Kit for detecting African swine fever virus by using fluorescence probe method LAMP (loop-mediated isothermal amplification)

Abstract

The invention relates to the technical field of virus detection, and particularly discloses a kit for detecting African swine fever virus by using a fluorescent probe method LAMP (loop-mediated isothermal amplification), the kit for detecting African swine fever virus by using the fluorescent probe method LAMP comprises an LAMP reaction solution for detecting African swine fever virus, a specific fluorescent probe and African swine fever virus genome DNA (deoxyribonucleic acid); the LAMP reaction liquid comprises a specific primer combination consisting of a pair of specific outer primers, a pair of specific inner primers and a loop primer; the detection method of the kit comprises the following steps: nucleic acid extraction, fluorescent probe LAMP reaction system preparation, sample amplification and result determination. The kit for detecting the African swine fever virus by using the fluorescent probe method LAMP is simple and convenient to operate, has the advantages of strong specificity, high sensitivity, short time consumption and the like, can efficiently detect the African swine fever virus, and has important application value in prevention and control of African swine fever epidemic situation.

Description

Technical Field

[0001] The present application relates to the technical field of virus detection, and more specifically, it relates to a kit for detecting African swine fever virus by using the fluorescence probe method LAMP. Background Art

[0002] African swine fever is an acute, hemorrhagic, and highly contagious disease caused by the African swine fever virus (ASFV). Clinical manifestations include high fever, dyspnea, cyanosis, extensive congestion and hemorrhage of the skin and mucous membranes, severe hemorrhage of lymph nodes and internal organs, etc. Its characteristics are that pigs of all ages are susceptible, the disease process is short, and the morbidity and mortality rates are as high as 100%. At present, African swine fever virus detection methods include virus isolation, nucleic acid detection, serological detection, etc., which have the problems of cumbersome operation steps, low sensitivity and specificity, high requirements for the professional qualities of equipment and operators, and easy false positives in results. Therefore, there is an urgent need for a detection kit with simple operation, high sensitivity and strong specificity to prevent and control African swine fever.

[0003] Loop-mediated isothermal amplification technology (LAMP) can perform nucleic acid amplification in a short time under constant temperature conditions. It is a "simple, fast, accurate, and low-cost" gene amplification method, with the advantages of simplicity, rapidity, strong specificity, and high sensitivity. The characteristic of the LAMP method is to design four primers for six regions on the target gene and use strand displacement DNA polymerase to carry out amplification reactions under constant temperature conditions. The LAMP technology has been widely used in the fields of pathogen, parasite, virus, disease, and transgenic product detection, etc. Based on the above statements, the present application proposes a kit for detecting African swine fever virus by using the fluorescence probe method LAMP. Summary of the Invention

[0004] In order to solve the problems of cumbersome operation steps, low sensitivity and specificity in the existing African swine fever virus detection technology, the present application provides a kit for detecting African swine fever virus by using the fluorescence probe method LAMP.

[0005] In a first aspect, the present application provides a kit for detecting African swine fever virus by using the fluorescence probe method LAMP, which includes a LAMP reaction solution for detecting African swine fever virus, a specific fluorescence probe, and African swine fever virus genomic DNA.

[0006] Preferably, the LAMP reaction solution includes the following components: reaction buffer, specific primer combination, enzyme solution, and RNase-free water.

[0007] Preferably, the LAMP reaction solution comprises the following components: 12.5 μL of reaction buffer, 1 μL of 5 μmol / L outer primer F3, 1 μL of 5 μmol / L outer primer B3, 1 μL of 30 μmol / L inner primer FIP, 1 μL of 30 μmol / L inner primer BIP, 1 μL of 20 μmol / L loop primer LB, 2 μL of enzyme solution, and make up to 20 μL with RNase-free water.

[0008] Preferably, the reaction buffer is composed of dNTP, 10× ThermoPol buffer, MgSO 4 and betaine.

[0009] Preferably, the reaction buffer is composed of 3.5 μL of dNTP, 3 μL of 10× ThermoPol buffer, 3 μL of MgSO 4 3 μL and 3 μL of betaine.

[0010] Preferably, the specific primer combination includes a pair of specific outer primers, a pair of specific inner primers and a loop primer, and their nucleotide sequences are respectively: Outer primer F3: CCGTAACTGCTCATGGTATC (SEQ ID NO.1); Outer primer B3: TCTCTTGCTCTGGATACGT (SEQ ID NO.2); Inner primer FIP: CACTGCCTCCGTAGTGGAAGTCGATAAATTTCCATCAAAGTTCTG (SEQ ID NO.3); Inner primer BIP: TAAAACCCCTGACGATCCTGGATATGACCACTGGGTTGG (SEQ ID NO.4); Loop primer LB: TTGCTTTGAAGCCACGGGAG (SEQ ID NO.5).

[0011] Preferably, the enzyme solution is Bst DNA polymerase.

[0012] Preferably, the sequence of the specific fluorescent probe is: TAGTGAAGGGTATGTAAGAGCTGC. The fluorescent reporter group of the specific fluorescent probe is selected from one of FAM, VIC, JOE, TET, and the fluorescent quenching group of the specific fluorescent probe is selected from one of BHQ1, BHQ2, BHQ3, Dabcy1.

[0013] Preferably, the sequence of the specific fluorescent probe is: TAGTGAAGGGTATGTAAGAGCTGC. The fluorescent reporter group of the specific fluorescent probe is FAM, and the fluorescent quenching group of the specific fluorescent probe is BHQ1.

[0014] In a second aspect, the present application provides a detection method for a kit for detecting African swine fever virus by the fluorescence probe method LAMP, which specifically includes the following steps: S1. Nucleic acid extraction: Use a virus DNA extraction kit to extract the DNA of the test sample. S2. Prepare a fluorescence probe LAMP reaction system: Mix the LAMP reaction solution, the DNA of the test sample, and the specific fluorescent probe, and set up a positive control group and a negative control group. S3. Sample amplification: Amplify the fluorescence probe LAMP reaction system in a fluorescence quantitative PCR instrument. Set the amplification program as a constant temperature reaction at 60 - 70 °C for 10 - 20 s, a constant temperature treatment at 60 - 80 °C for 30 - 50 s, collect signals, and the number of cycles is 30 - 50. S4. Result determination: Analyze the test sample according to the real-time fluorescence PCR amplification curve to determine whether the African swine fever virus gene exists in the test sample.

[0015] Preferably, in the step S2, the positive control group includes the LAMP reaction solution, African swine fever virus genomic DNA, and the specific fluorescent probe; the negative control group includes the LAMP reaction solution, RNase-free water, and the specific fluorescent probe.

[0016] Preferably, in the step S2, the positive control group includes 20 μL of the LAMP reaction solution, 3 μL of African swine fever virus genomic DNA, and 2 μL of the specific fluorescent probe; the negative control group includes 20 μL of the LAMP reaction solution, 3 μL of RNase-free water, and 2 μL of the specific fluorescent probe.

[0017] In summary, the present application has the following beneficial effects: 1. The designed specific primer group of the present application has high specificity and sensitivity, and has a good amplification effect, which can meet the requirements of high specificity and sensitivity of the kit detection, thereby improving the detection efficiency and accuracy.

[0018] 2. The kit for detecting African swine fever virus by the fluorescence probe method LAMP of the present application has strong specificity. For other swine-origin viruses such as classical swine fever virus CSFV, porcine reproductive and respiratory syndrome virus PRRSV, pseudorabies virus PRV, porcine circovirus type 2 PCV2, and porcine epidemic diarrhea virus PEDV, no obvious amplification curves will appear, indicating that the kit of the present application has strong specificity.

[0019] 3. The kit for detecting African swine fever virus by fluorescence probe-based LAMP method of the present application has high sensitivity and accuracy. The lowest detection limit is 50 times lower than that of real-time fluorescence quantitative PCR, and it is more convenient to operate and takes less time. At the initial stage of the virus epidemic when the virus load is low, the kit of the present application can achieve rapid on-site diagnosis of the disease and timely control of the epidemic situation. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the detection result of the turbidity change before and after the reaction of the 3 primer systems in Example 1.

[0021] Figure 2 It is the specific detection result of the kit for detecting African swine fever virus by fluorescence probe-based LAMP method in Example 2.

[0022] Figure 3 is the sensitivity detection result of the kit for detecting African swine fever virus by fluorescence probe-based LAMP method in Example 3. Figure 3a It is the amplification result of fluorescence probe LAMP, Figure 3b It is the amplification result of fluorescence quantitative RT-PCR. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0023] The present application will be further described in detail below with reference to the embodiments.

[0024] Example 1 Design and screening of fluorescence probe LAMP primers.

[0025] The B646L gene is a common marker gene of African swine fever virus type I and type II. By detecting the B646L gene, the presence of African swine fever virus can be confirmed. From the published African swine fever virus B646L gene sequence in Genbank, the conserved regions were identified by multiple sequence alignment. Using an online biological software (http: / / www.neb.cn / ), by adjusting parameter values such as Tm value, GC content, dG critical value, amplification length, and fragment region, 3 primer combinations suitable for fluorescence probe-based LAMP were designed. The nucleotide sequences of each group of primers are shown in Table 1 below.

[0026] Table 1

[0027] Using the above 3 groups of detection primers to perform LAMP amplification reactions on African swine fever virus positive plasmids respectively, and screening the group of primers with the best amplification effect. The reaction system is: 3 μL of African swine fever virus positive plasmid, 20 μL of LAMP reaction solution (consisting of 12.5 μL of reaction buffer (consisting of 3.5 μL of dNTP, 3 μL of 10× ThermoPol buffer, MgSO 4It consists of 3 μL of a mixture of 3 μL of a certain substance and 3 μL of betaine, 1 μL of the outer primer F3 at 5 μmol / L, 1 μL of the outer primer B3 at 5 μmol / L, 1 μL of the inner primer FIP at 30 μmol / L, 1 μL of the inner primer BIP at 30 μmol / L, 2 μL of Bst DNA polymerase, and 2.5 μL of RNase-free water), and 2 μL of RNase-free water. The amplification program is as follows: Incubate at a constant temperature of 65 °C for 30 min, and then incubate at a constant temperature of 70 °C for 5 min.

[0028] After the reaction, the turbidity change of the reaction system before and after the reaction was directly detected with a turbidimeter. The detection results are as Figure 1 shown. Compared with primer sets 2 and 3, the turbidity change of the reaction system of primer set 1 before and after the reaction was the most obvious, and the time taken for the turbidity change to occur was also the shortest. Therefore, the amplification effect of primer set 1 was the best. In this application, primer set 1 was determined to be the best primer set for detecting African swine fever virus in the following examples, and loop primers were designed with this primer set.

[0029] Example 2 The African swine fever virus was detected using the prepared kit for detecting African swine fever virus by fluorescence probe-based LAMP.

[0030] A detection method for a kit for detecting African swine fever virus by fluorescence probe-based LAMP specifically includes the following steps: S1. Nucleic acid extraction: Using a viral DNA extraction kit (purchased from Thermo Fisher Scientific (China) Co., Ltd.), extract the DNA of the sample to be tested according to the steps in the instruction manual; S2. Preparation of the fluorescence probe LAMP reaction system: Mix 20 μL of the LAMP reaction solution (consisting of 12.5 μL of the reaction buffer (composed of 3.5 μL of dNTP, 3 μL of 10× ThermoPol buffer, 3 μL of MgSO 4 3 μL and 3 μL of betaine), 1 μL of the outer primer F3 at 5 μmol / L, 1 μL of the outer primer B3 at 5 μmol / L, 1 μL of the inner primer FIP at 30 μmol / L, 1 μL of the inner primer BIP at 30 μmol / L, 1 μL of the loop primer LB at 20 μmol / L, 2 μL of Bst DNA polymerase, and 1.5 μL of RNase-free water), 3 μL of the sample DNA to be tested, and 2 μL of the specific fluorescence probe. The positive control group includes 20 μL of the LAMP reaction solution, 3 μL of African swine fever virus genomic DNA, and 2 μL of the specific fluorescence probe; the negative control group includes 20 μL of the LAMP reaction solution, 3 μL of RNase-free water, and 2 μL of the specific fluorescence probe; S3. Sample Amplification: Amplify the fluorescence probe LAMP reaction system in a fluorescence quantitative PCR instrument. Set the amplification program as a constant temperature reaction at 65°C for 15 s and a constant temperature treatment at 70°C for 40 s (collect signals, with the number of cycles being 40). S4. Result Judgment: Analyze the test sample based on the real-time fluorescence PCR amplification curve to determine whether the African swine fever virus gene exists in the test sample.

[0031] The method for judging the test results of the kit in this application is as follows: (1) Positive control: There is a specific amplification curve. (2) Negative control: There is no specific amplification curve. Judgment of the test sample results: (1) Positive: There is a specific amplification curve. (2) Negative: There is no specific amplification curve.

[0032] Example 3 Specificity detection of the kit for detecting African swine fever virus using the fluorescence probe method LAMP.

[0033] Using African swine fever virus DNA as the standard product; DNA extracted from porcine pseudorabies virus PRV and porcine circovirus type 2 PCV2, and cDNA extracted from classical swine fever virus CSFV, porcine reproductive and respiratory syndrome virus PRRSV, and porcine epidemic diarrhea virus PEDV as the test sample DNA, and perform specificity detection according to the method described in Example 2.

[0034] The test results are as Figure 2 shown. It can be seen from this figure that the kit of the present invention can successfully detect the African swine fever virus DNA standard product (corresponding to tube 1); classical swine fever virus CSFV, porcine reproductive and respiratory syndrome virus PRRSV, porcine pseudorabies virus PRV, porcine circovirus type 2 PCV2, and porcine epidemic diarrhea virus PEDV (corresponding to tubes 2, 3, 4, 5, and 6 respectively) are not detected. The results show that the kit prepared with the primer combination of this application has good specificity.

[0035] Example 4 Sensitivity detection of the kit for detecting African swine fever virus using the fluorescence probe method LAMP.

[0036] 1. Preparation of the template: Perform 10-fold serial dilutions on the original plasmid concentration of the African swine fever virus positive plasmid. The plasmid concentrations after serial dilution are 90.5 ng / μl, 9.05 ng / μl, 0.905 ng / μl, 0.0905 ng / μl, 9.05 pg / μl, and 1.81 pg / μl (corresponding to tubes 1, 2, 3, 4, 5, and 6 respectively), and perform fluorescence probe LAMP and fluorescence quantitative RT-PCR amplification to detect the sensitivity. 2. Fluorescent probe LAMP reaction system: 20 μL of LAMP reaction solution (composed of 12.5 μL of reaction buffer (composed of 3.5 μL of dNTP, 3 μL of 10× ThermoPol buffer, 3 μL of MgSO 4 3 μL and 3 μL of betaine), 1 μL of 5 μmol / L outer primer F3, 1 μL of 5 μmol / L outer primer B3, 1 μL of 30 μmol / L inner primer FIP, 1 μL of 30 μmol / L inner primer BIP, 1 μL of 20 μmol / L loop primer LB, 2 μL of Bst DNA polymerase and 1.5 μL of RNase-free water), 3 μL of sample DNA and 2 μL of specific fluorescent probe (fluorescent reporter group is FAM, fluorescent quenching group is BHQ1), with a total volume of 25 μL. The reaction procedure is: constant temperature reaction at 65°C for 15 s, constant temperature treatment at 70°C for 40 s (collecting signals, with 40 cycles); 3. Fluorescent quantitative RT-PCR reaction system: Operate according to the African swine fever virus fluorescent PCR detection kit (purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd.). The reaction system is: 17.5 μL of ASFV reaction solution, 2.5 μL of enzyme mixture and 5 μL of template, with a total volume of 25 μL. The reaction procedure is: reverse transcription: 50°C for 10 min; pre-denaturation: 95°C for 3 min; PCR amplification: cycle at 95°C for 5 s, 55°C for 40 s, with 40 cycles. Fluorescent signals are collected at the second step (55°C for 40 s) of each cycle (fluorescent reporter group "FAM", fluorescent quenching group "None").

[0037] The detection results are shown in Figure 3. Figure 3a They are the detection results of the fluorescent probe LAMP, and the results show that the lowest detection limit is 1.81 pg / μl. Figure 3b They are the detection results of the fluorescent quantitative RT-PCR, and the results show that the lowest detection limit is 0.0905 ng / μl. The detection sensitivity of the fluorescent probe LAMP is 50 times higher than that of the fluorescent quantitative RT-PCR.

[0038] Example 5 Use the kit of the present application and the real-time fluorescent quantitative RT-PCR method in Example 4 to simultaneously detect 50 clinical samples (40 of which are negative samples and 10 are positive samples), and analyze the coincidence rate of the two detection results. The results are shown in Table 2.

[0039] Table 2

[0040] According to the detection results in Table 2, the detection results of the fluorescence probe LAMP method established in this application are consistent with those of the fluorescence quantitative RT-PCR method, and the coincidence rate is 100%. However, the fluorescence quantitative RT-PCR has cumbersome detection steps and a long detection time, while the fluorescence probe LAMP is more convenient and fast, and the result accuracy is also relatively high.

[0041] This specific embodiment is only an explanation of this application, and it does not limit this application. After reading this specification, those skilled in the art can make modifications to this embodiment without creative contributions as needed, but as long as it is within the scope of the claims of this application, it is protected by the patent law.

[0042] <110>Taizhou Leiling Bio-Tech Co., Ltd. <120>Kit for detecting African swine fever virus by fluorescence probe LAMP method <160>13 <170>SIPO SequenceListing 1.0 <210>1 <211>20 <212>DNA <213>Artificial Sequence <400>1 ccgtaactgc tcatggtatc 20 <210>2 <211>19 <212>DNA <213>Artificial Sequence <400>2 tctcttgctc tggatacgt 19 <210>3 <211>45 <212>DNA <213>Artificial Sequence <400>3 cactgcctcc gtagtggaag tcgataaatt tccatcaaag ttctg 45 <210>4 <211>39 <212>DNA <213>Artificial Sequence <400>4 taaaacccct gacgatcctg gatatgacca ctgggttgg 39 <210>5 <211>20 <212>DNA <213>Artificial Sequence <400>5 ttgctttgaa gccacgggag 20 <210>6 <211>18 <212>DNA <213>Artificial Sequence <400>6 tacagctctt ccagacgc 18 <210>7 <211>18 <212>DNA <213>Artificial Sequence <400>7 catcatcgca ccaggatc 18 <210>8 <211>50 <212>DNA <213>Artificial Sequence <400>8 catgagcagt tacggaaatg ttttttgttc atctatatct gatattagcc 50 <210>9 <211>42 <212>DNA <213>Artificial Sequence <400>9 aatttccatc aaagttctgc agcttttaat cgcactgcct cc 42 <210>10 <211>19 <212>DNA <213>Artificial Sequence <400>10 gtatccgatc acgttacct 19 <210>11 <211>18 <212>DNA <213>Artificial Sequence <400>11 atatgaccac tgggttgg 18 <210>12 <211>45 <212>DNA <213>Artificial Sequence <400>12 gctgcagaac tttgatggaa atttaaacat ttccgtaact gctca 45 <210>13 <211>39 <212>DNA <213>Artificial Sequence <400>13 ctacggaggc agtgcgatta atattcctcc cgtggcttc 39。

Claims

1. A kit for detecting African swine fever virus using the fluorescent probe method LAMP, characterized in that: It includes LAMP reaction solution for detecting African swine fever virus, specific fluorescent probe, and African swine fever virus genomic DNA; The LAMP reaction solution includes the following components: reaction buffer, specific primer combination, enzyme solution and RNase-free water; The specific primer combination includes a pair of specific outer primers, a pair of specific inner primers and a loop primer, and the nucleotide sequences thereof are respectively: External primer F3: CCGTAACTGCTCATGGTATC (SEQ ID NO. 1); External primer B3: TCTCTTGCTCTGGATACGT (SEQ ID NO. 2); Internal primer FIP: CACTGCCTCCGTAGTGGAAGTCGATAAATTTCCATCAAAGTTCTG (SEQ ID NO. 3); Internal primer BIP: TAAAACCCCTGACGATCCTGGATATGACCACTGGGTTGG (SEQ ID NO. 4); Loop primer LB: TTGCTTTGAAGCCACGGGAG (SEQ ID NO. 5); The sequence of the specific fluorescent probe is: TAGTGAAGGGTATGTAAGAGCTGC, the fluorescent reporter group of the specific fluorescent probe is selected from one of FAM, VIC, JOE, and TET, and the fluorescent quenching group of the specific fluorescent probe is selected from one of BHQ1, BHQ2, BHQ3, and Dabcy1.

2. The kit for detecting African swine fever virus using the fluorescent probe method LAMP according to claim 1, characterized in that: The reaction buffer is composed of a mixture of dNTP, 10×ThermoPol buffer, MgSO4 and betaine.

3. The kit for detecting African swine fever virus using the fluorescent probe method LAMP according to claim 1, characterized in that: The enzyme solution is Bst DNA polymerase.

4. A detection method of a kit for detecting African swine fever virus using the fluorescent probe method LAMP according to any one of claims 1 to 3, characterized in that: The specific steps include the following: S1. Nucleic acid extraction: Use a viral DNA extraction kit to obtain the DNA of the sample to be tested; S2. Prepare the fluorescent probe LAMP reaction system: mix the LAMP reaction solution, the sample DNA to be tested and the specific fluorescent probe, and set up a positive control group and a negative control group; S3, sample amplification: the fluorescent probe LAMP reaction system is amplified in a fluorescent quantitative PCR instrument, and the amplification program is set to 60-70°C constant temperature reaction for 10-20s, 60-80°C constant temperature treatment for 30-50s, and the signal is collected. The number of cycles is 30-50; S4. Result determination: Analyze the sample to be tested according to the real-time fluorescence PCR amplification curve to determine whether the sample to be tested contains African swine fever virus genes.

5. The detection method of the kit for detecting African swine fever virus using the fluorescent probe method LAMP according to claim 4, characterized in that: In step S2, the positive control group includes LAMP reaction solution, African swine fever virus genomic DNA and a specific fluorescent probe; the negative control group includes LAMP reaction solution, RNase-free water and a specific fluorescent probe.

Images