Process for the preparation of creatinase and fermentation medium

By combining batch fermentation, fed-batch fermentation, and induction phases, and by adding metal salt ion solution during fermentation, the problem of insufficient creatinine enzyme yield and specific activity was solved, achieving efficient creatinine enzyme preparation to meet industrial needs.

CN115820614BActive Publication Date: 2026-06-16WUHAN HANHAI NEW ENZYMES BIOLOGICAL TECH CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WUHAN HANHAI NEW ENZYMES BIOLOGICAL TECH CO LTD
Filing Date
2022-10-21
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

The yield and specific activity of creatinine enzymes in existing technologies are low, making it difficult to meet the needs of industrial application, especially in engineered Escherichia coli where the expression level and specific activity are insufficient.

Method used

A combined fermentation method of batch fermentation, fed-batch fermentation, and induction phase was adopted, and metal salt ion solution was added in at least one stage. By adding the solution in a fed-batch or intermittent manner, the metal ions in the fermentation broth were ensured to bind to the active site of creatinine enzyme, thereby increasing the expression level and specific activity of creatinine enzyme.

🎯Benefits of technology

The expression level and specific activity of creatinine enzyme were significantly improved. The enzyme activity of creatinine enzyme in the fermentation broth reached 14268 U/mL, and the specific activity after purification reached 2546 U/mg, which meets the requirements of industrialization.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820614B_ABST
    Figure CN115820614B_ABST
Patent Text Reader

Abstract

The present application relates to a preparation method of creatinase and a fermentation medium, and the method comprises the following steps: performing batch fermentation on a recombinant engineering bacterium carrying a creatinase gene; performing fed-batch fermentation when the carbon source of the fermentation liquor is depleted and the dissolved oxygen begins to recover; performing induction expression when the OD600 of the fermentation liquor is 20-40 to obtain creatinase; and adding a metal salt ion solution to the fermentation liquor in at least one stage during the fermentation process. The fed-batch fermentation can ensure that the bacterium obtains sufficient nutrition, and the addition of the metal salt ion solution in any stage during the fermentation process can make the fermentation liquor have a certain concentration of metal ions after the induction starts, and the metal ions are combined with the active center of the creatinase to greatly improve the expression amount and specific activity of the creatinase. Through test verification, the recombinant escherichia coli is subjected to 5L fermentation by using the above preparation method, the wet weight of the bacterium slurry is 171g / L, the enzyme activity of the creatinase is 14268U / mL, and the specific activity of the purified creatinase is 2546U / mg.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing creatinine enzyme and a fermentation culture medium. Background Technology

[0002] Creatinase, also known as creatinine amide hydrolase (EC 3.5.2.10), catalyzes the reversible conversion of creatinine to creatine. Each subunit of creatinase binds two Zn atoms. 2+ An ion, Zn in one of the binding sites 2+ It can be replaced when Zn 2+ When creatinine enzymes are replaced by other metal ions, their activity also changes.

[0003] Creatinine in the human body mainly originates from muscle metabolism and the metabolism of ingested meat. After being filtered by the glomeruli, creatinine is not reabsorbed by the renal tubules. Creatinine levels in blood and urine reflect glomerular filtration function and are of great significance for the diagnosis of kidney diseases. The classic alkaline picric acid method for creatinine detection has poor specificity and is easily interfered with by various "pseudo-creatinine" substances in the blood. Furthermore, creatinine detection methods related to mass spectrometry, liquid chromatography, and electrophoresis are costly and complex. Enzymatic methods for creatinine detection offer high specificity, simple operation, and good stability, and are gradually gaining attention from relevant testing institutions. The demand for enzyme-based creatinine detection kits is also increasing daily. Creatinase, as one of the core enzymes in enzymatic methods for creatinine detection, has significant economic value in the medical testing industry.

[0004] Currently, creatinine enzymes have only been found in some wild-type bacteria such as Pseudomonas, Corynebacterium, and Arthrobacter. However, wild-type bacteria are difficult to culture, and the yield of creatinine enzymes is extremely low, making industrial utilization difficult. Researchers have introduced the creatinine enzyme gene into engineered Escherichia coli and successfully obtained expression, but the expression level and specific activity of creatinine enzymes are both low. How to improve the yield and specific activity of creatinine enzymes remains an urgent problem to be solved. Summary of the Invention

[0005] Therefore, it is necessary to provide a method for preparing creatinine enzyme that can improve the yield and specific activity of creatinine enzyme.

[0006] A method for preparing creatinine enzyme, comprising the following steps:

[0007] Batch fermentation stage: Recombinant Escherichia coli carrying the creatinine enzyme gene is inoculated into the fermentation medium for batch fermentation;

[0008] Feeded fermentation stage: Feeded fermentation is carried out when the carbon source of the fermentation broth is exhausted and dissolved oxygen begins to rise.

[0009] Induction phase: When the OD600 of the fermentation broth reaches 20-40 during fed-batch fermentation, induced expression is performed to obtain creatinine enzyme;

[0010] In at least one of the batch fermentation stage, the fed-batch fermentation stage, and the induction stage, a metal salt ion solution is added to the fermentation broth, and the metal salt ion solution is added to the fermentation broth in a fed-batch or intermittent manner.

[0011] The above-described method for preparing creatinine enzyme ensures that recombinant *E. coli* receives sufficient nutrients through fed-batch fermentation. Furthermore, the addition of metal salt ion solution at any stage—batch fermentation, fed-batch fermentation, or induction—ensures a certain concentration of metal ions in the fermentation broth after induction. These metal ions bind to the active site of creatinine enzyme produced by the induced metabolism of recombinant *E. coli*, significantly increasing the expression level and specific activity of creatinine enzyme. Experimental results show that using this method to ferment recombinant *E. coli* in a 5L fermenter, the wet weight of the engineered *E. coli* sludge reached 171 g / L, the creatinine enzyme activity in the fermentation broth reached 14268 U / mL, and the specific activity of the purified creatinine enzyme reached 2546 U / mg.

[0012] In one embodiment, the step of adding the metal salt ion solution to the fermentation broth during the induction phase includes: adding the metal salt ion solution to the fermentation broth after adding the inducer to start inducing expression.

[0013] In one embodiment, the metal salt ion solution is added by flow addition for 4-15 hours and the induction time is 10-20 hours.

[0014] In one embodiment, the inducing agent in the induction phase is isopropyl thiogalactoside, the concentration of the inducing agent is 0.1 mM-1.5 mM, and the induction temperature is 20°C-37°C.

[0015] In one embodiment, the concentration of the inducer is 0.5 mM and the induction temperature is 25°C.

[0016] In one embodiment, the metal salt ion solution is a single metal salt ion solution, wherein the metal ion in the metal salt ion solution is selected from one of the following ions based on the volume of the fermentation medium: 0.5 mM-5 mM Fe. 2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ .

[0017] In one embodiment, the metal salt ion solution is a complex metal salt ion solution, wherein the metal ions in the metal salt ion solution are selected from at least two of the following ions based on the volume of the fermentation medium: 0.5 mM-5 mM Fe2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ 0.5mM-5mM Ni 2+ 0.5mM-10mM Co 2 + .

[0018] In one embodiment, when the metal salt ion solution is a single metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+ MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ It is CaCl2.

[0019] In one embodiment, when the metal salt ion solution is a composite metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+ MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ For CaCl2, Ni 2+ It is NiCl2 or NiSO4, Co 2+ It is CoCl2.

[0020] In one embodiment, the step of inoculating recombinant Escherichia coli carrying the creatinine enzyme gene into a fermentation medium for batch fermentation includes:

[0021] The recombinant Escherichia coli culture was inoculated into test tube culture medium at a volume concentration of 0.05%-0.5% and cultured at 37°C and 200 rpm for 10-20 hours to obtain the primary seed culture.

[0022] The primary seed culture was inoculated into a shake flask culture medium at a volume concentration of 0.05%-0.5% and cultured at 37°C and 200 rpm for 6-10 hours to obtain the recombinant Escherichia coli in the logarithmic growth phase.

[0023] The seed culture of the recombinant Escherichia coli in the logarithmic phase was added to the fermentation medium at an inoculation rate of 5%-10% by volume for batch fermentation.

[0024] In one embodiment, the batch fermentation conditions include: a rotation speed of 200 rpm to 750 rpm, an aeration rate of 0.5 vvm to 2 vvm, a fermentation temperature of 37°C, and a tank pressure of 0.02 MPa to 0.07 MPa.

[0025] In one embodiment, the fed-batch fermentation medium includes: 200 g / L-800 g / L glucose, 0.4 mg / L-6 mg / L Na2MoO4·2H2O, 2 mg / L-15 mg / L FeCl3·6H2O, and 0.3 mg / L-1.5 mg / L H3BO3.

[0026] In one embodiment, dissolved oxygen is controlled at 30% ± 10% during fed-batch fermentation.

[0027] In one embodiment, the creatinine enzyme gene fragment has at least one of the following features (a) and (b):

[0028] (a) It has more than 95% homology with the nucleotide sequence shown in SEQ ID No. 1;

[0029] (b) Encoding the creatinine enzyme, wherein the amino acid sequence of the creatinine enzyme includes the amino acid sequence shown in SEQ ID No. 2.

[0030] A fermentation medium for preparing the above-mentioned creatinine enzyme comprises: 4 g / L-40 g / L yeast extract, 5 g / L-40 g / L peptone, 5 g / L-40 g / L glucose, 1 g / L-15 g / L Tween 80, 2 g / L-20 g / L sodium acetate, 1.5 g / L-15 g / L glycerol, 2 g / L-15 g / L KH₂PO₄, 2 g / L-15 g / L K₂HPO₄·3H₂O, 4 g / L-20 g / L (NH₄)₂SO₄, and 0.04 g / L-0.5 g / L... The following are the concentrations of CaCl2, 0.5 g / L-5 g / L MgSO4·7H2O, 2 mg / L-15 mg / L NaCl, 2 mg / L-20 mg / L MnCl2·4H2O, 1 mg / L-10 mg / L ZnSO4·7H2O, 0.4 mg / L-8 mg / L Na2MoO4·2H2O, 2 mg / L-15 mg / L FeCl3·6H2O, 0.3 mg / L-5 mg / L H3BO3, and 0.2 mg / L-5 mg / L CuSO4·5H2O.

[0031] In one embodiment, the following are included: 20 g / L yeast extract, 20 g / L peptone, 5 g / L glucose, 2 g / L Tween 80, 5 g / L sodium acetate, 5 g / L glycerol, 2 g / L KH2PO4, 10 g / L K2HPO4·3H2O, 10 g / L (NH4)2SO4, 0.3 g / L CaCl2, 0.6 g / L MgSO4·7H2O, 10 mg / L NaCl, 2 mg / L MnCl2·4H2O, 8 mg / L ZnSO4·7H2O, 5 mg / L Na2MoO4·2H2O, 2 mg / L FeCl3·6H2O, 4 mg / L H3BO3, and 5 mg / L CuSO4·5H2O. Attached Figure Description

[0032] Figure 1 The image shows the SDS-PAGE of the creatinine enzyme produced by fermentation in Example 1 (1 is the sample loaded onto the column after pretreatment in Example 1, 2 is the elution sample during the purification process of Example 1, and 3 is the marker).

[0033] Figure 2 This is a graph showing the change in creatinine enzyme activity of the fermentation broth in Example 7 over the duration of induction. Detailed Implementation

[0034] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to specific examples and accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0035] The embodiments of this study provide a method for preparing creatinine enzyme, comprising the following steps:

[0036] Batch fermentation stage: Recombinant Escherichia coli carrying the creatinine enzyme gene is inoculated into the fermentation medium for batch fermentation;

[0037] Feeded fermentation stage: Feeded fermentation is carried out when the carbon source of the fermentation broth is exhausted and dissolved oxygen begins to rise.

[0038] Induction phase: When the OD600 of the fermentation broth drops to 20-40 during fed-batch fermentation, induced expression is performed to obtain creatinine enzyme;

[0039] In at least one of the batch fermentation stage, fed-batch fermentation stage, and induction stage, a metal salt ion solution is added to the fermentation broth. The metal salt ion solution is added to the fermentation broth either fed-batch or intermittently.

[0040] The above-described method for preparing creatinine enzyme ensures that recombinant *E. coli* receives sufficient nutrients through fed-batch fermentation. Furthermore, the addition of metal salt ion solution at any stage—batch fermentation, fed-batch fermentation, or induction—ensures a certain concentration of metal ions in the fermentation broth after induction. These metal ions bind to the active site of creatinine enzyme produced by the induced metabolism of recombinant *E. coli*, significantly increasing the expression level and specific activity of creatinine enzyme. Experimental results show that using this method to ferment recombinant *E. coli* in a 5L fermenter, the wet weight of the engineered *E. coli* sludge reached 171 g / L, the creatinine enzyme activity in the fermentation broth reached 14268 U / mL, and the specific activity of the purified creatinine enzyme reached 2546 U / mg.

[0041] Among them, cells capable of expressing creatinine enzymes are those carrying coding sequences that have at least one of the following characteristics (a) and (b):

[0042] (a) It has more than 95% homology with the nucleotide sequence shown in SEQ ID No. 1;

[0043] (b) Encodes creatinine enzyme, the amino acid sequence of which includes the amino acid sequence shown in SEQ ID No. 2.

[0044] Among them, the nucleotide sequence shown in SEQ ID No. 1 is the creatinine enzyme gene derived from *Pseudomonas putida*.

[0045] Specifically, the sequence shown in SEQ ID No. 1 is as follows:

[0046] ATGAGCAAGAGTGTTTTTGTAGGTGAGCTGACCTGGAAGGAGTACGAGGCGCGTGTCGCGGCAGGTGACTGCGTGCTCATGCTGCCGGTCGGCGCCCTGGAACAGCACGGCCATCACATGTGCATGAACGTCGATGTGCTGCTGCCCACGGCGGTGTGCAAGCGGGTCGCCGAGCGCATTGGTGCGCTGGTCATGCCGGGGCTGCAGTACGGCTACAAGTCCCAGCAGAAGTCCGGCGGCGGCAATCACTTCCCCGGCACCACCAGCCTGGATGGCGCCACCCTGACTGGCACGGTGCAGGACATCATCCGCGAGCTGGCGCGCCATGGTGCGCGTCGCCTGGTACTGATGAACGGCCACTACGAAAATTCCATGTTCATCGTCGAAGGCATCGACCTCGCCCTGCGCGAGCTGCGCTATGCCGGCATCCAGGACTTCAAAGTGGTGGTGCTCTCCTACTGGGACTTCGTCAAGGACCCGGCTGTGATCCAGCAGCTCTATCCCGAGGGCTTCCTCGGCTGGGACATCGAGCACGGCGGCGTCTTCGAGACCTCCCTGATGCTGGCTTTGTACCCGGACCTGGTGGACCTGGACCGCGTCGTCGATCACCCACCTGCAACCTTCCCACCCTATGACGTGTTTCCGGTCGACCCGGCCCGTACGCCGGCGCCGGGCACTCTGTCGTCGGCGAAGACGGCCAGCCGAGAGAAGGGCGAGTTGATCCTGGAGGTCTGCGTCCAGGGCATTGCCGACGCTATCCGCGAGGAGTTCCCGCCCACCTGA。

[0047] The sequence shown in SEQ ID No.2 is as follows:

[0048] MSKSVFVGEL TWKEYEARVA AGDCVLMLPV GALEQHGHHM CMNVDVLLPT AVCKRVAERIGALVMPGLQY GYKSQQKSGG GNHFPGTTSL DGATLTGTVQ DIIRELARHG ARRLVLMNGH YENSMFIVEGIDDLALRELRY AGIQDFKVVV LSYWDFVKDP AVIQQLYPEG FLGWDIEHGG VFETSLMLAL YPDLVDLDRVVDHPPATFPP YDVFPVDPAR TPAPGTLSSA KTASREKGEL ILEVCVQGIA DAIREEFPPT.

[0049] Any base deletions, substitutions, additions, or optimizations made based on this nucleotide sequence, or based on this amino acid sequence, are within the scope of this application.

[0050] The *E. coli* strain selected was BL21. Using this host bacterium facilitates efficient and stable expression of creatinine enzymes. Furthermore, the engineered *E. coli* strain exhibits kanamycin resistance.

[0051] In some embodiments, the metal salt ion solution is a single metal salt ion solution. Further, the metal ion in the single metal salt ion solution is selected from one of the following ions based on the volume of the fermentation medium: 0.5 mM-5 mM Fe. 2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ .

[0052] In some embodiments, the metal salt ion solution is a complex metal salt ion solution. Further, the metal ions in the complex metal salt ion solution are selected from at least two of the following ions based on the fermentation medium volume: 0.5 mM-5 mM Fe... 2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ 0.5mM-5mM Ni 2+ 0.5mM-10mM Co 2 + .

[0053] In some embodiments, when the metal salt ion solution is a single metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ It is CaCl2.

[0054] In some embodiments, when the metal salt ion solution is a complex metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+ MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ For CaCl2, Ni 2+ It is NiCl2 or NiSO4, Co 2+ It is CoCl2.

[0055] In a specific example, the metal salt ion solution includes: 4 mM Fe 2+ 4mM Mn 2+ 8mM Mg 2+ 8mM Ca 2+ 2mM Ni 2+ 4mM Co 2+ Compared with solutions without added metal salt ions, the expression level and specific activity of creatinine enzyme were increased by more than 3 times under these conditions.

[0056] In some embodiments, the metal salt ion solution is added to the fermentation broth via a fed-batch method. It should be noted that the method of adding the metal salt ion solution is not limited to fed-batch addition; it can also be done intermittently.

[0057] In some embodiments, the stage of adding metal salt ion solution to the fermentation broth is the induction stage. Specific steps include: adding the metal salt ion solution to the fermentation broth after inducing expression with an inducer. Further, the metal salt ion solution is added in a fed-batch manner for 4-15 hours, with an induction time of 10-20 hours. It should be noted that the stage of adding metal salt ion solution to the fermentation broth is not limited to the induction stage; it can also be done at other stages, such as in the batch fermentation stage and / or the fed-batch fermentation stage, or even in all three stages.

[0058] In some embodiments, the inducer during the induction phase is isopropyl thiogalactoside, with a concentration of 0.1 mM-1.5 mM, an induction temperature of 20°C-37°C, and an induction duration of 10-20 h. These conditions are conducive to the efficient and high-activity expression of creatinine enzyme. In one specific example, the inducer concentration is 0.5 mM, the induction temperature is 25°C, and the induction duration is 16 h.

[0059] In some embodiments, the fermentation medium for batch fermentation comprises: 4 g / L-40 g / L yeast extract, 5 g / L-40 g / L peptone, 5 g / L-40 g / L glucose, 1 g / L-15 g / L Tween 80, 2 g / L-20 g / L sodium acetate, 1.5 g / L-15 g / L glycerol, 2 g / L-15 g / L KH₂PO₄, 2 g / L-15 g / L K₂HPO₄·3H₂O, 4 g / L-20 g / L (NH₄)₂SO₄, and 0.04 g / L-0.5 g / L... The following are the concentrations of CaCl2, 0.5 g / L-5 g / L MgSO4·7H2O, 2 mg / L-15 mg / L NaCl, 2 mg / L-20 mg / L MnCl2·4H2O, 1 mg / L-10 mg / L ZnSO4·7H2O, 0.4 mg / L-8 mg / L Na2MoO4·2H2O, 2 mg / L-15 mg / L FeCl3·6H2O, 0.3 mg / L-5 mg / L H3BO3, and 0.2 mg / L-5 mg / L CuSO4·5H2O.

[0060] The main function of yeast extract is to provide the carbon source, nitrogen source, inorganic salts, and some growth factors required for the growth of *E. coli*, participating in the formation of cellular material. The carbon source provides energy for cell growth; the nitrogen source provides raw materials for the synthesis of various intracellular proteins; inorganic salts are components of enzymes, maintaining enzyme activity and regulating cellular osmotic pressure, hydrogen ion concentration, and redox potential; growth factors provide organic matter that cells cannot synthesize themselves but is essential for microbial growth, including organic substances such as amino acids, vitamins, purines, pyrimidines, and their derivatives. In some embodiments, the yeast extract content is 4 g / L-40 g / L. This content range is beneficial for improving the production and activity of creatinine enzymes in cells. In some embodiments, the yeast extract content is 4 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 35 g / L, or 40 g / L.

[0061] The main function of peptone is to provide the nitrogen source required for the growth of *E. coli*, and after decomposition, it provides raw materials for the synthesis of various intracellular proteins. In some embodiments, the peptone content is 5 g / L-40 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the peptone content is 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 35 g / L, or 40 g / L.

[0062] Glucose serves to provide the carbon source required for the growth of *E. coli*, participate in the formation of cellular material, and provide energy for cell growth. In some embodiments, the glucose content is 5 g / L-40 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the glucose content is 5 g / L, 10 g / L, 15 g / L, 20 g / L, 25 g / L, 30 g / L, 35 g / L, or 40 g / L.

[0063] Tween 80 acts as an emulsifier, promoting the dissolution of insoluble substances. In some embodiments, the content of Tween 80 is 1 g / L-15 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of Tween 80 is 1 g / L, 3 g / L, 5 g / L, 7 g / L, 9 g / L, 11 g / L, 13 g / L, or 15 g / L.

[0064] Sodium acetate serves to provide inorganic salts and act as a buffer for acetate ions. In some embodiments, the sodium acetate concentration is 2 g / L–20 g / L. This concentration range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the sodium acetate concentration is 2 g / L, 5 g / L, 10 g / L, 15 g / L, or 20 g / L.

[0065] Glycerol serves to provide a carbon source. In some embodiments, the glycerol content is 1.5 g / L–15 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the glycerol content is 1.5 g / L, 3 g / L, 5 g / L, 7 g / L, 9 g / L, 11 g / L, 13 g / L, or 15 g / L.

[0066] The role of KH₂PO₄ is to provide phosphorus and act as a pH buffer. Phosphorus is an essential component of nucleic acids, nucleoproteins, phospholipids, enzymes, and adenosine triphosphate (ATP), participating in heredity, enzyme synthesis, and energy transfer. In some embodiments, the KH₂PO₄ content is 2 g / L-15 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the KH₂PO₄ content is 2 g / L, 3 g / L, 5 g / L, 7 g / L, 9 g / L, 11 g / L, 13 g / L, or 15 g / L.

[0067] The role of K₂HPO₄·3H₂O is to provide phosphorus and act as a pH buffer. In some embodiments, the content of K₂HPO₄·3H₂O is 2 g / L-15 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of K₂HPO₄·3H₂O is 2 g / L, 3 g / L, 5 g / L, 7 g / L, 9 g / L, 11 g / L, 13 g / L, or 15 g / L.

[0068] The role of (NH4)2SO4 is to provide an inorganic nitrogen source and sulfur, which participates in the formation of disulfide bonds and is related to protein folding. In some embodiments, the content of (NH4)2SO4 is 4 g / L-20 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of (NH4)2SO4 is 4 g / L, 8 g / L, 10 g / L, 12 g / L, 14 g / L, 16 g / L, 18 g / L, or 20 g / L.

[0069] The role of CaCl2 is to provide inorganic salts. In some embodiments, the CaCl2 content is 0.04 g / L-0.5 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the CaCl2 content is 0.04 g / L, 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, or 0.5 g / L.

[0070] The role of MgSO4·7H2O is to provide inorganic salts. In some embodiments, the content of MgSO4·7H2O is 0.5 g / L-5 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of MgSO4·7H2O is 0.5 g / L, 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L.

[0071] The role of NaCl is to provide inorganic salts. In some embodiments, the NaCl concentration is 2 mg / L-15 mg / L. This concentration range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the NaCl concentration is 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L, 12 mg / L, or 15 mg / L.

[0072] The function of MnCl2·4H2O is to provide inorganic salts. In some embodiments, the content of MnCl2·4H2O is 2 mg / L-20 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of MnCl2·4H2O is 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L, 12 mg / L, 15 mg / L, 17 mg / L, 19 mg / L, or 20 mg / L.

[0073] The function of ZnSO4·7H2O is to provide inorganic salts. In some embodiments, the content of ZnSO4·7H2O is 1 mg / L-10 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of ZnSO4·7H2O is 1 mg / L, 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, or 10 mg / L.

[0074] The function of Na₂MoO₄·2H₂O is to provide inorganic salts. In some embodiments, the content of Na₂MoO₄·2H₂O is 0.4 mg / L-8 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of Na₂MoO₄·2H₂O is 0.4 mg / L, 1 mg / L, 2 mg / L, 4 mg / L, 6 mg / L, or 8 mg / L.

[0075] The function of FeCl3·6H2O is to provide inorganic salts. In some embodiments, the content of FeCl3·6H2O is 2 mg / L-15 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of FeCl3·6H2O is 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L, 12 mg / L, or 15 mg / L.

[0076] The role of H3BO3 is to provide boron and act as a pH buffer; boron participates in cellular synthesis. In some embodiments, the H3BO3 content is 0.3 mg / L-5 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the H3BO3 content is 0.3 mg / L, 0.5 mg / L, 1 mg / L, 1.5 mg / L, 2 mg / L, 2.5 mg / L, 3 mg / L, 3.5 mg / L, 4 mg / L, 4.5 mg / L, or 5 mg / L.

[0077] The function of CuSO4·5H2O is to provide inorganic salts. In some embodiments, the content of CuSO4·5H2O is 0.2 mg / L-5 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of CuSO4·5H2O is 0.2 mg / L, 0.5 mg / L, 1 mg / L, 1.5 mg / L, 2 mg / L, 2.5 mg / L, 3 mg / L, 3.5 mg / L, 4 mg / L, 4.5 mg / L, or 5 mg / L.

[0078] The fermentation medium for batch fermentation also includes a solvent. The solvent is deionized water or distilled water. Specifically, the fermentation medium contains a residual amount of solvent.

[0079] In a specific example, the batch fermentation medium includes: 20 g / L yeast extract, 20 g / L peptone, 5 g / L glucose, 2 g / L Tween 80, 5 g / L sodium acetate, 5 g / L glycerol, 2 g / L KH₂PO₄, 10 g / L K₂HPO₄·3H₂O, 10 g / L (NH₄)₂SO₄, 0.3 g / L CaCl₂, 0.6 g / L MgSO₄·7H₂O, 10 mg / L NaCl, 2 mg / L MnCl₂·4H₂O, 8 mg / L ZnSO₄·7H₂O, 5 mg / L Na₂MoO₄·2H₂O, 2 mg / L FeCl₃·6H₂O, 4 mg / L H₃BO₃, and 5 mg / L CuSO₄·5H₂O. This fermentation medium, with its reasonable proportions, is beneficial for improving the production and activity of creatinine enzymes in cells.

[0080] In some embodiments, the batch fermentation conditions include: an inoculum of 5%-10% (v / v) of recombinant Escherichia coli carrying the creatinine enzyme gene, a rotation speed of 200-750 rpm, an aeration rate of 0.5 vvm-2 vvm, a fermentation temperature of 37°C, and a tank pressure of 0.02 MPa-0.07 MPa.

[0081] In one specific example, the inoculum size of recombinant E. coli carrying the creatinine enzyme gene was 5%, and the ventilation rate was 2 vvm.

[0082] In a specific example, during the fermentation process, the rotation speed is controlled at 200 rpm at the beginning of fermentation, and the rotation speed is increased by 50 rpm whenever the dissolved oxygen is lower than 30%; when the rotation speed reaches 750 rpm, it remains unchanged, and fermentation continues until the dissolved oxygen begins to rebound and then supplemental fermentation is carried out.

[0083] In some embodiments, the fed-batch fermentation medium includes: 200 g / L-800 g / L glucose, 0.4 mg / L-6 mg / L Na2MoO4·2H2O, 2 mg / L-15 mg / L FeCl3·6H2O, and 0.3 mg / L-1.5 mg / L H3BO3.

[0084] The role of glucose is to provide a carbon source. In some embodiments, the glucose content is 200 g / L-800 g / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the glucose content is 200 g / L, 250 g / L, 300 g / L, 350 g / L, 400 g / L, 450 g / L, 500 g / L, 550 g / L, 600 g / L, 650 g / L, 700 g / L, 750 g / L, or 800 g / L.

[0085] The function of Na₂MoO₄·2H₂O is to provide inorganic salts. In some embodiments, the content of Na₂MoO₄·2H₂O is 0.4 mg / L-6 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of Na₂MoO₄·2H₂O is 0.4 mg / L, 1 mg / L, 2 mg / L, 3 mg / L, 4 mg / L, 5 mg / L, or 6 mg / L.

[0086] The function of FeCl3·6H2O is to provide inorganic salts. In some embodiments, the content of FeCl3·6H2O is 2 mg / L-15 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the content of FeCl3·6H2O is 2 mg / L, 4 mg / L, 6 mg / L, 8 mg / L, 10 mg / L, 12 mg / L, or 15 mg / L.

[0087] The role of H3BO3 is to provide boron and act as a pH buffer. In some embodiments, the H3BO3 content is 0.3 mg / L-1.5 mg / L. This content range is beneficial for increasing the production and activity of creatinine enzymes in cells. In some embodiments, the H3BO3 content is 0.3 mg / L, 0.5 mg / L, 0.7 mg / L, 0.9 mg / L, 1.1 mg / L, 1.3 mg / L, or 1.5 mg / L.

[0088] The fed-batch culture medium also includes a solvent. The solvent is deionized water or distilled water. Specifically, the fed-batch culture medium contains a residual amount of solvent.

[0089] In one specific example, the fed medium consists of 300 g / L glucose, 5 mg / L Na₂MoO₄·2H₂O, 2 mg / L FeCl₃·6H₂O, and 1.2 mg / L H₃BO₃. This fed medium has a reasonable ratio and is beneficial for improving the production and activity of creatinine enzymes in cells.

[0090] Among them, the feeding is controlled automatically by the fermentation system, and the dissolved oxygen is controlled at 30% ± 10% during the feeding fermentation process.

[0091] The step of inoculating recombinant E. coli carrying the creatinine enzyme gene into the fermentation medium for batch fermentation includes the following steps: S110-S130:

[0092] S110. The recombinant Escherichia coli culture was inoculated into a test tube culture medium and cultured to obtain a primary seed culture.

[0093] Specifically, the recombinant Escherichia coli culture was inoculated into LB test tube medium at a volume concentration of 0.05%-0.5% and cultured at 37℃ and 200rpm for 10-20 hours to obtain the primary seed culture.

[0094] S120. The primary seed culture was inoculated into a shake flask culture medium and cultured to the logarithmic growth phase to obtain recombinant Escherichia coli in the logarithmic growth phase.

[0095] Specifically, the primary seed culture was inoculated into LB shake flask medium at a volume concentration of 0.05%-0.5% and cultured at 37℃ and 200rpm for 6-10 hours to obtain recombinant Escherichia coli in the logarithmic growth phase.

[0096] S130. The seed culture of the logarithmic phase recombinant Escherichia coli engineered bacteria is added to the fermentation medium at an inoculation rate of 5%-10% by volume for batch fermentation.

[0097] The process includes purifying the fermentation broth after the induction of expression. Further, the purification method is nickel ion affinity chromatography. Specifically, the purification steps for the fermentation broth include steps S210-S260:

[0098] S210. Pretreatment of Chromatographic Samples: The fermentation broth is subjected to solid-liquid separation to obtain bacterial sludge. Take 10g of bacterial sludge, resuspend it in a buffer (20mM pH 7.5 Tris-HCl) and bring the volume to 100mL. Homogenize the resuspended solution at 680Pa-720Pa for 5min. Add 500mM NaCl to the homogenized solution, then centrifuge at 10000rpm for 15min. Filter through a 0.45nm pore size membrane to obtain the sample for column loading, while retaining the sample. The solid-liquid separation method is not limited; for example, centrifugation or filtration can be used.

[0099] Preparation of S220 nickel ion affinity chromatography column: Take out the nickel ion affinity chromatography column, add about one-quarter of the column volume of nickel ion-containing packing material, rinse the packing material in the column with 10 times the packing material volume of 20% ethanol, then rinse the packing material in the column with 10 times the packing material volume of distilled water, then rinse the column with 5 times the packing material volume of equilibration solution (20mM pH7.5 Tris-HCl, 500mM NaCl) and seal the column.

[0100] S230, Sample loading: Add 5 times the volume of the loading sample to the nickel ion affinity chromatography column, and retain the sample after the entire volume is added.

[0101] S240, Washing: Pass the column with 5 times the volume of the packing material equilibration solution (20mM pH7.5 Tris-HCl, 500mM NaCl), and retain the sample after the addition is complete; pass the column with 5 times the volume of the packing material washing solution (20mM pH7.5 Tris-HCl, 500mM NaCl, 20mM pH7.5 imidazole), and retain the sample after the addition is complete.

[0102] S250, Elution: Pass 5 times the volume of the packing material into the column with the eluent (20mM pH7.5 Tris-HCl, 200mM pH7.5 imidazole). After the eluent is completely added, retain the sample as the elution sample.

[0103] S260, Column washing: Pass the column through 5 times the volume of the packing material with washing solution (500mM pH7.5 imidazole), and retain the sample after the solution has been added.

[0104] Furthermore, the fermentation broth and purified samples after fermentation need to be tested for enzyme activity, and the specific activity of the purified creatinine enzyme needs to be calculated. Specifically, the creatinine enzyme activity detection method includes the following steps S310-S330:

[0105] S310. Sample absorbance determination: Add 0.1 mL of 0.3 mol / L pH 6.5 phosphate buffer and 0.8 mL of 0.1 mol / L creatinine solution to the same test tube and preheat at 37℃ for 5 min; add 0.1 mL of sample to the test tube and react at 37℃ for 10 min; add 2 mL of 4% (w / w) Na₂CO₃ to terminate the reaction and cool in ice water to obtain the test solution; add 0.1 mL of the test solution, 0.9 mL of distilled water, 0.5 mL of 2% α-naphthol solution, 0.5 mL of alkaline solution containing 1.2% (w / w) NaOH and 3.2% (w / w) Na₂CO₃, and 0.5 mL of 0.05% (w / w) diacetyl solution to the same test tube, mix well, and let stand at 25℃ for 1 h; add 2.5 mL of distilled water and read the absorbance at 525 nm, which is recorded as AS.

[0106] S320. Blank control absorbance determination: Add 0.1 mL of 0.3 mol / L pH 6.5 phosphate buffer and 0.8 mL of 0.1 mol / L creatinine solution to the same test tube and preheat at 37℃ for 5 min; add 2 mL of 4% (w / w) Na2CO3 to the test tube and react at 37℃ for 10 min, then add 0.1 mL of sample and cool in ice water to obtain the test solution; add 0.1 mL of the test solution, 0.9 mL of distilled water, 0.5 mL of 2% α-naphthol solution, 0.5 mL of alkaline solution containing 1.2% (w / w) NaOH and 3.2% (w / w) Na2CO3, and 0.5 mL of 0.05% (w / w) diacetyl solution to the same test tube, mix well, and let stand at 25℃ for 1 h; add 2.5 mL of distilled water and read the absorbance at 525 nm, which is recorded as A0.

[0107] S330, calculate enzyme activity and specific enzyme activity.

[0108] Enzyme activity is defined as the amount of creatinine enzyme required to hydrolyze a substrate to produce 1 μmol of creatine in a reaction solution at 37°C and pH 6.8, which is 1 unit of activity (U).

[0109] The formula for calculating enzyme activity is:

[0110] Enzyme activity per unit volume (U / mL) = (A S -A0)×1.0(mL)df / [0.0704×1.0(mL)×10(min)]=(A S -A0)×14.2×df, where A S A0 represents the absorbance of the sample at 525 nm, A0 represents the absorbance of the blank control at 525 nm, df represents the dilution factor, and 0.0704 represents the millimolecular attenuation coefficient (cm²) of urea under the test conditions. 2 ·μmol -1 ).

[0111] The formula for calculating creatinine enzyme specific activity is:

[0112] Creatinine enzyme specific activity (U / mg) = Eluted enzyme activity (U / mL) / Eluted protein concentration (U / mg)

[0113] The above-described method for preparing creatinine enzyme utilizes specific fermentation and fed-batch media. Feeding is controlled via DO-STAT coupling to ensure sufficient nutrients for cells expressing creatinine enzyme. The growth rate of the strain is controlled by adding inducers and adjusting the feeding rate, preventing adverse effects such as acid accumulation, feedback inhibition, misfolding of the target protein, and nutrient waste caused by excessively rapid growth. Adding metal salt ion solutions either feed-in or intermittently at any stage of batch fermentation, fed-batch fermentation, or induction ensures a certain concentration of metal complex salt ions in the fermentation broth after induction. These metal ions bind to the active site of creatinine enzyme produced by cells expressing creatinine enzyme after induction, significantly increasing the expression level and specific activity of creatinine enzyme. Experimental results using this method in a 5L fermenter showed that the wet weight of the engineered *E. coli* sludge reached 171 g / L, the creatinine enzyme activity in the fermentation broth reached 14268 U / mL, and the specific activity of the purified creatinine enzyme reached 2546 U / mg.

[0114] The following is a specific embodiment.

[0115] Unless otherwise specified, the reagents and instruments used in the examples are conventionally selected in the art. Experimental methods not specifying particular conditions in the examples are typically performed under standard conditions, such as those described in literature, books, or recommended by the reagent kit manufacturer. All reagents used in the examples are commercially available.

[0116] Unless otherwise specified, the engineered Escherichia coli used in the examples is constructed by introducing the creatinine enzyme gene derived from Pseudomonas putida into Escherichia coli, and contains kanamycin (Kana) resistance. The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence of the encoded creatinine enzyme is shown in SEQ ID No. 2.

[0117] Example 1

[0118] The batch fermentation medium used in this embodiment is TB medium, which is commonly used for Escherichia coli culture, and includes: 20 g / L peptone, 24 g / L yeast extract, 4 ml / L glycerol, 16.45 g / L dipotassium hydrogen phosphate, and 2.31 g / L potassium dihydrogen phosphate.

[0119] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0120] Step 1: Inoculate the preserved Escherichia coli engineered strain carrying the creatinine enzyme gene fragment into a test tube containing 10 mL of sterile LB liquid medium at a volume concentration of 0.1%, and incubate at 37°C and 200 rpm for 17 h to obtain the primary seed culture.

[0121] The preservation method for the above-mentioned engineered Escherichia coli strain carrying the creatinine enzyme gene fragment is as follows: A single colony of well-grown engineered Escherichia coli is picked from the corresponding LB resistant plate and inoculated into a stoppered test tube containing 10 mL of liquid LB medium. The culture is then incubated at 37°C and 200 rpm until the bacterial culture reaches OD500. 600 Once the bacterial concentration reaches between 1.5 and 3.0, and microscopic examination confirms that the bacterial solution is free of contaminants, the bacterial solution is mixed with 30% sterile glycerol at a volume ratio of 1:1 and stored in a sterile bacterial culture preservation tube at -80°C for 2 years.

[0122] Step 2: Inoculate the primary seed culture at a volume concentration of 0.1% into a shake flask containing 150 mL of sterile LB liquid medium and incubate at 37°C and 200 rpm for 6-10 hours to obtain the seed culture of logarithmic-phase Escherichia coli engineered bacteria.

[0123] Step 3: The seed culture of the engineered *E. coli* in the logarithmic growth phase was added at a 10% inoculum to a 5L fermenter containing 3L of the sterile fermentation medium for fermentation. The fermenter was controlled under the following conditions: rotation speed 200-750 rpm, aeration ratio 2 vvm, culture temperature 37℃, pressure 0.02MPa-0.07MPa, and pH 6.8±0.05. During fermentation, the initial rotation speed was 200 rpm, increasing by 50 rpm whenever dissolved oxygen fell below 30%, and maintaining this speed at 750 rpm. During fermentation, the pH was adjusted using 50% (v / v) ammonia solution, the solvent being at least one selected from deionized water or distilled water.

[0124] Step 4: When glucose is depleted and dissolved oxygen begins to rebound, replenish dissolved oxygen using a feeding medium in conjunction with the feeding process. During the feeding process, the dissolved oxygen level is controlled at 30% ± 10%. The feeding medium consists of: 300 g / L glucose, 5 mg / L Na₂MoO₄·2H₂O, 2 mg / L FeCl₃·6H₂O, and 1.2 mg / L H₃BO₃, wherein the solvent is selected from at least one of deionized water or distilled water.

[0125] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues until the induction time reaches 10 hours, at which point fermentation is stopped, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, the inducer concentration is 0.5 mM, the induction temperature is 20°C, and the induction pH is 6.8 ± 0.05.

[0126] Step 6: After fermentation, centrifuge the fermentation broth at 7000 rpm for 25 min, remove the supernatant to obtain the bacterial sludge precipitate sample, and purify the sample using a nickel ion affinity chromatography column.

[0127] Step 7: Detect the protein concentration of the purified sample, the creatinine enzyme activity of the fermentation broth and purified sample after fermentation, and calculate the creatinine enzyme protein specific activity of the eluted sample.

[0128] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 132 g / L, the creatinine enzyme activity in the fermentation broth was 1543 U / mL, and the specific activity of the purified creatinine enzyme was 522 U / mg.

[0129] Example 2

[0130] The batch fermentation medium used in this embodiment contains: yeast extract, peptone, glucose, 2 g / L Tween 80, 5 g / L sodium acetate, glycerol, 2 g / L KH₂PO₄, 10 g / L K₂HPO₄·3H₂O, (NH₄)₂SO₄, 0.3 g / L CaCl₂, 0.6 g / L MgSO₄·7H₂O, 10 mg / L NaCl, 2 mg / L MnCl₂·4H₂O, 8 mg / L ZnSO₄·7H₂O, 5 mg / L Na₂MoO₄·2H₂O, 2 mg / L FeCl₃·6H₂O, 4 mg / L H₃BO₃, and 5 mg / L CuSO₄·5H₂O. The concentrations of yeast extract, peptone, glucose, glycerol, and (NH₄)₂SO₄ were optimized.

[0131] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0132] Step 1: Same as Step 1 in Example 1.

[0133] Step 2: Same as Step 2 in Example 1.

[0134] Step 3: Same as step 3 in Example 1.

[0135] Step 4: Same as step 4 in Example 1.

[0136] Step 5: Same as step 5 in Example 1.

[0137] Step 6: Same as step 6 in Example 1.

[0138] Step 7: Same as step 7 in Example 1.

[0139] The results of the formulation optimization are shown in Table 1. The optimal culture medium formulation is as follows: 20 g / L yeast extract, 20 g / L peptone, 5 g / L glucose, 2 g / L Tween 80, 5 g / L sodium acetate, 5 g / L glycerol, 2 g / L KH₂PO₄, 10 g / L K₂HPO₄·3H₂O, 10 g / L (NH₄)₂SO₄, 0.3 g / L CaCl₂, 0.6 g / L MgSO₄·7H₂O, 10 mg / L NaCl, and 2 mg / L MnCl₂. The optimal formula for the Escherichia coli engineered bacteria sludge was 146 g / L, containing 2.4 H2O, 8 mg / L ZnSO4·7H2O, 5 mg / L Na2MoO4·2H2O, 2 mg / L FeCl3·6H2O, 4 mg / L H3BO3, and 5 mg / L CuSO4·5H2O. The creatinine enzyme activity in the fermentation broth was 2168 U / mL, and the specific activity of creatinine enzyme after purification was 646 U / mg. The fermentation results of the optimal formula were used in subsequent statistical analysis of the results of Example 2.

[0140] Table 1. Statistical analysis of culture medium formulation optimization results

[0141]

[0142] A comparison of the results of Example 1 and Example 2 (see Table 2) shows that, under the same conditions, the fermentation effect of the culture medium used in this invention is better than that of TB culture medium.

[0143] Table 2 Comparison of results between Example 1 and Example 2

[0144]

[0145]

[0146] Example 3

[0147] The batch fermentation medium used in this embodiment consists of 20 g / L yeast extract, 20 g / L peptone, 5 g / L glucose, 2 g / L Tween 80, 5 g / L sodium acetate, 5 g / L glycerol, 2 g / L KH2PO4, 10 g / L K2HPO4·3H2O, 10 g / L (NH4)2SO4, 0.3 g / L CaCl2, 0.6 g / L MgSO4·7H2O, 10 mg / L NaCl, 2 mg / L MnCl2·4H2O, 8 mg / L ZnSO4·7H2O, 5 mg / L Na2MoO4·2H2O, 2 mg / L FeCl3·6H2O, 4 mg / L H3BO3, and 5 mg / L CuSO4·5H2O.

[0148] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0149] Step 1: Same as Step 1 in Example 1.

[0150] Step 2: Same as Step 2 in Example 1.

[0151] Step 3: The seed culture of the engineered *E. coli* in the logarithmic growth phase is added at a 10% inoculation rate to a 5L fermenter containing 3L of the sterile fermentation medium. Fermentation begins after inoculation with a metal salt ion solution, and induction continues for approximately 5 hours. The metal salt ion solution (concentration based on the volume of the fermentation medium) is 2mM Fe. 2+ The fermentation tank was controlled under the following conditions: rotation speed of 200-750 rpm, aeration ratio of 2vvm, culture temperature of 37℃, tank pressure of 0.02MPa-0.07MPa, and pH of 6.8±0.05. During fermentation, the initial rotation speed was 200 rpm, and the speed was increased by 50 rpm whenever dissolved oxygen fell below 30%, remaining constant at 750 rpm. During fermentation, 50% (volume ratio) ammonia solution was used to adjust the pH; the solvent was selected from at least one of deionized water or distilled water.

[0152] Step 4: Same as step 4 in Example 1.

[0153] Step 5: Same as step 5 in Example 1.

[0154] Step 6: Same as step 6 in Example 1.

[0155] Step 7: Same as step 7 in Example 1.

[0156] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 139 g / L, the creatinine enzyme activity in the fermentation broth was 2388 U / mL, and the specific activity of the purified creatinine enzyme was 703 U / mg.

[0157] Example 4

[0158] The batch fermentation medium used in this embodiment is the same as that in Example 3.

[0159] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0160] Step 1: Same as Step 1 in Example 1.

[0161] Step 2: Same as Step 2 in Example 1.

[0162] Step 3: Same as step 3 in Example 1.

[0163] Step 4: Same as step 4 in Example 1.

[0164] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues while simultaneously adding a metal salt ion solution, completing the addition within approximately 5 hours. Fermentation is stopped after 10 hours of induction, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with a concentration of 0.5 mM. The induction temperature is 20°C, and the induction pH is 6.8 ± 0.05. The metal salt ion solution (concentration based on fermentation medium volume) is 2 mM Fe... 2+ .

[0165] Step 6: Same as step 6 in Example 1.

[0166] Step 7: Same as step 7 in Example 1.

[0167] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 145 g / L, the creatinine enzyme activity in the fermentation broth was 2691 U / mL, and the specific activity of the purified creatinine enzyme was 774 U / mg.

[0168] Example 5

[0169] The batch fermentation medium used in this embodiment is the same as that in Example 3.

[0170] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0171] Step 1: Same as Step 1 in Example 1.

[0172] Step 2: Same as Step 2 in Example 1.

[0173] Step 3: Same as step 3 in Example 1.

[0174] Step 4: Same as step 4 in Example 1.

[0175] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, adjust the fermentation broth temperature to the required induction temperature, add an inducer to the fermentation broth, and continue fermentation. Simultaneously, intermittently add a metal salt ion solution every 1 hour, completing the addition after 5 hours of induction. Stop fermentation after 10 hours of induction, obtaining a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with a concentration of 0.5 mM. The induction temperature is 20°C, and the induction pH is 6.8 ± 0.05. The metal salt ion solution (concentration based on fermentation medium volume) is 2 mM Fe... 2+ .

[0176] Step 6: Same as step 6 in Example 1.

[0177] Step 7: Same as step 7 in Example 1.

[0178] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 142 g / L, the creatinine enzyme activity in the fermentation broth was 2513 U / mL, and the specific activity of the purified creatinine enzyme was 728 U / mg.

[0179] A comparison of the results from Examples 2-5 (see Table 3) shows that adding Fe at the beginning of induction using a feed-feed method is effective. 2+ The solution fermentation results are better.

[0180] Table 3 shows the addition of Fe at different stages and in different ways, with or without its own addition. 2+ Comparison of results

[0181]

[0182]

[0183] Example 6

[0184] The batch fermentation medium formula used in this embodiment is the same as that in embodiment 3.

[0185] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0186] Step 1: Same as Step 1 in Example 1.

[0187] Step 2: Same as Step 2 in Example 1.

[0188] Step 3: Same as step 3 in Example 1.

[0189] Step 4: Same as step 4 in Example 1.

[0190] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues while simultaneously adding a metal ion solution, completing the addition within 5 hours. Fermentation is stopped after 10 hours of induction, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with a concentration of 0.5 mM. The induction temperature is 20°C, and the induction pH is 6.8 ± 0.05. The composition and concentration of the metal salt ion solution (based on the volume of the fermentation medium) are shown in Table 4.

[0191] Step 6: Same as step 6 in Example 1.

[0192] Step 7: Same as step 7 in Example 1.

[0193] The fermentation results with different metal ion solutions are shown in Table 4. The optimal metal ion solution formulation is 4 mM Fe. 2+ 4mM Mn 2+ 8mM Mg 2+ 8mM Ca 2+ 2mM Ni 2+ 4mM Co 2+ Under this formula, the wet weight of the engineered Escherichia coli sludge was 148 g / L, the creatinine enzyme activity in the fermentation broth was 7571 U / mL, and the specific activity of the purified creatinine enzyme was 2212 U / mg. The fermentation results of the optimal metal ion solution formula were used in subsequent statistical analysis of the results of Example 6.

[0194] Table 4. Statistical analysis of results from adding different metal ion solutions to feed.

[0195]

[0196] Example 7

[0197] The batch fermentation medium used in this embodiment is the same as that in Example 3.

[0198] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0199] Step 1: Same as Step 1 in Example 1.

[0200] Step 2: Same as Step 2 in Example 1.

[0201] Step 3: Same as step 3 in Example 1.

[0202] Step 4: Same as step 4 in Example 1.

[0203] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues while simultaneously adding a complex metal salt ion solution, completing the addition within approximately 5 hours. After induction begins, samples are taken at -20°C at 0, 2, 4, 6, 8, 10, 12, 14, and 16 hours of induction and stored until the induction time reaches 16 hours, at which point fermentation is stopped, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with a concentration of 0.5 mM. The induction temperature is 20°C, and the induction pH is 6.8 ± 0.05. The complex metal salt ion solution (concentration based on fermentation medium volume) comprises: 4 mM Fe... 2+ 4mM Mn 2+ 8mM Mg 2+ 8mM Ca 2+ 2mM Ni2+ 4mM Co 2+ .

[0204] Step 6: Same as step 6 in Example 1.

[0205] Step 7: Same as step 7 in Example 1.

[0206] Results: After fermentation, the wet weight of the engineered *E. coli* bacterial sludge was 167 g / L, the creatinine enzyme activity in the fermentation broth was 11902 U / mL, and the specific activity of the purified creatinine enzyme was 2420 U / mg. In this example, the enzyme activity in the fermentation broth continuously increased with the extension of induction time, with 16 h of induction being optimal. See [link to specific results] for details. Figure 2 .

[0207] Example 8

[0208] The batch fermentation medium used in this embodiment is the same as that in Example 3.

[0209] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0210] Step 1: Same as Step 1 in Example 1.

[0211] Step 2: Same as Step 2 in Example 1.

[0212] Step 3: Same as step 3 in Example 1.

[0213] Step 4: Same as step 4 in Example 1.

[0214] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues while simultaneously adding a complex metal salt ion solution, completing the addition within approximately 5 hours. Fermentation is stopped after 16 hours of induction, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with a concentration of 0.5 mM. The induction temperatures are 25°C and 30°C, and the induction pH is 6.8 ± 0.05. The complex metal salt ion solution (concentration based on fermentation medium volume) comprises: 4 mM Fe... 2+ 4mM Mn 2+ 8mM Mg 2 + 8mM Ca 2+ 2mM Ni 2+ 4mM Co 2+ .

[0215] Step 6: Same as step 6 in Example 1.

[0216] Step 7: Same as step 7 in Example 1.

[0217] Results: At an induction temperature of 25℃, the wet weight of the engineered *E. coli* bacterial sludge was 171 g / L, the creatinine enzyme activity in the fermentation broth was 14268 U / mL, and the specific activity of the purified creatinine enzyme was 2546 U / mg. At an induction temperature of 30℃, the wet weight of the engineered *E. coli* bacterial sludge was 182 g / L, the creatinine enzyme activity in the fermentation broth was 12280 U / mL, and the specific activity of the purified creatinine enzyme was 2239 U / mg. Subsequent statistical analyses of the results from Example 8 all used the fermentation results obtained at an induction temperature of 25℃.

[0218] As can be seen from the experimental results of Examples 7-8 (see Table 5), under the same conditions, the expression level and specific activity of creatinine enzyme were highest when the induction temperature was 25℃.

[0219] Table 5. Statistical analysis of results from examples with different induction temperatures.

[0220]

[0221] Example 9

[0222] The batch fermentation medium used in this embodiment is the same as that in Example 3.

[0223] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0224] Step 1: Same as Step 1 in Example 1.

[0225] Step 2: Same as Step 2 in Example 1.

[0226] Step 3: Same as step 3 in Example 1.

[0227] Step 4: Same as step 4 in Example 1.

[0228] Step 5: When the OD of the fermentation broth... 600 When the temperature reaches approximately 30°C, the fermentation broth temperature is adjusted to the required induction temperature. An inducer is added to the fermentation broth, and fermentation continues while simultaneously adding a complex metal salt ion solution, completing the addition within approximately 5 hours. Fermentation is stopped after 16 hours of induction, yielding a fermentation broth containing the creatinine enzyme. The inducer is isopropyl thiogalactoside, with concentrations of 0.1 mM and 1 mM. The induction temperature is 25°C, and the induction pH is 6.8 ± 0.05. The complex metal salt ion solution (concentration based on fermentation medium volume) comprises: 4 mM Fe... 2+ 4mM Mn 2+ 8mM Mg 2+ 8mM Ca 2+ 2mM Ni 2+4mM Co 2+ .

[0229] Step 6: Same as step 6 in Example 1.

[0230] Step 7: Same as step 7 in Example 1.

[0231] Results: When the inducer concentration was 0.1 mM, the wet weight of the engineered Escherichia coli sludge was 191 g / L, the creatinine enzyme activity in the fermentation broth was 11330 U / mL, and the specific activity of creatinine enzyme after purification was 2486 U / mg; when the inducer concentration was 1 mM, the wet weight of the engineered Escherichia coli sludge was 168 g / L, the creatinine enzyme activity in the fermentation broth was 13455 U / mL, and the specific activity of creatinine enzyme after purification was 2411 U / mg.

[0232] As can be seen from the experimental results of Examples 8 and 9 (see Table 6 for details), under the same conditions, the expression level and specific activity of creatinine enzyme were highest when the concentration of the inducer was 0.5 mM.

[0233] Table 6. Statistical analysis of results from examples with different inducing agent concentrations.

[0234]

[0235]

[0236] Example 10

[0237] This embodiment describes a 50L fermenter process.

[0238] The batch fermentation medium used in this embodiment is the same as that in Embodiment 2.

[0239] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0240] Step 1: Inoculate the preserved Escherichia coli engineered strain carrying the creatinine enzyme gene fragment into a test tube containing 10 mL of sterile LB liquid medium at a volume concentration of 0.1%, and incubate at 37°C and 200 rpm for 17 h to obtain the primary seed culture.

[0241] The preservation method for the above-mentioned engineered Escherichia coli strain carrying the creatinine enzyme gene fragment is as follows: A single colony of well-grown engineered Escherichia coli is picked from the corresponding LB resistant plate and inoculated into a stoppered test tube containing 10 mL of liquid LB medium. The culture is then incubated at 37°C and 200 rpm until the bacterial culture reaches OD500. 600 Once the bacterial concentration reaches between 1.5 and 3.0, and microscopic examination confirms that the bacterial solution is free of contaminants, the bacterial solution is mixed with 30% sterile glycerol at a volume ratio of 1:1 and stored in a sterile bacterial culture preservation tube at -80°C for 2 years.

[0242] Step 2: Inoculate the primary seed culture at a volume concentration of 0.1% into a shake flask containing 400 mL of sterile LB liquid medium and incubate at 37°C and 200 rpm for 5-6 h to obtain the seed culture of logarithmic-phase Escherichia coli engineered bacteria.

[0243] Step 3: The seed culture of the engineered *E. coli* in the logarithmic growth phase is added at an inoculum volume of 10% to a 50L fermenter containing 25L of the sterile fermentation medium for fermentation. The fermenter is controlled under the following conditions: rotation speed 100-500 rpm, aeration ratio 2.16-2.4 vvm, culture temperature 37℃, pressure 0.05-0.07 MPa, and pH 6.8 ± 0.05. During fermentation, the initial rotation speed is 100 rpm, increasing by 50 rpm whenever dissolved oxygen falls below 30%, and maintaining this speed at 500 rpm. The pH is adjusted using 70% (v / v) ammonia solution, selected from at least one of deionized water or distilled water.

[0244] Step 4: Same as step 4 in Example 1.

[0245] Step 5: Same as step 5 in Example 10.

[0246] Step 6: Same as step 6 in Example 1.

[0247] Step 7: Same as step 7 in Example 1.

[0248] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 145 g / L, the creatinine enzyme activity in the fermentation broth was 12475 U / mL, and the specific activity of the purified creatinine enzyme was 2398 U / mg.

[0249] Example 11

[0250] This example demonstrates a 500L fermentation process.

[0251] The batch fermentation medium used in this embodiment is the same as that in Embodiment 2.

[0252] The fermentation method for engineered Escherichia coli that produces creatinine enzyme provided in this embodiment includes the following steps:

[0253] Step 1: Inoculate the preserved Escherichia coli engineered strain carrying the creatinine enzyme gene fragment into a shake flask containing 400 mL of sterile LB liquid medium at a volume concentration of 0.1%, and incubate at 37 °C and 200 rpm for 6 h to obtain the primary seed culture.

[0254] The preservation method for the above-mentioned engineered Escherichia coli strain carrying the creatinine enzyme gene fragment is as follows: A single colony of well-grown engineered Escherichia coli is picked from the corresponding LB resistant plate and inoculated into a stoppered test tube containing 10 mL of liquid LB medium. The culture is then incubated at 37°C and 200 rpm until the bacterial culture reaches OD500. 600 Once the bacterial concentration reaches between 1.5 and 3.0, and microscopic examination confirms that the bacterial solution is free of contaminants, the bacterial solution is mixed with 30% sterile glycerol at a volume ratio of 1:1 and stored in a sterile bacterial culture preservation tube at -80°C for 2 years.

[0255] Step 2: Inoculate the primary seed culture at a volume concentration of 0.1% into a seed tank containing 25L of sterile fermentation medium, and incubate at 37℃ and 200rpm for 4-5 hours to obtain the seed culture of logarithmic-phase Escherichia coli engineered bacteria.

[0256] Step 3: The seed culture of the engineered *E. coli* in the logarithmic growth phase was added at a 10% inoculum to a 500L fermenter containing 250L of the sterile fermentation medium for fermentation. The fermenter was controlled under the following conditions: rotation speed 100-280 rpm, aeration ratio 1.8-2.4 vvm, culture temperature 37℃, pressure 0.05-0.07 MPa, and pH 6.8 ± 0.05. During fermentation, the initial rotation speed was 100 rpm, and the speed was increased by 50 rpm whenever dissolved oxygen fell below 30%, remaining constant at 280 rpm. The pH was adjusted using 100% ammonia solution during fermentation.

[0257] Step 4: Same as step 4 in Example 1.

[0258] Step 5: Same as step 5 in Example 10.

[0259] Step 6: Same as step 6 in Example 1.

[0260] Step 7: Same as step 7 in Example 1.

[0261] Results: After fermentation, the wet weight of the engineered Escherichia coli sludge was 132 g / L, the creatinine enzyme activity in the fermentation broth was 12113 U / mL, and the specific activity of the purified creatinine enzyme was 2351 U / mg.

[0262] The experimental results of Examples 5, 9, and 10 (see Table 5 for details) show that the process can achieve high expression levels and high specific activity of creatinine enzyme at fermentation scales of 5L, 50L, and 500L.

[0263] Table 5. Statistical analysis of results from examples with different fermentation scales.

[0264]

[0265] In summary, this study achieved high-density culture of engineered *E. coli* bacteria carrying the creatinine enzyme gene fragment and efficient expression of exogenous creatinine enzyme by adding metal salt ion solutions at any stage of the fermentation process using specific fermentation and fed-batch media. High-density fermentation in a 5L fermenter yielded a wet weight of 171 g / L for the engineered *E. coli* sludge, a creatinine enzyme activity of 14268 U / mL in the fermentation broth, and a specific activity of 2546 U / mg after purification. This method provides an effective solution to the problems of low creatinine enzyme expression and low specific activity, reduces production costs, improves biomass resource utilization, and has significant application value in related medical testing fields.

[0266] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for preparing creatinine enzyme, characterized in that, Includes the following steps: Batch fermentation stage: Recombinant Escherichia coli carrying the creatinine enzyme gene is inoculated into the fermentation medium for batch fermentation; Feeded fermentation stage: Feeded fermentation is carried out when the carbon source of the fermentation broth is exhausted and dissolved oxygen begins to rise. Induction phase: When the OD600 of the fermentation broth reaches 20-40 during fed-batch fermentation, induced expression is performed to obtain creatinine enzyme; In at least one of the batch fermentation stage, the fed-batch fermentation stage, and the induction stage, a metal salt ion solution is added to the fermentation broth, and the metal salt ion solution is added to the fermentation broth in a fed-batch or intermittent manner. The step of adding the metal salt ion solution to the fermentation broth during the induction phase includes: adding the metal salt ion solution to the fermentation broth after adding the inducer to start inducing expression; The metal salt ion solution is a single metal salt ion solution, and the metal ion in the single metal salt ion solution is selected from one of the following ions based on the volume of the fermentation medium: 0.5 mM-5 mM Fe. 2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ ; Alternatively, the metal salt ion solution is a complex metal salt ion solution, wherein the metal ions in the complex metal salt ion solution, based on the volume of the fermentation medium, are selected from at least two of the following ions: 0.5 mM-5 mM Fe. 2+ 1mM-10mM Mn 2+ 2mM-10mM Mg 2+ 2mM-10mM Ca 2+ 0.5mM-5mM Ni 2+ 0.5mM-10mM Co 2+ ; The amino acid sequence encoded by the creatinine enzyme gene is shown in SEQ ID No.

2.

2. The method for preparing creatinine enzyme according to claim 1, characterized in that, The metal salt ion solution is added by flow addition for 4-15 hours, and the induction time is 10-20 hours.

3. The method for preparing creatinine enzyme according to claim 1, characterized in that, The inducing agent in the induction phase is isopropyl thiogalactoside, and the concentration of the inducing agent is 0.1 mM-1.5 mM, and the induction temperature is 20℃-37℃.

4. The method for preparing creatinine enzyme according to claim 3, characterized in that, The concentration of the inducer is 0.5 mM, and the induction temperature is 25 °C.

5. The method for preparing creatinine enzyme according to claim 1, characterized in that, When the metal salt ion solution is a single metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+ MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ It is CaCl2; When the metal salt ion solution is a complex metal salt ion solution, Fe 2+ It is FeCl2 or FeSO4, Mn 2+ MnCl2 or MnSO4, Mg 2+ It is MgCl2 or MgSO4, Ca 2+ For CaCl2, Ni 2+ It is NiCl2 or NiSO4, Co 2+ It is CoCl2.

6. The method for preparing creatinine enzyme according to claim 1, characterized in that, The step of inoculating recombinant Escherichia coli carrying the creatinine enzyme gene into the fermentation medium for batch fermentation includes: The recombinant Escherichia coli culture was inoculated into test tube culture medium at a volume concentration of 0.05%-0.5% and cultured at 37℃ and 200rpm for 10-20 hours to obtain the primary seed culture. The primary seed culture was inoculated into a shake flask culture medium at a volume concentration of 0.05%-0.5% and cultured at 37°C and 200 rpm for 6-10 hours to obtain the recombinant Escherichia coli in the logarithmic growth phase. The seed culture of the recombinant Escherichia coli in the logarithmic phase was added to the fermentation medium at an inoculation rate of 5%-10% by volume for batch fermentation.

7. The method for preparing creatinine enzyme according to claim 1, characterized in that, The conditions for batch fermentation include: a rotation speed of 200 rpm to 750 rpm, an aeration rate of 0.5 vvm to 2 vvm, a fermentation temperature of 37°C, and a tank pressure of 0.02 MPa to 0.07 MPa. And / or, the fed culture medium used for fed fermentation includes: 200 g / L-800 g / L glucose, 0.4 mg / L-6 mg / L Na2MoO4·2H2O, 2 mg / L-15 mg / L FeCl3·6H2O, and 0.3 mg / L-1.5 mg / L H3BO3; And / or, during fed fermentation, the dissolved oxygen level is controlled at 30%±10%.

8. The method for preparing creatinine enzyme according to any one of claims 1-7, characterized in that, The nucleotide sequence of the creatinine enzyme gene is shown in SEQ ID No.

1.

9. An application of a fermentation medium for the preparation of creatinine enzyme according to any one of claims 1-8, characterized in that, include: 4 g / L-40 g / L yeast powder, 5 g / L-40 g / L peptone, 5 g / L-40 g / L glucose, 1 g / L-15 g / L Tween 80, 2 g / L-20 g / L sodium acetate, 1.5 g / L-15 g / L glycerol, 2 g / L-15 g / L KH₂PO₄, 2 g / L-15 g / L K₂HPO₄·3H₂O, 4 g / L-20 g / L (NH₄)₂SO₄, 0.04 g / L-0.5 g / L CaCl₂, 0.5 g / MgSO4·7H2O (L-5g / L), NaCl (2mg / L-15mg / L), MnCl2·4H2O (2mg / L-20mg / L), ZnSO4·7H2O (1mg / L-10mg / L), Na2MoO4·2H2O (0.4mg / L-8mg / L), FeCl3·6H2O (2mg / L-15mg / L), H3BO3 (0.3mg / L-5mg / L), CuSO4·5H2O (0.2mg / L-5mg / L).