derivatives in the resin-treated liquid were monitored by HPLC. Removal was considered complete when the residual ATP and its derivatives in the HPLC solution were ≤0.05%. The volume of resin used was calculated.

[0126] Reaction system b2:

[0127] The conversion time in reaction system a2 was set to 1 hour, while all other conditions remained the same.

[0128] Reaction system c2:

[0129] The conversion time in reaction system a2 was set to 90 min, with all other conditions remaining the same.

[0130] Reaction system d2:

[0131] The conversion time in reaction system a2 was set to 2 hours, while all other conditions remained the same.

[0132] Reaction system e2:

[0133] NMN was prepared using a fusion protease (SEQ ID NO:16+SEQ ID NO:6+SEQ ID NO:17) catalyzing 70% NR chloride. The reaction mixture consisted of 8 mM ATP or its salt, 50 mM magnesium salt, 80 mM 70% NR chloride, and 8 mM hexametaphosphate or its salt. The pH was adjusted to 5.5, and 10% of the reaction volume of the fusion protein-containing bacterial sludge was added. The reaction was carried out at 40°C, and the NMN yield was monitored by HPLC. The conversion rate from NR to NMN was calculated. After 1.5 h of conversion, the reaction solution was subjected to ultrafiltration to remove the enzyme. Residual ATP and its derivatives (ADP, AMP) were then removed sequentially by anion exchange resin and cation exchange resin. During the removal process, the residual ATP and its derivatives in the liquid after passing through the resin were monitored by HPLC. Removal was considered complete when the residual amount of ATP and its derivatives in the HPLC was ≤0.05%. The volume of resin used was calculated.

[0134] The conversion rate of NR, the amount of anion resin and cation resin required per 100 g of product after removal of ATP, and the like were measured and calculated for the five reaction systems, and the results are shown in the following table.

[0135]

[0136] As can be seen from Example 5, the catalytic efficiency of the fusion protein is very high, even if the content of 70% NR chloride is used as the reaction raw material, only 10% of the reaction volume of the fusion protein slurry is added, and the raw material can be substantially converted after 1.5 hours of conversion (c2 system). The conversion efficiency of other sources of protein with a content of 70% NR chloride as the reaction raw material is very low, only 36.7%, which shows that impurities in the raw material have a great effect on enzyme activity.

[0137] Example 6 Preparation of NMN by different linkers

[0138] The following four fusion proteins (a3, b3, c3, and d3) were used to catalyze the preparation of NMN from pure NR chloride, respectively.

[0139] Fusion protein a3 (the order of enzyme connection is: NRK enzyme derived from Haemophilus influenzae + flexible linker + Ppk enzyme derived from Escherichia coli, i.e. SEQ ID NO: 4 + SEQ ID NO: 6 + SEQ ID NO: 5):

[0140] The reaction system is: ATP or its salt 8 mM, magnesium salt 50 mM, NR chloride 80 mM, after the solution is prepared, the solution pH is adjusted to 5.5, 20% of the fusion protein a3 slurry of the reaction volume is added, the reaction temperature is maintained at 40°C, and the reaction is carried out, and the yield of NMN is monitored by HPLC, and the conversion rate of NR to NMN is calculated. After 2 hours of conversion, the reaction solution is removed by ultrafiltration to remove the enzyme, and then the anion resin and the cation resin are used to remove the residual ATP and its series (ADP, AMP) in the reaction solution. During the removal process, the residual amount of ATP and its series in the liquid after passing through the resin is monitored by HPLC, and when the residual amount of ATP and its series in the HPLC is ≤0.05%, it is considered that the removal is complete, and the volume of the resin used is calculated.

[0141] Fusion protein b3 (the order of enzyme connection is: Ppk enzyme derived from Escherichia coli + flexible linker + NRK enzyme derived from Haemophilus influenzae, i.e. SEQ ID NO: 5 + SEQ ID NO: 6 + SEQ ID NO: 4):

[0142] The enzyme added in the reaction system is 20% of the reaction volume of the bacterial slurry of fusion protein b3, and other reaction conditions are exactly the same as those of the reaction system in which fusion protein a3 is added in this example.

[0143] Fusion protein c3 (the connection order of enzymes is: NRK enzyme derived from Haemophilus influenzae + rigid linker + Ppk enzyme derived from Escherichia coli, i.e. SEQ ID NO: 4 + SEQ ID NO: 15 + SEQ ID NO: 5):

[0144] Among them, the DNA sequence (SEQ ID NO: 15) encoding the rigid linker is:

[0145] GAAGCGGCGGCAAAA

[0146] The enzyme added in the reaction system is 20% of the reaction volume of the bacterial slurry of fusion protein c3, and other reaction conditions are exactly the same as those of the reaction system in which fusion protein a3 is added in this example.

[0147] Fusion protein d3 (the connection order of enzymes is: Ppk enzyme derived from Escherichia coli + rigid linker + NRK enzyme derived from Haemophilus influenzae, i.e. SEQ ID NO: 5 + SEQ ID NO: 15 + SEQ ID NO: 4):

[0148] The enzyme added in the reaction system is 20% of the reaction volume of the bacterial slurry of fusion protein d3, and other reaction conditions are exactly the same as those of the reaction system in which fusion protein a3 is added in this example.

[0149] The conversion rate of NR of the four reaction systems was determined and calculated, and the required amount of anion resin and cation resin per 100 g of product after removing ATP was calculated, and the results are shown in the following table:

[0150]

[0151] As can be seen from Example 6, under the same conditions, the conversion rates of fusion proteins with different linkers and different enzyme connection orders also have great differences. The function of the two enzymes is not affected when the enzymes are connected with a flexible linker, and the conversion efficiency is the highest. When the enzymes are connected with a rigid linker, the function of the enzyme active subunit is affected, resulting in a decrease in enzyme activity.

[0152] Example 7 Study of reaction temperature and pH

[0153] Reaction system a4:

[0154] ATP or its salt 8 mM, magnesium salt 50 mM, NR chloride 80 mM, after being configured into a solution, adjust the solution pH to 5.5, add 20% of the reaction volume of the fusion protein a3 (NRK enzyme derived from Haemophilus influenzae + flexible linker + Ppk enzyme derived from Escherichia coli, i.e. SEQ ID NO: 4 + SEQ ID NO: 6 + SEQ ID NO: 5) slurry, keep the reaction temperature at 40℃, carry out the reaction, monitor the NMN yield by HPLC, and thus calculate the conversion rate of NR to NMN. After 2h of conversion, remove the enzyme from the reaction solution by ultrafiltration, and sequentially remove the residual ATP and its series (ADP, AMP) in the reaction solution by anion resin and cation resin. During the removal process, monitor the residual amount of ATP and its series in the liquid after passing through the resin by HPLC. When the residual amount of ATP and its series in the HPLC is ≤0.05%, it is considered that the removal is completed, and the volume of the used resin is calculated.

[0155] Reaction system b4:

[0156] The reaction system adjusts the solution pH to 7.0, and the reaction temperature is 35℃, and the other reaction conditions are exactly the same as those of reaction system a4.

[0157] Reaction system c4:

[0158] The reaction system adjusts the solution pH to 6.5, and the reaction temperature is 30℃, and the other reaction conditions are exactly the same as those of reaction system a4.

[0159] Reaction system d4:

[0160] The reaction system adjusts the solution pH to 4.0, and the reaction temperature is 28℃, and the other reaction conditions are exactly the same as those of reaction system a4.

[0161] The conversion rate of NR, the amount of anion resin and cation resin required for 100g of product after removing ATP in the four reaction systems are measured and calculated, and the results are shown in the following table:

[0162]

[0163] The enzyme catalysis reactions in Examples 3-6 are all carried out at pH 5.5 and reaction temperature 40℃. In Example 7, we also tried other reaction conditions. According to the results of reaction systems a4-d4, the corresponding enzyme catalysis reactions can also be carried out at pH 4.0-7.0 and temperature 28-40℃. SEQUENCE LISTING <110> Hubei Yuanda Life Science and Technology Co., Ltd. <120> A method for efficiently preparing nicotinamide mononucleotide and a fusion protein <130> P21016264C <160> 17 <170> PatentIn version 3.5 <210> 1 <211> 421 <212> PRT <213> Haemophilus influenzae <400> 1 Met Gly Phe Thr Thr Gly Arg Glu Phe His Pro Ala Leu Arg Met Arg 1 5 10 15 Ala Lys Tyr Asn Ala Lys Tyr Leu Gly Thr Lys Ser Glu Arg Glu Lys 20 25 30 Tyr Phe His Leu Ala Tyr Asn Lys His Thr Gln Phe Leu Arg Tyr Gln 35 40 45 Glu Gln Ile Met Ser Lys Thr Lys Glu Lys Lys Val Gly Val Ile Phe 50 55 60 Gly Lys Phe Tyr Pro Val His Thr Gly His Ile Asn Met Ile Tyr Glu 65 70 75 80 Ala Phe Ser Lys Val Asp Glu Leu His Val Ile Val Cys Ser Asp Thr 85 90 95 Val Arg Asp Leu Lys Leu Phe Tyr Asp Ser Lys Met Lys Arg Met Pro 100 105 110 Thr Val Gln Asp Arg Leu Arg Trp Met Gln Gln Ile Phe Lys Tyr Gln 115 120 125 Lys Asn Gln Ile Phe Ile His His Leu Val Glu Asp Gly Ile Pro Ser 130 135 140 Tyr Pro Asn Gly Trp Gln Ser Trp Ser Glu Ala Val Lys Thr Leu Phe 145 150 155 160 His Glu Lys His Phe Glu Pro Ser Ile Val Phe Ser Ser Glu Pro Gln 165 170 175 Asp Lys Ala Pro Tyr Glu Lys Tyr Leu Gly Leu Glu Val Ser Leu Val 180 185 190 Asp Pro Asp Arg Thr Phe Phe Asn Val Ser Ala Thr Lys Ile Arg Thr 195 200 205 Thr Pro Phe Gln Tyr Trp Lys Phe Ile Pro Lys Glu Ala Arg Pro Phe 210 215 220 Phe Ala Lys Thr Val Ala Ile Leu Gly Gly Glu Ser Ser Gly Lys Ser 225 230 235 240 Val Leu Val Asn Lys Leu Ala Ala Val Phe Asn Thr Thr Ser Ala Trp 245 250 255 Glu Tyr Gly Arg Glu Phe Val Phe Glu Lys Leu Gly Gly Asp Glu Gln 260 265 270 Ala Met Gln Tyr Ser Asp Tyr Pro Gln Met Ala Leu Gly His Gln Arg 275 280 285 Tyr Ile Asp Tyr Ala Val Arg His Ser His Lys Ile Ala Phe Ile Asp 290 295 300 Thr Asp Phe Ile Thr Thr Gln Ala Phe Cys Ile Gln Tyr Glu Gly Lys 305 310 315 320 Ala His Pro Phe Leu Asp Ser Met Ile Lys Glu Tyr Pro Phe Asp Val 325 330 335 Thr Ile Leu Leu Lys Asn Asn Thr Glu Trp Val Asp Asp Gly Leu Arg 340 345 350 Ser Leu Gly Ser Gln Lys Gln Arg Gln Gln Phe Gln Gln Leu Leu Lys 355 360 365 Lys Leu Leu Asp Lys Tyr Lys Val Pro Tyr Ile Glu Ile Glu Ser Pro 370 375 380 Ser Tyr Leu Asp Arg Tyr Asn Gln Val Lys Ala Val Ile Glu Lys Val 385 390 395 400 Leu Asn Glu Glu Glu Ile Ser Glu Leu Gln Asn Thr Thr Phe Pro Ile 405 410 415 Lys Gly Thr Ser Gln 420 <210> 2 <211> 688 <212> PRT <213> Escherichia coli <400> 2 Met Gly Gin Glu Lys Leu Tyr lie Glu Lys Glu Leu Ser Trp Leu Ser 1 5 10 15 Phe Asn Glu Arg Val Leu Gin Glu Ala Ala Asp Lys Ser Asn Pro Leu 20 25 30 lie Glu Arg Met Arg Phe Leu Gly lie Tyr Ser Asn Asn Leu Asp Glu 35 40 45 Phe Tyr Lys Val Arg Phe Ala Glu Leu Lys Arg Arg lie lie lie Ser 50 55 60 Glu Glu Gin Gly Ser Asn Ser His Ser Arg His Leu Leu Gly Lys lie 65 70 75 80 Gln Ser Arg Val Leu Lys Ala Asp Gin Glu Phe Asp Gly Leu Tyr Asn 85 90 95 Glu Leu Leu Leu Glu Met Ala Arg Asn Gin lie Phe Leu lie Asn Glu 100 105 110 Arg Gin Leu Ser Val Asn Gin Gin Asn Trp Leu Arg His Tyr Phe Lys 115 120 125 Gln Tyr Leu Arg Gin His lie Thr Pro lie Leu lie Asn Pro Asp Thr 130 135 140 Asp Leu Val Gin Phe Leu Lys Asp Asp Tyr Thr Tyr Leu Ala Val Glu 145 150 155 160 Ile Ile Arg Gly Asp Thr Ile Arg Tyr Ala Leu Leu Glu Ile Pro Ser 165 170 175 Asp Lys Val Pro Arg Phe Val Asn Leu Pro Pro Glu Ala Pro Arg Arg 180 185 190 Arg Lys Pro Met Ile Leu Leu Asp Asn Ile Leu Arg Tyr Cys Leu Asp 195 200 205 Asp Ile Phe Lys Gly Phe Phe Asp Tyr Asp Ala Leu Asn Ala Tyr Ser 210 215 220 Met Lys Met Thr Arg Asp Ala Glu Tyr Asp Leu Val His Glu Met Glu 225 230 235 240 Ala Ser Leu Met Glu Leu Met Ser Ser Ser Leu Lys Gln Arg Leu Thr 245 250 255 Ala Glu Pro Val Arg Phe Val Tyr Gln Arg Asp Met Pro Asn Ala Leu 260 265 270 Val Glu Val Leu Arg Glu Lys Leu Thr Ile Ser Arg Tyr Asp Ser Ile 275 280 285 Val Pro Gly Gly Arg Tyr His Asn Phe Lys Asp Phe Ile Asn Phe Pro 290 295 300 Asn Val Gly Lys Ala Asn Leu Val Asn Lys Pro Leu Pro Arg Leu Arg 305 310 315 320 His Ile Trp Phe Asp Lys Ala Gin Phe Arg Asn Gly Phe Asp Ala Ile 325 330 335 Arg Glu Arg Asp Val Leu Leu Tyr Tyr Pro Tyr His Thr Phe Glu His 340 345 350 Val Leu Glu Leu Leu Arg Gin Ala Ser Phe Asp Pro Ser Val Leu Ala 355 360 365 Ile Lys Ile Asn Ile Tyr Arg Val Ala Lys Asp Ser Arg Ile Ile Asp 370 375 380 Ser Met Ile His Ala Ala His Asn Gly Lys Lys Val Thr Val Val Val 385 390 395 400 Glu Leu Gin Ala Arg Phe Asp Glu Glu Ala Asn Ile His Trp Ala Lys 405 410 415 Arg Leu Thr Glu Ala Gly Val His Val Ile Phe Ser Ala Pro Gly Leu 420 425 430 Lys Ile His Ala Lys Leu Phe Leu Ile Ser Arg Lys Glu Asn Gly Glu 435 440 445 Val Val Arg Tyr Ala His Ile Gly Thr Gly Asn Phe Asn Glu Lys Thr 450 455 460 Ala Arg Leu Tyr Thr Asp Tyr Ser Leu Leu Thr Ala Asp Ala Arg Ile 465 470 475 480 Thr Asn Glu Val Arg Arg Val Phe Asn Phe Ile Glu Asn Pro Tyr Arg 485 490 495 Pro Val Thr Phe Asp Tyr Leu Met Val Ser Pro Gln Asn Ser Arg Arg 500 505 510 Leu Leu Tyr Glu Met Val Asp Arg Glu Ile Ala Asn Ala Gln Gln Gly 515 520 525 Leu Pro Ser Gly Ile Thr Leu Lys Leu Asn Asn Leu Val Asp Lys Gly 530 535 540 Leu Val Asp Arg Leu Tyr Ala Ala Ser Ser Ser Gly Val Pro Val Asn 545 550 555 560 Leu Leu Val Arg Gly Met Cys Ser Leu Ile Pro Asn Leu Glu Gly Ile 565 570 575 Ser Asp Asn Ile Arg Ala Ile Ser Ile Val Asp Arg Tyr Leu Glu His 580 585 590 Asp Arg Val Tyr Ile Phe Glu Asn Gly Gly Asp Lys Lys Val Tyr Leu 595 600 605 Ser Ser Ala Asp Trp Met Thr Arg Asn Ile Asp Tyr Arg Ile Glu Val 610 615 620 Ala Thr Pro Leu Leu Asp Pro Arg Leu Lys Gln Arg Val Leu Asp Ile 625 630 635 640 Ile Asp Ile Leu Phe Ser Asp Thr Val Lys Ala Arg Tyr Ile Asp Lys 645 650 655 Glu Leu Ser Asn Arg Tyr Val Pro Arg Gly Asn Arg Arg Lys Val Arg 660 665 670 Ala Gln Leu Ala Ile Tyr Asp Tyr Ile Lys Ser Leu Glu Gln Pro Glu 675 680 685 <210> 3 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of flexible linker <400> 3 Lys Glu Ser Gly Ser Val Ser Ser Glu Gin Leu Ala Gin Phe Arg Ser 1 5 10 15 Leu Asp <210> 4 <211> 1263 <212> DNA <213> Haemophilus influenzae <400> 4 atgggtttta ccacaggacg ggagttccat ccggctctta ggatgcgtgc gaagtataac 60 gccaagtatt tgggtaccaa gtcagaacga gagaaatact ttcaccttgc ctataacaag 120 catacacaat tccttcgcta ccaggaacag ataatgtcga agacaaagga aaaaaaggtg 180 ggcgtgatct tcggcaaatt ttacccggtt catacaggtc acatcaacat gatctatgag 240 gcgttttcga aagtcgatga attgcacgtt attgtgtgct cggatacagt gcgagatctc 300 aagctgtttt atgactcgaa aatgaaacga atgccaaccg tacaggatcg gttgagatgg 360 atgcaacaaa tcttcaaata tcaaaaaaat cagattttca tccatcatct tgttgaggac 420 gggatacctt cgtatccaaa cggctggcag tcatggagcg aggctgttaa aacgcttttt 480 cacgagaaac actttgaacc atcaattgtt tttagctcag agccgcaaga caaggctcct 540 tatgagaagt acttaggcct tgaggtgagc ctagtagatc cagatagaac ctttttcaat 600 gttagtgcga cgaaaataag aactacgcca tttcaatatt ggaaattcat tcctaaagaa 660 gctcgtcctt ttttcgcgaa gacggtcgct atcctcggcg gagaatcatc tggcaagtcc 720 gtcttggtga acaaacttgc agcagtattt aatacaacgt cggcatggga gtatgggaga 780 gagtttgtgt tcgagaaact gggaggcgat gagcaagcaa tgcaatattc cgactacccg 840 caaatggctt tggggcacca aaggtacatc gactatgcag ttcggcactc ccataaaatc 900 gcttttatag atacggactt tattacgact caggcgttct gcatacagta cgagggtaaa 960 gcacacccat ttcttgatag catgattaaa gagtatccct tcgacgtgac aatactttta 1020 aagaacaaca cagaatgggt cgatgacggc ttgcgttctc taggctcgca aaaacagcgg 1080 caacagtttc aacagctact gaagaaacta ctggataaat ataaggtgcc atatatagaa 1140 atcgagtcgc catcgtacct ggatcgttat aatcaggtga aggccgtaat agagaaagtc 1200 ttgaacgaag aggaaatctc ggagcttcag aataccactt ttccaataaa aggcacctcc 1260 caa 1263 <210> 5 <211> 2064 <212> DNA <213> Escherichia coli <400> 5 atgggacagg agaaattgta tatagaaaaa gaactgagtt ggctatcgtt caatgaaagg 60 gtcctgcagg aggcagcgga caaatctaac ccgctcatcg aacgcatgcg atttctaggc 120 atctattcca ataatctaga cgagttctac aaggttcggt tcgcggagtt aaagaggcgc 180 atcataataa gtgaggaaca aggaagcaat tcacactcca ggcacctact aggtaagatc 240 caatcgaggg tcctcaaagc tgaccaagaa ttcgacggct tgtacaacga attactcttg 300 gaaatggccc gtaaccagat tttccttatt aacgagagac agctatccgt taaccagcag 360 aactggcttc gtcattattt taagcaatat ctgcgtcagc atatcacgcc tattttaatt 420 aaccccgata cagacctggt gcagttcttg aaggacgact acacgtatct agctgtcgag 480 ataattaggg gagatactat cagatacgcc cttctcgaga ttccatcgga taaggtgcca 540 cgattcgtaa atcttccccc ggaggcccca cgacgcagaa aaccgatgat cttactggac 600 aacattttgc gatattgttt agacgatatc ttcaagggct tctttgacta cgatgccctg 660 aatgcttatt ccatgaaaat gacacgtgat gctgagtacg acttggtaca cgagatggag 720 gctagtctga tggaactaat gtcgtcgtcc ctaaagcagc ggctcacagc ggagcccgtc 780 cgatttgtct atcaacgtga catgcccaat gcactggttg aggtgctacg cgagaaactg 840 acaatatcta gatatgatag tatcgtgcca ggcggacggt atcacaactt caaggacttc 900 atcaatttcc caaatgttgg aaaggccaat ttggttaata aacccttacc gcgattgcgt 960 cacatctggt tcgacaaagc acagttcaga aatgggtttg atgctatacg agaacgagac 1020 gttcttctat attacccata ccacactttc gagcatgtgc ttgagctcct acggcaagca 1080 tcattcgacc cttctgtatt agccataaag ataaatattt accgagtcgc taaggattcc 1140 cgaataatcg atagcatgat acacgcagct cataacggaa agaaagttac agttgtagtc 1200 gagttgcagg ccagatttga tgaagaagca aacatacatt gggccaagcg tctaactgaa 1260 gcaggcgtac acgtcatctt tagcgcaccg ggccttaaaa tacacgcaaa gcttttcttg 1320 atcagccgaa aggaaaatgg ggaggtagtg cgttacgcac atatcggaac aggtaacttc 1380 aatgagaaaa cggctcgtct ttatactgat tactcgctat tgacggccga tgcgaggatt 1440 actaatgaag ttcgccgagt tttcaacttc attgagaatc cttaccgacc agtcaccttc 1500 gactacctta tggtttctcc acaaaacagt agacgtttgc tttatgagat ggtcgatcgg 1560 gagatcgcta atgcacaaca gggtctccct agtggaataa ctttaaaact gaacaacttg 1620 gttgacaaag gcttggtaga tcggctatat gcggcctcca gcagcggcgt gcctgtaaac 1680 ctattggtac gtggaatgtg ctccttgata ccgaacttgg aaggcatcag cgataacatt 1740 cgggctatat cgattgtaga ccggtatctc gaacacgacc gggtttatat cttcgagaac 1800 gggggagaca agaaggtata tctcagcagc gctgactgga tgaccaggaa tattgattac 1860 cgtattgagg tagcaacccc attattagat ccaaggttga agcaacgggt tctagacatt 1920 attgacatat tgttttcgga caccgtgaag gcgaggtata tcgataaaga gctgtctaac 1980 cgatatgtgc cccgcggtaa tcgaaggaag gtgcgtgctc aactcgcaat ttacgattac 2040 attaaatcgt tggaacagcc agag 2064 <210> 6 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence encoding a flexible linker <400> 6 aaggaaagcg ggagtgtttc gagtgaacag ctggcgcagt ttagaagttt ggat 54 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer NRK-BamHI-F <400> 7 cgcggatcca tgggttttac cacaggacg 29 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer NRK-EcoRI-R <400> 8 ggccttaaga atttgggagg tgccttttat tggaa 35 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer Ppk-EcoRI-F <400> 9 ccggaattca tgggacagga gaaattg 27 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer Ppk-HindIII-R <400> 10 cccaagcttc tctggctgtt ccaacg 26 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer NRK-BamHI-F <400> 11 cgcggatcca tgggttttac cacaggacg 29 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer NRK-linker-R <400> 12 ctcccgcttt ccttttggga ggtgcc 26 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer linker-Ppk-F <400> 13 gtttagaagt ttggatggac aggagaaatt g 31 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Primer Ppk-HindIII-R <400> 14 cccaagcttc tctggctgtt ccaacg 26 <210> 15 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of rigid linker <400> 15 gaagcggcgg caaaa 15 <210> 16 <211> 717 <212> DNA <213> Kluyveromyces marxianus <400> 16 atgaccacca ccaaagtgaa actgattgcg attagcggct gcagcagcag cggcaaaacc 60 accctggcga aatttctggc gaacgcgatt ccgggctgca ttctgattca tgaagatgat 120 ttttataaac cggatagcga aattccgatt aacgaaaaat atggcgtggc ggattgggat 180 tgcccggaag cgctggatct ggatgcgttt aaacgcgaac tggatctgat taaaaccacc 240 ggcagcatta aaaccaaact gattcataac gaaaacgtgg atgatattgg caaatttaac 300 attaaacagg aagattggga tgcgctgcgc gcgaaactga gcagcgtgat tgaaagcgat 360 ctgaaagtgg tgctggtgga tggctttatg atttttaacg atgaagaact gatgaaaaaa 420 tttgatattc gcatttttgt gcgcgcgccg tatgaagtgc tgagccgccg ccgccatgcg 480 cgcgcgggct ataaaaccct ggaatcgttt tgggtggatc cgccgtatta ttttgatgaa 540 tttgtgtatc gcgcgtatcg cgaagaacat aaacatctgt ttgtgaacga agatgtggaa 600 ggcagcctgc gcagcgatgc gggcctgttt gaactgatta acgatgatga aaccgaaatt 660 accaaagcgc tgaacaccat tgcggattat attgtgagcc atctggatgc gaactaa 717 <210> 17 <211> 1293 <212> DNA <213> Pseudomonas aeruginosa <400> 17 atggaaacat cggagcgcgg cttgggtttg cctagaactc atcgcgtcgc tctgagtgag 60 agaccacgcc cgcgaagcga gaggcctaga gggttaggac tgaatccccg cgccttagcg 120 gctcttgcag gattgaaccc acgcgcactt gccctttatt cccctagggc gctcgctgcg 180 cgagggccca gagcgctagc agcgctcgct gcgcggggtg cgcgtggggc acttgcacct 240 agagcccgag gtttgtacag tccaagggct cttgccacac accgagcccg gggagcgcgc 300 ggtccaaggg cgcgaggagt cgcactagct ctggcgtcag agcgccctcg tgcgctggcc 360 gggctaaacc tttacagcgc cctagccgcc aggggtgggc tcggcctgat attggaggga 420 ttaaacgcct tagccattct ggagtccgaa cgcggtctaa atctctattc ccctcgcgtc 480 gcccttgcgc tcgccttgga agggttaaac gtagctctcg ctttagcatc agaaagggcc 540 ctcgccccgc gtcatatcag cggtctatac tcggagcgaa gcgagcgagg actagcttcg 600 cccagcgagc ggacgcacag gtccgagcgc gcactagcga gtgaacgatt ggagccgcgc 660 GCGCTAGCAG CCAGCAATAA TATAGGCCAA GGACATACCG GCACATCAGT AC CCACGA 720 GCACGGGGGA TGGAAACAGC GAGAGGTGCT CGGGGCGCTA GTAATGGGCT CACTTACCGG 780 Ggtctcctat attctgccct ggcgctatat tcccatatta gcgcgtctcc tctggaggga 840 Ttaaacattc tagaaggcct gttggagctg gaactatatt cggtagcact gggtttgaac 900 Tctgaacggc acgccccgt agcactattg tatagcgggt taacacatcg tgggttgtac 960 Ggcctaaatg cccgaggtgt agcactcgtc gcgctagtag ccttattgga accccatgaa 1020 Gggctcgggt tatatgcccg cggggcaagt ccggcactlg ccgctttggc cggtttgtat 1080 Ctgtattccg gcctgtacgg gttgtatacc catcggatcc tggaactata ctcagcgcgt 1140 Ggaccccatg agatggagac tggtcttcat atcagtttag aggcatcaaa tcctagggcg 1200 Cggggtggac tatatgctct ggcagcaagg ggcatattgg aggtagcttt ggcgctggcg 1260 Ttagaagggt tattgtacag tccacggtcg gag 1293

Claims

1. A fusion protein, characterized in that, Nicotinamide ribokinase NRK and ATP cycling enzyme are linked together by a linker to form a fusion protein, wherein the ATP cycling enzyme is polyphosphate kinase Ppk derived from Escherichia coli, and the amino acid sequence of Ppk is shown in SEQ ID NO: 2; and the NRK is derived from Haemophilus influenzae, and the amino acid sequence of the NRK is shown in SEQ ID NO:

1. The NRK and Ppk are connected by a linker L, and the structure of the fusion protein is NRK-L-Ppk, with the amino acid sequence of L as shown in SEQ ID NO:

3.

2. An isolated nucleic acid, characterized in that, The nucleic acid encodes the fusion protein as described in claim 1.

3. The isolated nucleic acid as described in claim 2, characterized in that, The nucleotide sequence encoding the NRK is shown in SEQ ID NO: 4; the nucleotide sequence encoding the Ppk is shown in SEQ ID NO: 5; and the nucleotide sequence encoding the L is shown in SEQ ID NO:

6.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the isolated nucleic acid as described in claim 2 or 3.

5. The recombinant expression vector as described in claim 4, characterized in that, The NRK and Ppk are on the same recombinant expression vector.

6. The recombinant expression vector as described in claim 5, characterized in that, The backbone plasmid of the recombinant expression vector is pET28a(+).

7. A transformant, characterized in that, The transformant comprises the isolated nucleic acid as described in claim 2 or 3, or the recombinant expression vector as described in any one of claims 4-6.

8. The transformant as described in claim 7, characterized in that, The transformant was selected from Escherichia coli as the starting strain.

9. The transformant as described in claim 8, characterized in that, The Escherichia coli is E. coli BL21(DE3).

10. A method for preparing a fusion protein, characterized in that, The transformant as described in any one of claims 7-9 is cultured to express the fusion protein, thus obtaining the product.

11. A method for preparing NMN, characterized in that, Using nicotinamide ribose or its salt and ATP or its salt as raw materials, the fusion protein as described in claim 1 is used to catalyze the reaction to produce NMN.

12. The method for preparing NMN as described in claim 11, characterized in that, The reaction also includes magnesium ions and polyphosphates.

13. The method for preparing NMN as described in claim 12, characterized in that, The nicotinamide ribose is nicotinamide ribose chloride, the ATP or its salt is ATP disodium salt, the magnesium ions are from MgCl2, and the polyphosphate is sodium hexametaphosphate; the reaction time is 0.5-2 hours; the pH of the reaction is 4.0-7.0, and the reaction temperature is 28-40℃.

14. The method for preparing NMN as described in claim 13, characterized in that, In the reaction, 8 mM of ATP or its salt, 50 mM of magnesium salt, 80 mM of nicotinamide ribose or nicotinamide ribose chloride, and 8 mM of sodium hexametaphosphate are added, along with 10% to 20% of the reaction volume of a bacterial sludge containing the fusion protein as described in claim 1. The reaction time is 1.5 to 2 hours. And / or, the pH is 5.5, and the reaction temperature is 40°C.

15. The use of the fusion protein as described in claim 1 in the preparation of a catalyst for the production of nicotinamide mononucleotide.

Citation Information

Patent Citations

  • Method for regenerating ATP (adenosine triphosphate) by enzyme process and application thereof

    CN105861598A

  • Nicotinamide ribokinase mutant and application thereof

    CN110373398A

  • Enzymatic synthesis method of beta-nicotinamide mononucleotide

    CN112795606A

  • Nicotinamide ribonucleoside kinase

    US20030175925A1