Kit and method for detecting ultra-micro new coronavirus RNA at room temperature

Abstract

This invention provides a nucleic acid composition for detecting SARS-CoV-2, comprising a DNA recognition strand and a DNA auxiliary strand; a kit for detecting SARS-CoV-2, comprising a target RNA recognition amplification module and a dual signal amplification module; and a room-temperature detection method for ultra-trace amounts of SARS-CoV-2 RNA. The kit and detection method provided by this invention can detect ultra-trace amounts of SARS-CoV-2 RNA at room temperature, with mild reaction conditions, no need for reverse transcription, simple operation, and a balance between high specificity and high sensitivity. The nucleic acid composition used in this invention fully utilizes the high sensitivity of the CRIPSR-Cas12a detection system, achieving a detection limit of 100 aM, enabling the detection of ultra-trace RNA.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology. Specifically, it relates to a kit and method for detecting ultra-small amounts of SARS-CoV-2 RNA at room temperature, consisting of a target RNA recognition and amplification module and a CRISPR-Cas12a-based dual signal amplification module. Background Technology

[0002] Since the outbreak of COVID-19, caused by the single-stranded RNA virus SARS-CoV-2, early detection and identification of the virus has been crucial for epidemic prevention and control. Specific and sensitive RNA virus detection methods are essential for epidemic control. Traditional RNA detection methods mainly include sequencing, Northern blotting, PCR, microarrays, and fluorescent probes. Sequencing can comprehensively display RNA information within a sample, but it is costly, time-consuming, and requires complex and expensive instruments, making it difficult to widely implement at the grassroots level. Northern blotting is simple, easy to perform, and inexpensive, but it is time-consuming, has low sensitivity, and poor specificity. Microarrays can perform high-throughput miRNA analysis, but have lower sensitivity; however, they are costly, and their specificity needs further improvement. PCR requires reverse transcription pretreatment of RNA to convert it into cDNA before analysis. This step involves multiple reactions at different temperatures, increasing detection time and operational complexity. In addition, the PCR method requires strict control of the heating and annealing temperatures, as well as the availability of relevant instruments and professionally trained sample preparation personnel, which increases the cost and operational complexity of the method and limits its further promotion to grassroots levels.

[0003] In recent years, CRISPR-Cas12a-based nucleic acid detection systems have attracted widespread attention due to their good specificity and sensitivity. When substrate DNA activates the CRISPR-Cas12a system, its trans-cleavage activity is activated, allowing for the cyclic cleavage of single-stranded DNA fluorescent probes within the system at room temperature, thus amplifying the signal. However, for RNA detection, two major bottlenecks remain. First, a relatively complex reverse transcription process is required to convert RNA into cDNA; second, the detection limit of CRISPR-Cas12a-based RNA detection systems cannot meet the needs of detecting ultra-low abundance RNA, greatly limiting the promotion and application of this system. For example, CN113337638A discloses a detection method and kit for the novel coronavirus (SARS-CoV-2); however, this method combines CRISPR trans-cleavage with PCR technology, requiring PCR amplification. CN111154919A discloses a kit for a one-step closed-tube method for detecting novel coronavirus nucleic acid. It utilizes rolling circle amplification (RCA) to generate a large number of G4 chain nanowires, which then catalyze a colorimetric reaction to achieve rapid and direct detection of the novel coronavirus nucleic acid. However, its detection limit is 1 pM. CN113151591A discloses a nucleic acid composition and kit for detecting SARS-CoV-2, which cleverly integrates rolling circle amplification technology and recombinase polymerase amplification technology. It allows for detection of samples under isothermal conditions, eliminating the need for expensive and cumbersome temperature cycling instruments. However, its sensitivity is only 100 pg / μL. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a simple, rapid, and highly sensitive kit consisting of a target RNA recognition amplification module and a CRISPR-Cas12a-based dual signal amplification module, as well as a room-temperature detection method for ultra-small amounts of SARS-CoV-2 RNA, so as to achieve rapid, inexpensive, and specific room-temperature detection of low-abundance SARS-CoV-2 nucleic acid.

[0005] The technical solution adopted in this invention is as follows:

[0006] Firstly, the present invention provides a method for detecting SARS. CoV The nucleic acid composition of 2 includes a DNA recognition strand and a DNA auxiliary strand; the DNA recognition strand is used for signal recognition of the target RNA, and the recognition region is a conserved sequence of the SARS-CoV-2 gene; the DNA auxiliary strand is used to assist the recognition strand in rolling circle amplification of the target RNA.

[0007] In some embodiments, the sequence of the DNA recognition strand is selected from one or more sequences of SEQ ID NO. 1 to SEQ ID NO. 4; the sequence of the DNA auxiliary strand is shown in SEQ ID NO. 5.

[0008] In some preferred embodiments, the sequence of the DNA recognition strand is shown in SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 4.

[0009] Secondly, the present invention provides a method for detecting SARS. CoV The kit for 2 includes a target RNA recognition and amplification module and a dual signal amplification module; the target RNA recognition and amplification module includes the nucleic acid composition, DNA ligase and DNA polymerase provided in the first aspect of the present invention; the dual signal amplification module includes a Cas12a reaction system, an iCas12a reaction system and a fluorescent probe; the Cas12a reaction system includes Cas12a and crRNA; the iCas12a reaction system includes crRNA, a Blocker strand and Cas12a.

[0010] In some embodiments, the nucleic acid composition is prepared by dissolving the DNA recognition strand and the DNA auxiliary strand in DNA polymerase buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, and incubating at 37°C.

[0011] In some embodiments, the DNA ligase is a T4 ligase; and / or, the DNA polymerase is a Phi29 DNA polymerase.

[0012] In some embodiments, the Cas12a reaction system is prepared by mixing Cas12a and crRNA in a buffer environment and incubating at 37°C.

[0013] In some embodiments, the iCas12a reaction system is prepared by dissolving crRNA and Blocker chains in buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, incubating at 37°C to obtain a crRNA-Blocker complex, mixing it with Cas12a in a buffer environment, and incubating at 37°C.

[0014] In some embodiments, the sequence of the crRNA is as shown in SEQ ID NO. 6; and / or, the sequence of the Blocker chain is as shown in SEQ ID NO. 7; and / or, the sequence of the fluorescent probe is as shown in SEQ ID NO. 8.

[0015] Thirdly, the present invention provides a method for detecting ultra-small amounts of SARS-CoV-2 RNA at room temperature, based on the reagent kit provided in the second aspect of the present invention, specifically including the following steps:

[0016] S1. Place the nucleic acid sample to be tested into the target RNA recognition amplification module for amplification to obtain the amplification product;

[0017] S2. Mix the amplification product with the double signal amplification module and detect it in the dark;

[0018] In step S1, the amplification reaction conditions are 37°C for 15 minutes;

[0019] In step S2, the detection reaction conditions are 37°C, excitation wavelength 485nm, and emission wavelength 520nm.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] The kit and detection method provided by this invention can detect trace amounts of SARS-CoV-2 RNA at room temperature (25℃~40℃, preferably 37℃). The reaction conditions are mild, requiring no reverse transcription process, and the operation is simple, while also ensuring high specificity and high sensitivity. When the SARS-CoV-2 target RNA is absent in the system, the target RNA recognition amplification module cannot react, thus failing to activate the dual signal amplification module, resulting in a low background. Furthermore, the nucleic acid composition used in this invention can fully utilize the high sensitivity of the CRIPSR-Cas12a detection system, achieving a detection limit of 100 aM, enabling the detection of trace amounts of RNA. Attached Figure Description

[0022] Figure 1 Example 1 shows the detection limit for detecting the N gene RNA of the novel coronavirus.

[0023] Figure 2 Example 2 is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA.

[0024] Figure 3 Example 3 is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA.

[0025] Figure 4 Example 4 is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA.

[0026] Figure 5 Example 5 is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA.

[0027] Figure 6 This is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA in Comparative Example 1.

[0028] Figure 7 This is a statistical evaluation of the detection limit of the SARS-CoV-2 N gene RNA in Comparative Example 2. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention. In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; unless specifically specified, the technical means used are all conventional means well known to those skilled in the art.

[0030] The technical concept of this invention is to provide a simple, rapid, and highly sensitive kit consisting of a target RNA recognition amplification module and a CRISPR-Cas12a-based dual signal amplification module, as well as a room temperature detection method for ultra-small amounts of SARS-CoV-2 RNA.

[0031] Firstly, the present invention provides a method for detecting SARS. CoV The nucleic acid composition of 2 includes a DNA recognition strand and a DNA auxiliary strand; the DNA recognition strand is used for signal recognition of the target RNA, and the recognition region is a conserved sequence of the SARS-CoV-2 gene; the DNA auxiliary strand is used to assist the recognition strand in rolling circle amplification with the target RNA.

[0032] Specifically, the sequence of the DNA recognition strand is selected from one or more sequences in SEQ ID NO. 1 to SEQ ID NO. 4;

[0033] CTACTGCTGCCTGGATTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATGCAGGAGAAGTTCCC (SEQ ID NO.1);

[0034] CTACTGCTGCCTGGAGTTGAATTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCTAGCAGGAGAAG (SEQ ID NO.2);

[0035] TGGTTCAATCTGTCAAGCAGTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCAGCAAAGCAAGAGCAGCA (SEQ ID NO.3);

[0036] TCCCTTCTGCGTAGAAGCCTTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCTTGACTGCCGCCTCTGC (SEQ ID NO.4).

[0037] The sequence design of the DNA auxiliary strand is: ATACTCACCCAGAGT (SEQ ID NO. 5).

[0038] Secondly, the present invention provides a method for detecting SARS. CoV The kit for 2 includes a target RNA recognition amplification module and a dual signal amplification module; the target RNA recognition amplification module includes the nucleic acid composition, DNA ligase and DNA polymerase provided in the first aspect of the present invention; the dual signal amplification module includes a Cas12a reaction system, an iCas12a reaction system and a fluorescent probe; the Cas12a reaction system includes Cas12a and crRNA; the iCas12a reaction system includes crRNA, a Blocker strand and Cas12a.

[0039] Specifically, the nucleic acid composition is prepared by dissolving the DNA recognition strand and the DNA auxiliary strand in DNA polymerase buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, and incubating at 37°C.

[0040] The DNA ligase used was T4 ligase; the DNA polymerase used was Phi29 DNA polymerase.

[0041] The Cas12a reaction system was prepared by mixing Cas12a and crRNA in a buffer environment and incubating at 37°C.

[0042] The iCas12a reaction system is prepared by first dissolving crRNA and Blocker chains in buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, and incubating at 37°C to obtain the crRNA-Blocker complex. Then, the crRNA-Blocker complex and Cas12a are mixed in buffer and incubated at 37°C to obtain the final product.

[0043] The crRNA sequence was designed as follows:

[0044] UAAUUUCUACUAAGUGUAGAUAAGGGCAUGAGCUAGGUGAU (SEQ ID NO. 6).

[0045] The sequence design of the Blocker chain is as follows:

[0046] ATCACCTAGTATATCTCATGCCCTTATCTACACTTAGTAGTTTTTTAAATTA (SEQ ID NO. 7).

[0047] The fluorescent probe sequence is designed as follows: FAM-TTTTTATTTTT-BHQ (SEQ ID NO. 8).

[0048] Thirdly, the present invention provides a method for detecting ultra-small amounts of SARS-CoV-2 RNA at room temperature, based on the reagent kit provided in the second aspect of the present invention, specifically including the following steps:

[0049] S1. Place the nucleic acid sample to be tested into the target RNA recognition amplification module for amplification to obtain the amplification product;

[0050] S2. Mix the amplification product with the double signal amplification module and detect it in the dark;

[0051] In step S1, the amplification reaction conditions are 37°C for 15 minutes;

[0052] In step S2, the detection reaction conditions are 37°C, excitation wavelength 485nm, and emission wavelength 520nm.

[0053] When the target RNA of the novel coronavirus is present in the nucleic acid sample to be tested, the target RNA binds to the DNA recognition strand and forms a circular structure. Guided by the DNA auxiliary strand and acted upon by Phi29 DNA polymerase, circular amplification occurs using the DNA recognition strand as a template, yielding multiple repeating amplified DNA products complementary to the DNA recognition strand. These amplified products contain DNA sequences that can react with downstream dual signal amplification modules, thus allowing direct coupling with the latter module to further amplify and report the signal. When the target RNA is absent, the DNA recognition strand cannot form a circular structure, and no product can be amplified to react with the downstream module, thus no reporter signal is generated, offering the advantage of low background.

[0054] Furthermore, the amplified DNA products generated upstream can directly activate the trans-cleavage activity of the CRISPR-Cas12a system. Specifically, activated CRISPR-Cas12a can cleave single-stranded DNA fluorescent probes labeled with the fluorescent groups FAM and BHQ at both ends, thereby generating a cyclic signal reporter. On the other hand, activated CRISPR-Cas12a can activate the blocked iCRISPR-Cas12a (inhibit-CRISPR-Cas12a) in the dual signal amplification module, converting it into aCRISPR-Cas12a with signal amplification activity. After the upstream amplified products enter this module, the non-specific cleavage activity of Cas12a is activated, subsequently cleaving single-stranded probes present in the system, thereby generating a fluorescent signal. In addition, activated Cas12a cleaves the DNA strand blocking igRNA-T2 in the system, subsequently forming complete gRNA-T2; then, gRNA-T2 binds to Cas12a and matches with the helper target primer, activating Cas12a. Activated Cas12a cleaves both the free probe and sgRNA in the system, forming a positive feedback system and achieving double signal amplification. This double-cycle amplification system directly increases the amount of Cas12a enzyme generating the signal, thereby improving the sensitivity of the detection method. This allows for the detection of trace amounts of RNA while maintaining a relatively simple system and detection procedure.

[0055] The following is an example of an experiment involving the N gene of the novel coronavirus.

[0056] The oligonucleotide chains in the experimental examples of this invention were synthesized by Shanghai Sangon Biotech through HPLC purification.

[0057] Lba Cas12a and NEBuffer 2.1 were purchased from New England Biolabs.

[0058] The T4 DNA ligase and Phi 29 DNA polymerase were purchased from BBI Life Sciences.

[0059] Testing instrument: Biotek microplate reader.

[0060] Example 1

[0061] (1) Commission the synthesis of the following sequence

[0062] Synthetic DNA recognition strand sequence:

[0063] CTACTGCTGCCTGGATTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATGCAGGAGAAGTTCCC (SEQ ID NO. 1).

[0064] Synthesized DNA auxiliary strand sequence: ATACTCACCCAGAGT (SEQ ID NO. 5).

[0065] Synthesized crRNA sequence:

[0066] UAAUUUCUACUAAGUGUAGAUAAGGGCAUGAGCUAGGUGAU (SEQ ID NO. 6).

[0067] Synthesize the Blocker chain sequence:

[0068] ATCACCTAGTATATCTCATGCCCTTATCTACACTTAGTAGTTTTTTAAATTA (SEQ ID NO. 7).

[0069] Synthesized fluorescent probe sequence: FAM-TTTTTATTTTT-BHQ (SEQ ID NO. 8).

[0070] (2) Preparation of recognition strand-auxiliary strand nucleic acid composition

[0071] The DNA recognition strand and DNA auxiliary strand were dissolved in PHI29 DNA polymerase buffer at a ratio of 1:1.5, denatured at 85°C for 3 minutes, annealed at 55°C for 3 minutes, and incubated at 37°C for 10 minutes. The specific reaction system is shown in the table below:

[0072]

[0073] (3) Preparation of target RNA recognition amplification module

[0074] Different concentrations of SARS-CoV-2 samples, a recognition strand-auxiliary strand nucleic acid composition, T4 ligase, and Phi29 DNA polymerase were dissolved together in a buffer solution and reacted at 37°C for 15 minutes to obtain the amplification product. The specific reaction system is shown in the table below:

[0075]

[0076] (4) Pre-assembled Cas12a reaction system

[0077] Mix Cas12a and crRNA in NEBuffer 2.1 and incubate at 37°C for 30 minutes. See the table below for the specific reaction mixture.

[0078]

[0079] (5) Pre-assembled iCas12a reaction system

[0080] Preparation of the crRNA-Blocker complex: Dissolve the crRNA and Blocker strands in NEBuffer 2.1 at a 1:2 ratio, denature at 85°C for 3 minutes, anneal at 55°C for 3 minutes, incubate at 37°C for 1 hour, and then store at 4°C for later use. See the table below for the specific reaction system:

[0081]

[0082] The crRNA-Blocker complex was mixed with Cas12a in NEBuffer 2.1 and incubated at 37°C for 30 minutes. The specific reaction system is shown in the table below:

[0083]

[0084] (6) Construction and fluorescence detection of the CRISPR-Cas12a cleavage system:

[0085] The pre-constructed amplification products, Cas12a reaction system, iCas12a reaction system, and fluorescent probe were mixed. Detection was performed in a microplate reader at 37°C in the dark. The specific reaction system is shown in the table below:

[0086]

[0087] The reaction conditions for the fluorescence microplate reader are: 37℃, excitation wavelength 485nm, emission wavelength 520nm, and detection time 90 minutes.

[0088] See the statistics of test results. Figure 1 Analysis of the linear rise rate of the fluorescence curves corresponding to each concentration shows that this system can detect SARS-CoV-2 RNA at the 10 fM level.

[0089] Example 2

[0090] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that the sequence of the designed DNA recognition strand is:

[0091] CTACTGCTGCCTGGAGTTGAATTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCTAGCAGGAGAAG (SEQ ID NO. 2).

[0092] Test results as follows Figure 2 As shown, the detection limit can reach 10 fM.

[0093] Example 3

[0094] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that the sequence of the designed DNA recognition strand is:

[0095] TGGTTCAATCTGTCAAGCAGTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCAGCAAAGCAAGAGCAGCA (SEQ ID NO. 3).

[0096] Test results as follows Figure 3 As shown, the detection limit can reach 1 fM.

[0097] Example 4

[0098] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that the sequence of the designed DNA recognition strand is:

[0099] TCCCTTCTGCGTAGAAGCCTTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCTTGACTGCCGCCTCTGC (SEQ ID NO.4).

[0100] Test results as follows Figure 4 As shown, the detection limit can reach 1 fM.

[0101] Example 5

[0102] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that three DNA recognition strands were designed, with the following sequences:

[0103] CTACTGCTGCCTGGATTTTTATACATATTTATGGGTTTGGCTCTGGGAAAGTATGCAGGAGAAGTTCCC (SEQ ID NO.1);

[0104] TGGTTCAATCTGTCAAGCAGTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCAGCAAAGCAAGAGCAGCA (SEQ ID NO.3);

[0105] TCCCTTCTGCGTAGAAGCCTTTTTTAAGGGCATGAGCTAGGTGATACTCTGGGTGAGTATCTTGACTGCCGCCTCTGC (SEQ ID NO.4).

[0106] The ratio of the recognition strand sequences in the prepared recognition strand-auxiliary strand nucleic acid composition is 1:1:1.

[0107] Test results as follows Figure 5 As shown, the detection limit can reach 100 aM.

[0108] Comparative Example 1

[0109] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that the sequence of the designed DNA recognition strand is:

[0110] CATACCGCAGACGGCCCGCCCTACCCAAAACTGAACCCGCCCTACCAAAACCCAACCCGCCCTACCATAACCTTTCCA (SEQ ID NO. 9).

[0111] Test results as follows Figure 6 As shown, there was no significant difference in the fluorescence curve rise rate between the 1 nM group and the blank group, and the detection limit was only 1 nM.

[0112] Comparative Example 2

[0113] The experimental materials and process steps in this embodiment are basically the same as in Example 1, the only difference being that the sequence of the designed DNA recognition strand is:

[0114] GCAGCAGAGACGAAAAAACACAAAGGAACGAGAGGACAGGAACCACAGACAAAGGAGCACGA (SEQ ID NO.10).

[0115] Test results as follows Figure 7 As shown, there was no difference in the rate of increase of the fluorescence curve between the 1 nM group and the blank group, and the detection limit was only 1 nM.

[0116] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nucleic acid composition for detecting SARS-CoV-2, characterized by: It includes a DNA recognition strand and a DNA auxiliary strand; the DNA recognition strand is used for signal recognition of the target RNA, and the recognition region is a conserved sequence of the SARS-CoV-2 gene; the DNA auxiliary strand is used to assist the recognition strand in rolling circle amplification with the target RNA. The sequence of the DNA recognition strand is selected from one or more sequences of SEQ ID NO. 1 to SEQ ID NO. 4; the sequence of the DNA auxiliary strand is shown in SEQ ID NO. 5; The sequences of the DNA recognition strand are shown in SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO.

4.

2. A kit for detecting SARS-CoV-2, characterized by: It includes a target RNA recognition and amplification module and a dual signal amplification module; the target RNA recognition and amplification module includes the nucleic acid composition, DNA ligase, and DNA polymerase as described in claim 1; the dual signal amplification module includes a Cas12a reaction system, an iCas12a reaction system, and a fluorescent probe; the Cas12a reaction system includes Cas12a and crRNA; the iCas12a reaction system includes crRNA, a Blocker strand, and Cas12a.

3. The kit for detecting SARS-CoV-2 according to claim 2, characterized in that: The nucleic acid composition was prepared by dissolving the DNA recognition strand and the DNA auxiliary strand in DNA polymerase buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, and incubating at 37°C.

4. The kit for detecting SARS-CoV-2 according to claim 2, characterized in that: The DNA ligase is a T4 ligase; and / or, the DNA polymerase is a Phi29 DNA polymerase.

5. The kit for detecting SARS-CoV-2 according to claim 2, characterized in that: The Cas12a reaction system was prepared by mixing Cas12a and crRNA in a buffer environment and incubating at 37°C.

6. The kit for detecting SARS-CoV-2 according to claim 2, characterized in that: The iCas12a reaction system is prepared by dissolving crRNA and Blocker chains in buffer, denaturing at 85°C for 3 minutes, annealing at 55°C for 3 minutes, and incubating at 37°C to obtain the crRNA-Blocker complex, which is then mixed with Cas12a in buffer and incubated at 37°C.

7. The kit for detecting SARS-CoV-2 according to claim 2, characterized in that: The sequence of the crRNA is shown in SEQ ID NO. 6; and / or, the sequence of the Blocker chain is shown in SEQ ID NO. 7; and / or, the sequence of the fluorescent probe is shown in SEQ ID NO. 8.

Images