Nucleic acid composition, detection kit based on RPA-CRISPR / Cas12a A-type Seneca virus nucleic acid, application and visual one-step detection method

Abstract

The invention discloses a nucleic acid composition, a detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid, application and a visual one-step detection method, the composition comprises a Seneca virus type A RPA primer pair and crRNA, the RPA primer pair and the crRNA aim at the VP1 gene of the Seneca virus type A, and the RPA primer pair and the crRNA aim at the VP1 gene of the Seneca virus type A. The crRNA is an RNA sequence which is designed based on a suboptimal PAM sequence and can be matched with an amplification product sequence of the RPA primer pair. According to the present invention, the special crRNA designed based on the suboptimal prospacer adjacent motifs (sPAM) is applied to the SVA detection, and the RPA amplification and the CRISPR / Cas12a cutting are integrated into the one tube, such that the incompatibility problem of the RPA amplification and the Cas12a cutting in the one reaction tube is overcome;

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and relates to a nucleic acid composition, a detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid, and an application and a one-step visualization detection method. Background Art

[0002] Senecavirus A (SVA) is a newly emerged pathogen that causes disease in pigs. It can cause blisters, ulcers in the mouth, nose and hoof of pigs of different ages, as well as acute death in newborn piglets. The disease has been widely prevalent at home and abroad, posing a great threat to the global pig industry and a huge challenge to disease prevention and control. Early diagnosis of pathogens is the main link in disease prevention and control. The application of modern molecular technology has made it possible to complete the diagnosis of SVA in just a few hours, greatly improving the detection efficiency. Most of these molecular detection methods are based on RT-PCR, among which fluorescent quantitative RT-PCR is the gold standard for SVA detection. However, these RT-PCR-based detection methods all rely on laboratory nucleic acid amplification instruments and are not popularized in clinical pathogen detection. With the continuous development of science and technology, isothermal amplification technology has emerged. Loop-mediated isothermal amplification technology (LAMP) and recombinase polymerase amplification technology (RPA) have been successfully applied to SVA diagnosis and can be used for on-site instant detection. However, due to the short development time of isothermal amplification technology, the current isothermal amplification technology is not as stable as PCR technology and is easily interfered by various factors in the environment, resulting in false positives. CRISPR / Cas technology is a popular gene editing technology in recent years. This technology has brought great changes to the fields of bioengineering and medicine. CRISPR / Cas technology is mainly used in animal model preparation, whole genome screening and nucleic acid detection. The targeted recognition and non-specific cleavage activity of CRISPR / Cas show great potential in the development of in vitro nucleic acid detection technology. The CRISPR / Cas system consists of CRISPR RNA (crRNA) and Cas protein. CrRNA is complementary to the target sequence and can guide Cas protein to perform sequence-specific recognition and non-specific cleavage. In most DNA-targeted CRISPR / Cas systems, the binding of Cas protein to target DNA depends on the recognition of the protospacer adjacent motif (PAM) by the crRNA-guided Cas protein, where the PAM sequence is a short DNA sequence adjacent to the protospacer target site, generally 3-5 nt, and different Cas proteins recognize different PAM sequences. Cas12a mainly recognizes TTTN type PAM sequences.

[0003] Combining isothermal amplification technology with the CRISPR / Cas detection system and adding the recognition step of CRISPR / Cas12a protein on the basis of isothermal amplification of the target gene can improve the accuracy and sensitivity of detection and simplify the operation. Therefore, establishing a method for detecting SVA based on the RPA-CRISPR / Cas12a system is of great significance for disease prevention and control. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a nucleic acid composition, a detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid, an application and a one-step visualization detection method, a special crRNA designed based on suboptimal protospacer adjacent motifs (sPAM) is used for SVA detection, and RPA amplification and CRISPR / Cas12a cutting are integrated into one tube, overcoming the incompatibility problem of RPA amplification and Cas12a cutting in one reaction tube. The entire detection process only requires one sample addition step, avoiding potential contamination problems during amplicon transfer, simplifying the operation steps, and providing a simple operation, high sensitivity, good specificity, high accuracy, short detection time, and no need for complex instruments and equipment for clinical instant detection of SVA.

[0005] The technical solution provided by the present invention is as follows:

[0006] The invention provides a nucleic acid composition, which comprises a Senecavirus type A RPA primer pair and crRNA, wherein the RPA primer pair and the crRNA are directed to the Senecavirus type A VP1 gene, and the crRNA is an RNA sequence designed based on a suboptimal PAM sequence and capable of matching the amplification product sequence of the RPA primer pair.

[0007] Furthermore, the RPA primer includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer RPA-F is shown in SEQ ID NO.2, the nucleotide sequence of the reverse primer RPA-R is shown in SEQ ID NO.3, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.1.

[0008] The present invention also provides a detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid, wherein the kit comprises the nucleic acid composition described above.

[0009] Furthermore, the kit includes an RPA amplification premix and a CRISPR / Cas12a premix, the RPA amplification premix includes a forward primer RPA-F, a reverse primer RPA-R, a buffer, magnesium acetate and enzyme-free water; the CRISPR / Cas12a premix includes LbCas12a, crRNA, a fluorescent probe ssDNA and NEB Buffer 2.1.

[0010] Further, the concentration of the LbCas12a is 0.5 μg / μL, the concentration of the crRNA is 0.5 μM, and the concentrations of the forward primer RPA-F and the reverse primer RPA-R are 10 μM.

[0011] Furthermore, the nucleotide sequence of the fluorescent probe ssDNA is 5'-FAM-TTATT-BHQ1-3'.

[0012] The present invention also provides the use of the above-mentioned RPA-CRISPR / Cas12a type A Senecavirus nucleic acid detection kit in the preparation of a product for detecting porcine type A Senecavirus.

[0013] The present invention also provides a one-step visualization detection method for type A Senecavirus nucleic acid based on RPA-CRISPR / Cas12a, comprising the following steps: (1) Prepare RPA premix by mixing buffer, RPA-F primer, RPA-R primer, enzyme-free water and magnesium acetate; (2) Prepare CRISPR / Cas12a premix by mixing LbCas12a, 1 NEB Buffer 2.1, fluorescent probe ssDNA and crRNA; (3) Then mix the RPA premix, CRISPR / Cas12a premix and template DNA and react at 37°C for 40 minutes; (4) After the reaction is completed, the results are interpreted visually using a blue light or ultraviolet light excitation device; The template DNA is the extracted genomic DNA of the sample to be tested.

[0014] Furthermore, the amount of each component added to the RPA premix was 15 μL buffer, 1.2 μL RPA-F primer with a concentration of 10 μM, 1.2 μL RPA-R primer with a concentration of 10 μM, 4.6 μL enzyme-free water and 2 μL magnesium acetate, and the amount of each component added to the CRISPR / Cas12a premix was 1 μL LbCas12a with a concentration of 0.5 μg / μL, 1 μL crRNA with a concentration of 0.5 μM, 1 μL fluorescent probe ssDNA and 3 μL NEB Buffer 2.1.

[0015] Furthermore, the template DNA contains or does not contain a conserved nucleic acid sequence amplified by RPA in the VP1 gene of type A Seneca virus.

[0016] When the test sample is positive, the RPA product is a conserved sequence in the VP1 gene of type A Seneca virus that is different from other species. At this time, the nucleic acid sequence of the RPA product is: CCGACAACGCCGAGACTGGTGTTATTGAGGCAGGTAACACTGACACCGATTTCTCTGGTGAACTGGCGGCTCCTGGCTCTAACCATACTAATGTCAAATTTCTTTTTGATCGATCTCGACTACTGAATGTAATTAAGGTACTGGAGAAGGACGCTGTCTTCCCCCGTCCTTTCCCCACAGCAACAGGTGCACAGCAGGACGATGGTTA (SEQ ID NO.4).

[0017] Beneficial Effects

[0018] 1. The specific crRNA sequence designed in the present invention is designed for the specific suboptimal PAM sequence of SVA, which can effectively solve the incompatibility problem between RPA amplification and CRISPR / Cas12a, and realize a one-step detection method that is both simple and highly sensitive.

[0019] 2. The present invention develops a method for rapid detection of SVA in the pig farming industry, which integrates RPA amplification and CRISPR / Cas12a reaction into a one-step reaction in a reaction tube through optimization. It provides a simpler means of rapid on-site detection of SVA. Compared with the RPA-CRISPR / Cas12a two-step method, only one sample addition is required, eliminating the step of opening and transferring the RPA amplified product. Thereby avoiding the risk of contamination that may occur during the transfer process. At the same time, the reaction system of the two-step method of RPA and CRISPR / Cas12a is compatible with one reaction tube, saving the use of related reagents and saving costs.

[0020] 3. The RPA-CRISPR / Cas12a of the present invention is used for SVA detection, which has the characteristics of simple operation, high sensitivity, and good stability. It does not require complex instruments and equipment, is very suitable for on-site detection, and helps to reduce the economic losses caused by SVA infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1It is the expression and purification of Cas12a protein and the verification of protein activity. Figure A is the nucleic acid electrophoresis diagram of amplified Cas12a gene; Figures B and C are the Coomassie Brilliant Blue staining diagrams of Cas12a protein induced expression and purification; Figure D is the protein imprint of Cas12a; Figures E and F are the verification diagrams of Cas12a protein activity.

[0022] Figure 2 It is crRNA selection and Cas12a / crRNA concentration screening. Figure A shows three crRNAs designed based on the SVA VP1 gene; Figures B and C are crRNA effect verification diagrams based on CRISPR / Cas12a visualization detection; Figures D and E are orthogonal concentration screening diagrams of Cas12a / crRNA based on CRISPR / Cas12a visualization detection. The Cas12a protein concentrations are 0.25 μg / μl, 0.5 μg / μl, and 1.0 μg / μl from left to right, and the crRNA concentrations are 0.25 μM, 0.50 μM, and 1.0 μM from top to bottom.

[0023] Figure 3 Figure 1 is the RPA primer screening and CRISPR / Cas12a sensitivity. Figure A is the electrophoresis of nucleic acid screening with 3 RPA primers; Figures B and C are based on the sensitivity of CRISPR / Cas12a when there is no amplification based on CRISPR / Cas12a visual detection.

[0024] Figure 4 It is a one-step specific detection. Figure A is the nucleic acid PCR verification diagram of SVA and other porcine viruses; Figures B and C are the specific detection result diagrams based on RPA-CRISPR / Cas12a visualization detection, where reaction groups 1-6 are SVA, PRRSV, CSFV, PEDV, PDCoV, and NTC, respectively.

[0025] Figure 5 Figure A is a one-step detection flow chart; Figures B and C are based on the RPA-CRISPR / Cas12a visualization detection sensitivity chart, where reaction groups 1-7 are 2×10 9 copies / μl, 2×10 7 copies / μl, 2×10 5 copies / μl, 2×10 3 copies / μl, 2×10 1 copies / μl, 2×10 0 copies / μl, NTC.

[0026] Figure 6This is the result of one-step clinical tissue sample testing. Figure A is a visualization of 28 clinical samples based on RPA-CRISPR / Cas12a; Figure B is a comparison of the results of the RPA-CRISPR / Cas12a detection method and the RT-qPCR detection method, where red represents a positive result and green represents a negative result. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with specific embodiments and drawings.

[0028] Unless otherwise specified, the materials and reagents used in the examples can be obtained from commercial sources.

[0029] Source of clinical tissue samples: preserved by this laboratory.

[0030] Reagents and instruments: TwistDX TwistAmp Basic was purchased from TwistDx with the catalog number TABAS03KIT (containing nucleic acid amplification reagent lyophilized enzyme, buffer, and MgOAc); NEBuffer2.1 was purchased from NEB with the catalog number B6002S; TriZol reagent was purchased from Beijing Rambolide with the catalog number R1000; reverse transcription kit was purchased from Nanjing Novozymes with the catalog number R302-01; plasmid mini-extraction kit was purchased from Tiangen Biochemical Technology Co., Ltd. with the catalog number DP103-02; LightCycler 96 instrument was purchased from Roche; nucleic acid imager was purchased from Shanghai Tianneng Technology Co., Ltd.; crRNA and RPA primers were synthesized by Anshengda.

[0031] Example 1 Construction of Cas12a prokaryotic expression vector and protein purification

[0032] Using the 6 His-MBP-TEV-huLbCas12a plasmid (ID: 90096) of Addgene as a template, upstream and downstream primers (upstream primer: GCGGGATCCATGAGCAAGCTGGAGAAGTTTAC, downstream primer: ATGTCGACTGTGCTTCACGCTGGTCTGGGC) were designed to PCR amplify the LbCas12a gene. The results of agarose gel electrophoresis showed that the target fragment was consistent with the LbCas12a gene. The PCR product was recovered, digested, and connected to the pET-28a vector. The ligation product was transformed into DH5a competent cells, and the plasmid was extracted after bacterial inspection and sequencing. The successfully constructed plasmid was transformed into the BL21 expression strain, inoculated into 5 mL of culture medium for culture, and then transferred to 200 mL of culture medium for expansion. IPTG was added when OD600 was 0.6-0.8, and the induced bacterial solution was centrifuged at 4 ℃ and 7000 g for 5 min. The precipitate was collected and stored at -20 ℃ for later purification. All steps of protein purification were performed on ice. The stored bacteria were added with 10 ml of equilibrium buffer and resuspended by ultrasonication on ice for 30 min. The fully disrupted bacterial solution was centrifuged at 12,000 rpm for 10 min at 4 °C. The protein solution was added to a gravity column filled with Ni-NTA filler for purification. The obtained protein was concentrated and the concentration was determined. After the protein activity was verified, it was stored at -80 °C. Figure 1 shown.

[0033] Example 2

[0034] 1. Design of crRNA, ssDNA fluorescent probes, and RPA primers

[0035] The present invention searches for multiple full genome sequences of type A Seneca virus through literature and the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). After homology analysis and BLAST, it is found that a gene segment on the VP1 gene of type A Seneca virus is highly conserved. Therefore, 3 crRNAs and 3 pairs of RPA primers are designed for a highly conserved gene segment on the VP1 gene of type A Seneca virus, wherein crRNA1 is designed to fully meet the requirements of the PAM sequence site, crRNA2 is designed according to the suboptimal PAM site, and crRNA3 is not designed according to the PAM site. The detailed sequences are shown in Table 1.

[0036] Table 1. Sequence table of crRNA, RPA primers and probes

[0037]

[0038] 2. Construction of SVA-VP1 standard plasmid

[0039] The whole genome sequences of multiple strains of Seneca virus type A were retrieved in NCBI. Through analysis and comparison, the VP1 gene of type A Seneca virus was identified as the target gene. Using SnapGene software, the PCR primers of SVA-VP1 gene were designed according to the accession number MG983756.1 in GenBank (the upstream primer was TACTCGAGATTCCACCGACAACGCCG, and the downstream primer was GCCGGTACCTTGCATCAGCATCTTTTG). The cDNA of type A Seneca virus was used as a template (stored in this laboratory) for PCR amplification. The results were observed by agarose gel electrophoresis. The target fragment was consistent in size with the VP1 gene. The PCR product was recovered, digested with enzymes, and ligated to the pEGFP-C1 vector. After bacterial inspection and sequencing, the plasmid was extracted using a plasmid extraction kit, which was the SVA-VP1 standard plasmid.

[0040] 3. Verification of the validity of crRNA sequences and optimization of LbCas12a protein concentration

[0041] The effectiveness of the three designed type A Seneca virus crRNAs was verified by the CRISPR / Cas12a detection system. The validation reaction system was: 1 μl crRNA, 1 μl Cas12a, 1 μl ssDNA, 1 μl SVA standard plasmid and 32 μl enzyme-free water. The reaction was placed in a LightCycler 96 instrument and reacted at 37 °C for 30 min. The fluorescence signal was collected every 1 min, and the end point fluorescence signal value was selected. Graphpad prism8.0 software was used to draw the graph, and finally photos were taken with a smartphone under blue light, ultraviolet light and natural light. The results are as follows Figure 2 As shown in BC, the suboptimal crRNA2 is effective in the CRISPR / Cas reaction, and the crRNA2 effect is verified by the RPA-CRISPR / Cas12a one-step system. The method for verifying the effect of crRNA2 is the same as the sensitivity test method in Example 4. The results show that crRNA2 has a good effect, such as Figure 5 As shown in BC.

[0042] The concentrations of Cas12a and crRNA were optimized by the CRISPR / Cas12a detection system. The reaction system included: 1 μl crRNA, 1 μl Cas12a, 1 μl ssDNA, 1 μl SVA standard plasmid and 32 μl enzyme-free water (wherein the Cas12a protein concentrations were 0.25 μg / μl, 0.5 μg / μl, and 1 μg / μl, respectively, and the crRNA concentrations were 0.25 μM, 0.5 μM, and 1 μM, respectively). The reaction was carried out in a LightCycler 96 instrument at 37 °C for 30 min, and the fluorescence signal was collected every 1 min. The end point fluorescence signal value was selected, and the graph was drawn using Graphpad prism8.0 software. Finally, a photo was taken with a smartphone under blue light. According to the fluorescence signal value, the optimal reaction concentration was determined to be 0.5 μg / μl for Cas12a and 0.5 μM for crRNA). Figure 2 As shown in DE.

[0043] 4. Screening of RPA primers

[0044] The SVA-VP1 standard plasmid was diluted 10-fold in a gradient sequence to prepare 10 11 , 10 9 , 10 7 , 10 5 , 10 3 , 10 1 , 10 0 The SVA standard plasmid with 100 copies / μl was amplified isothermally according to the instructions of the TwistDX TwistAmp Basic kit, and then agarose gel electrophoresis was performed to screen the optimal RPA primers according to the amplification efficiency of each pair of RPA primers ( Figure 3 A), followed by experiments to determine the sensitivity of CRISPR / Cas12a detection in the absence of amplification ( Figure 3 BC).

[0045] Example 3 Establishment of a one-step detection method for visualization of Senecavirus nucleic acid type A based on RPA-CRISPR / Cas12a

[0046] (1) Preparation of porcine clinical tissue samples: 200 mg of porcine clinical tissue was added to 1 ml of PBS and ground into a homogenate using a cryo-grinder. The tissue was then frozen and thawed three times and centrifuged at 12,000 rpm at 4°C to obtain 200 μl of the supernatant. RNA was extracted using TRIzol reagent and then cDNA was obtained using a reverse transcription kit, which was subsequently used as a template for testing.

[0047] (2) Preparation of one-step RPA premix: Add 15 μl buffer, 1.2 μl forward primer RPA-F (10 μM), 1.2 μl reverse primer RPA-R (10 μM), 4.6 μl enzyme-free water and 2 μL MgOAC to a tube of RPA nucleic acid amplification reagent freeze-dried enzyme;

[0048] (3) Preparation of one-step CRISPR / Cas12a premix: 1 μl LbCas12a (0.5 μg / μL), 1 μl crRNA (0.5 μM), 1 μl fluorescent probe ssDNA-FQ, 3 μl NEB Buffer 2.1;

[0049] (4) Mix the above RPA premix and CRISPR / Cas12a premix evenly, add 1 μL of the template to be tested, and mix evenly to obtain a total reaction system of 30 μL. After reacting at 37 °C for 40 minutes, observe the results. The results were observed under blue light, ultraviolet light, and natural light, and images were taken with a smartphone.

[0050] Example 4 Analysis of specificity and sensitivity of RPA-CRISPR / Cas12a detection method

[0051] (1) Specificity test of RPA-CRISPR / Cas12a detection method: The method established in the steps of Example 3 was applied to evaluate the specificity of the method by detecting several common viruses in the pig farming industry, including Senecavirus type A (SVA), porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV) and porcine deltacoronavirus (PDCoV) and a no-template blank control (NTC). The results are shown in Figure 4 As shown, only SVA can produce fluorescent signals, while the other viruses and the no-template blank control do not produce fluorescent signals, indicating that this method has good specificity.

[0052] (2) RPA-CRISPR / Cas12a detection method sensitivity test: Specifically, the SVA-VP1 standard plasmid extracted according to Example 4 was measured for concentration using Nanodrop, and then the copy number was calculated according to the copy number calculation formula. The plasmid was diluted in a 10-fold gradient to prepare 10 9 , 10 7 , 10 5 , 10 3 , 10 1 , 10 0 The SVA-VP1 standard plasmid with a concentration of 100 copies / μl was used for sensitivity detection according to the method established in the steps of Example 5. The results are shown in Figure 5 As shown, the lowest detection limit is 2.0×100 copies / μl.

[0053] Example 5 Detection of clinical samples

[0054] 28 pig tissues suspected of being infected with SVA were collected from different pig farms in Hebei Province. The 28 clinical tissue samples were processed according to the method of step (1) of the above Example 3, RNA was extracted, reverse transcribed into cDNA, and detected by the published RT-qPCR method for detecting SVA (DOI: 10.1016 / j.jviromet.2016.10.012). If the cq value of the RT-qPCR detection result is less than 30, it is judged to be positive, of which 8 samples are positive, and the positive detection rate is 28.5%. The method established in the above Example 3 step was used to detect the 28 clinical samples, of which 8 samples were positive (containing a conserved nucleic acid sequence amplified by RPA in the VP1 gene of type A Seneca virus as shown in SEQ ID NO.4), and the positive rate was 28.5%, which is consistent with the published RT-qPCR detection results and has clinical application value. The details of the clinical sample detection results are shown in Tables 2 and Figure 6 .

[0055] Table 2 SVA clinical sample test results

[0056]

[0057] SEQ ID NO.4: CCGACAACGCCGAGACTGGTGTTATTGAGGCAGGTAACACTGACACCGATTTCTCTGGTGAACTGGCGGCTCCTGGCTCTAACCATACTAATGTCAAATTTCTTTTTGATCGATCTCGACTACTGAATGTAATTAAGGTACTGGAGAAGGACGCTGTCTTCCCCCGTCCTTTCCCCACAGCAACAGGTGCACAGCAGGACGATGGTTA.

Claims

1. A nucleic acid composition, characterized in that The composition comprises a Senecavirus type A RPA primer pair and crRNA, wherein the RPA primer pair and crRNA are directed to the Senecavirus type A VP1 gene, and the crRNA is an RNA sequence designed based on a suboptimal PAM sequence and capable of matching the amplification product sequence of the RPA primer pair.

2. The nucleic acid composition according to claim 1, characterized in that The RPA primers include a forward primer and a reverse primer, the nucleotide sequence of the forward primer RPA-F is shown in SEQ ID NO.2, the nucleotide sequence of the reverse primer RPA-R is shown in SEQ ID NO.3, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.

1.

3. A detection kit based on RPACRISPR / Cas12a type A Senecavirus nucleic acid, characterized in that: The kit comprises the nucleic acid composition according to any one of claims 1-2.

4. The detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid according to claim 3, characterized in that The kit includes an RPA amplification premix and a CRISPR / Cas12a premix, wherein the RPA amplification premix includes a forward primer RPA-F, a reverse primer RPA-R, a buffer, magnesium acetate and enzyme-free water; and the CRISPR / Cas12a premix includes LbCas12a, crRNA, a fluorescent probe ssDNA and NEB Buffer 2.

1.

5. The RPA-CRISPR / Cas12a type A Seneca virus nucleic acid detection kit according to claim 4, characterized in that: The concentration of the LbCas12a is 0.5 μg / μL, the concentration of the crRNA is 0.5 μM, and the concentrations of the forward primer RPA-F and the reverse primer RPA-R are 10 μM.

6. The detection kit based on RPA-CRISPR / Cas12a type A Seneca virus nucleic acid according to claim 4, characterized in that The nucleotide sequence of the fluorescent probe ssDNA is 5'-FAM-TTATT-BHQ1-3'.

7. Use of the RPA-CRISPR / Cas12a type A Senecavirus nucleic acid detection kit according to any one of claims 3 to 6 in the preparation of a product for detecting porcine type A Senecavirus.

8. A one-step visualization detection method for type A Senecavirus nucleic acid based on RPA-CRISPR / Cas12a, characterized in that: The following steps are involved: (1) Prepare RPA premix by mixing buffer, RPA-F primer, RPA-R primer, enzyme-free water and magnesium acetate; (2) Prepare CRISPR / Cas12a premix by mixing LbCas12a, 1 NEB Buffer 2.1, fluorescent probe ssDNA and crRNA; (3) Then mix the RPA premix, CRISPR / Cas12a premix and template DNA and react at 37°C for 40 minutes; (4) After the reaction is completed, the results are interpreted visually using a blue light or ultraviolet light excitation device; The template DNA is the extracted genomic DNA of the sample to be tested.

9. The method of claim 8, wherein the method comprises: The amount of each component added to the RPA premix was 15 μL buffer, 1.2 μL RPA-F primer with a concentration of 10 μM, 1.2 μL RPA-R primer with a concentration of 10 μM, 4.6 μL enzyme-free water and 2 μL magnesium acetate. The amount of each component added to the CRISPR / Cas12a premix was 1 μL LbCas12a with a concentration of 0.5 μg / μL, 1 μL crRNA with a concentration of 0.5 μM, 1 μL fluorescent probe ssDNA and 3 μL NEB Buffer 2.

1.

10. The method for visual one-step detection of Senecavirus nucleic acid based on RPA-CRISPR / Cas12a type A according to claim 9, characterized in that: The template DNA contains or does not contain a conservative nucleic acid sequence amplified by RPA in the VP1 gene of type A Seneca virus.

Images