SgRNA targeting carbonic anhydrase 2 and application thereof

By using CRISPR-Cas9 gene editing technology and AAV delivery system, sgRNA targeting carbonic anhydrase 2 was designed, achieving highly efficient dual-site knockout of carbonic anhydrase 2. This solved the problem of low bioavailability of traditional drugs, significantly reduced intraocular pressure and reduced retinal ganglion cell apoptosis, and had a long-lasting antihypertensive effect.

CN116042618BActive Publication Date: 2026-07-07ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV
Filing Date
2022-12-06
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing carbonic anhydrase inhibitors have low bioavailability and significant adverse reactions when treating glaucoma, and traditional eye drops require frequent administration, making it difficult to achieve a long-term antihypertensive effect.

Method used

Using CRISPR-Cas9 gene editing technology, sgRNA targeting carbonic anhydrase 2 was designed and delivered to the ciliary body via AAV technology to achieve dual-site knockout of carbonic anhydrase 2 and inhibit aqueous humor production.

Benefits of technology

It achieves highly efficient Car2-targeted knockout, significantly reduces intraocular pressure, reduces retinal ganglion cell apoptosis, has a long-lasting antihypertensive effect, reduces the frequency of medication, and improves compliance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116042618B_ABST
    Figure CN116042618B_ABST
Patent Text Reader

Abstract

The application discloses sgRNA targeting carbonic anhydrase 2 and application thereof. The sgRNA targeting carbonic anhydrase 2 comprises sgRNA as shown in SEQ ID NO. 1 and sgRNA as shown in SEQ ID NO. 2. The application develops sgRNA for double-site knockout of ciliary body Car2 based on CRISPR-Cas9 and AAV technology, realizes efficient Car2 targeting, has high knockout efficiency, effectively inhibits aqueous humor production, has obvious effect of reducing intraocular pressure and long maintenance time, significantly reduces retinal ganglion cell apoptosis, can be used for glaucoma treatment, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to an sgRNA that targets carbonic anhydrase 2 and its applications. Background Technology

[0002] Glaucoma, the leading cause of irreversible blindness worldwide, is a group of diseases characterized by optic disc atrophy and cupping, visual field defects, and decreased visual acuity. Elevated intraocular pressure (IOP) is a significant risk factor for glaucoma. Studies have shown that lowering IOP by 20-40% can slow the progression of visual field loss by half. Currently, IOP-lowering therapy is the primary clinical strategy for treating glaucoma. Traditional IOP-lowering drugs include prostaglandin derivatives, beta-adrenergic receptor blockers, alpha-adrenergic receptor agonists, carbonic anhydrase inhibitors, and hyperosmolar agents, which primarily lower IOP by increasing aqueous humor outflow, inhibiting aqueous humor production, and reducing intraocular volume.

[0003] Carbonic anhydrase is expressed in ciliary body epithelial cells and catalyzes the interconversion of bicarbonate and carbon dioxide, playing a crucial role in aqueous humor production. Currently, brinzolamide, a commonly used clinical inhibitor of carbonic anhydrase, reduces aqueous humor secretion by inhibiting the activity of carbonic anhydrase 2 (Car2) in apigmented ciliary body epithelial cells, thereby lowering intraocular pressure by 15-20% and is used to treat various types of glaucoma. However, due to physiological limitations of the tear film and cornea, as well as the short residence time of the drug on the corneal surface, traditional eye drops have limitations such as low bioavailability, frequent administration, and significant adverse reactions. Therefore, whether it is possible to directly act on the ciliary body to inhibit carbonic anhydrase activity, maintain a long-lasting antihypertensive effect, and reduce the frequency of patient administration to improve compliance remains to be explored.

[0004] Gene editing technology can provide single but permanent therapeutic alterations. The eye, with its self-sealing blood-retinal barrier, has a small invasive area after gene therapy, making it an ideal target organ. CRISPR-Cas9 gene editing technology uses artificially designed single-stranded guide RNA (sgRNA) to recognize the target genomic sequence, guiding the Cas9 protease to cleave the DNA double strand. This results in gene knockout through frameshift mutations formed by non-homologous end joining, or gene insertion, deletion, and mutation through homologous recombination repair. Previous studies have shown that designing a single sgRNA targeting the fourth exon of mouse Car2 resulted in an insertion / deletion efficiency of only 26% and no significant blood pressure-lowering effect in normal mice. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and to provide an sgRNA that targets carbonic anhydrase 2 and its application.

[0006] The objective of this invention is achieved through the following technical solution: a sgRNA targeting carbonic anhydrase 2, comprising the sgRNA shown in SEQ ID NO.1 (5'-TGATCCAGTTTCACTTTCAC-3') and the sgRNA shown in SEQ ID NO.2 (5'-AAAGCTGTGCAGCAACCGGA-3').

[0007] The present invention also provides a DNA molecule encoding the above-mentioned sgRNA.

[0008] The present invention also provides a recombinant vector having the above-described DNA molecules.

[0009] The present invention also provides the use of the above-mentioned sgRNA, DNA molecule or recombinant vector in the preparation of drugs for treating glaucoma.

[0010] The present invention also provides a drug for treating glaucoma, wherein the active ingredient is the above-mentioned sgRNA, DNA molecule or recombinant vector.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] This invention develops a dual-site knockout sgRNA for ciliary body Car2 based on CRISPR-Cas9 and AAV technology, achieving highly efficient Car2 targeting, high knockout efficiency, effective inhibition of aqueous humor production, significant and long-lasting intraocular pressure reduction, and significant reduction of retinal ganglion cell apoptosis. It can be used for glaucoma treatment and has broad application prospects. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the carbonic anhydrase 2 DNA transcript sequence and CDS region.

[0014] Figure 2 This is a schematic diagram of the sgRNA target sequence location.

[0015] Figure 3 This is a schematic diagram of the plasmids constructed from each sgRNA.

[0016] Figure 4 This is a peak diagram of sgRNA knockout sequencing; where A uses sgRNA2+4, B uses sgRNA1+3, and C uses sgRNA5+6.

[0017] Figure 5 This is a diagram showing the results of the sgRNA knockout T7E1 restriction enzyme digestion experiment.

[0018] Figure 6 These are the plasmid map and sequencing results; where A is the plasmid map and B is the sequencing result.

[0019] Figure 7 These are simulated patterns and enzyme digestion electrophoresis results; where A is the simulated pattern and B is the enzyme digestion electrophoresis result.

[0020] Figure 8 These are the results of an experiment to knock out carbonic anhydrase 2 in the eyes of normal mice; where A is an intraocular pressure graph, B is an agarose gel electrophoresis image, C is a Western blot result, D is a protein level graph of ciliary body carbonic anhydrase 2, and E is an immunofluorescence localization result.

[0021] Figure 9 These are the results of an experiment on the treatment of chronic ocular hypertension by knocking out carbonic anhydrase 2; where A is an intraocular pressure statistical graph, B is a statistical graph of the number of Brn3a positive cells in a single field of view, and C is the result of Brn3a immunofluorescence staining. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1:

[0024] 1. Design sgRNA sequences

[0025] A search of the Ensemble database for mouse carbonic anhydrase 2 (Car2) revealed its gene ID as ENSMUSG00000027562. Its transcript has three variants: Car2-201 (ENSMUST00000029078.9), Car2-202 (ENSMUST00000192609.6), and Car2-203 (ENSMUST00000195520.2). Car2-201 has been shown to have protein-coding function and participate in aqueous humor secretion. The Car2-201 transcript contains seven exons. Introducing it into Snapgene reveals… Figure 1 Since the first exon is not completely contained in the CDS region, we selected the nucleic acid sequences of exons 2, 3, and 4 on the transcript for sgRNA design.

[0026] The sequences of exons 2, 3, and 4 were imported into http: / / crispor.tefor.net / crispor.py, which predicted multiple sgRNA sequences. Based on specificity, effectiveness score, and number of mismatched bases, we selected two sgRNA sequences for each exon: sgRNA2 and sgRNA4 for exon 2, sgRNA1 and sgRNA3 for exon 3, and sgRNA5 and sgRNA6 for exon 4. The specific sequences are shown in Table 1.

[0027] Table 1. sgRNA sequences (5'-3') targeting carbonic anhydrase 2

[0028]

[0029] 2. Construct plasmids expressing each sgRNA

[0030] The vector was linearized by enzyme digestion, the target fragment was annealed into a double strand, and then ligated and recombined with the vector and transformed into DH5α competent cells. Positive clones were identified by PCR, plasmids were extracted by shaking and sequenced, and finally a vector plasmid containing the target fragment was constructed. The synthesized plasmid was then sequenced for verification.

[0031] 2.1 Target Fragment Synthesis

[0032] Sangon Biotech designed upstream and downstream primers based on the six designed sgRNA sequences, and added homologous sequences of SapI (Bio-Raybone, SV0067) digestion to the ends of the primer sequences:

[0033] Upstream primer: 5'- TGGG NNNNNNNNNNNNNNNNNNNN-3';

[0034] Downstream primer: 3'- C NNNNNNNNNNNNNNNNNNNN CAA -5'.

[0035] 2.2 Enzyme digestion vector

[0036] The required vector backbone ssAAV.U6.(Sp)sgRNA.CAG.SV40 NLS-EGFP.WPRE(Packgene,XA27) was digested with enzymes, and the digestion system is shown in Table 2.

[0037] Table 2

[0038]

[0039] After mixing the enzyme digestion system, incubate at 37°C for 1 hour. After the reaction, detect the enzyme digestion by 1% agarose gel electrophoresis, following the instructions in the user manuals of Tiangen's Agarose Gel DNA Recovery Kit and DNA Product Purification Kit.

[0040] 2.3 Target Fragment Annealing

[0041] Upon receiving the primers for biosynthesis, the primers were briefly centrifuged. The primer powder was then diluted with (nmol * 10) μL H2O to prepare a 100 μM stock solution. The primers were annealed to double strands according to the system in Table 3 and the reaction procedure in Table 4.

[0042] Table 3

[0043]

[0044]

[0045] Table 4

[0046]

[0047] 2.4 Connecting the carrier and the target fragment

[0048] The annealing product was diluted 100-fold and ligated with the enzyme-digested vector, as shown in Table 5. After mixing, the mixture was microcentrifuged and ligated at 22°C for 1 hour.

[0049] Table 5

[0050]

[0051] 2.5 Conversion

[0052] The ligation product was transformed into E. coli DH5α competent cells and screened on LB plates with the corresponding resistance.

[0053] (1) Take out the pre-prepared DH5α competent cells from -80℃ and place them in an ice bath;

[0054] (2) After the DH5α competent cells thaw, take 5 μL of the ligation product into 20 μL of DH5α competent cells, mix thoroughly, and let stand in an ice bath for 15 min.

[0055] (3) Place the centrifuge tube in a 42°C water bath for 40 seconds (do not shake the centrifuge tube during this time), then quickly transfer it to an ice bath and let it stand for 2 minutes.

[0056] (4) Add 200 μL of sterile LB medium (without antibiotics, Yuanye, R20125-500 ml) to a centrifuge tube, mix well, and place in a shaker at 37°C and 220 rpm for 1 hour. The purpose is to express the relevant resistance marker gene ampicillin on the plasmid and revive the bacteria;

[0057] (5) Spread onto LB medium containing ampicillin (Biosharp, BL610A);

[0058] (6) Incubate overnight in a 37°C incubator.

[0059] 2.6 Plasmid Extraction

[0060] Plasmid extraction was performed using a plasmid miniprep kit (Novozymes DC211-01) following the instructions.

[0061] (1) Before the experiment, please place Buffer QLB (first check if RapidLyse Mix has been added) on ice and pre-cool it to 0°C before use.

[0062] (2) Take 2 mL of overnight cultured bacterial solution, add it to a 2 mL centrifuge tube, centrifuge at 12,000 rpm (13,800×g) for 1 min, and remove the supernatant as much as possible (if there is a lot of bacterial solution, the bacterial precipitate can be collected into a centrifuge tube by multiple centrifugations).

[0063] (3) Take 600 μL of pre-cooled Buffer QLB and add it to a centrifuge tube containing bacterial precipitate. After use, store the Buffer QLB at 2°C.

[0064] (4) Use a vortex apparatus to immediately vortex for 30 seconds to completely resuspend the bacterial pellet, and incubate at room temperature for 3 minutes.

[0065] (5) Transfer all the liquid after incubation in the previous step to the RapidLyse DNA Mini Columns (RapidLyse DNA Mini Columns have been placed in the collection tube), centrifuge at 12,000 rpm (13,800×g) for 45 seconds, and discard the filtrate.

[0066] (6) Place the adsorption column back into the collection tube, add 600 μL of Buffer QWB around the perimeter of the adsorption column, centrifuge at 12,000 rpm (13,800 × g) for 45 seconds, and discard the filtrate.

[0067] (7) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,800 × g) for 1 min to completely remove the residual liquid in the adsorption column.

[0068] (8) Place the adsorption column in a clean 1.5 mL centrifuge tube (self-prepared), add 50 μL Buffer QEB to the center of the adsorption column membrane, centrifuge at 12,000 rpm (13,800×g) for 45 sec, and store the obtained plasmid DNA solution at -20℃ or use it for subsequent experiments.

[0069] 2.7 Sequencing

[0070] After culturing single colonies, plasmids were extracted and sequenced for verification. The results showed that the six sgRNAs were successfully used to construct the plasmids ssAAV.U6.sgRNA(n).CAG.SV40 NLS-EGFP.WPRE (n=1, 2, 3, 4, 5, 6).

[0071] 3. Cell transfection and genomic DNA extraction

[0072] 3.1 Plasmid transfection

[0073] (1) Cell culture: N2A cells (Pronosai, CL-0168) were cultured in DMEM medium containing 10% FBS and 1× penicillin-streptomycin in a 37℃, 5% CO2 saturated humidity incubator. Cells in the logarithmic growth phase were digested with trypsin containing EDTA, counted, and seeded into plates. 1×10⁶ cells were seeded per well of a six-well plate. 6 One cell was placed in an incubator and cultured until it adhered to the cell wall before the experiment was conducted.

[0074] (2) Plasmid transfection: Add 500 mL of serum-free DMEM medium to an EP tube and add Lipofectamine 3000 transfection reagent (Thermofisher, L3000008), mix well and let stand for 5 min. Add 2 μg of the target gene plasmid (a 1:1 mixture of ssAAV.U6.sgRNA(n).CAG.SV40 NLS-EGFP.WPRE plasmid and ssAAV.miniCMV.SpCas9 plasmid (ordered from Packgene, XA20)) to the EP tube, mix well and let stand for 30 min. Add the plasmid suspension to the adhered six-well plate, mix gently and continue to culture in a 37℃, 5% CO2 saturated humidity incubator for 72 h. Then collect the cells for experiments.

[0075] (3) Antibiotic screening of cells: 72 h after transfection, 4 μg / mL puromycin (Biosharp, BS111-25mg) was added to the experimental group to screen N2A cells, and the same concentration of puromycin was added to the control group.

[0076] (4) Cell enrichment: After 72 hours of antibiotic screening, the cells in the control group were basically dead, while some cells in the experimental group survived. The cells in the experimental group were cultured again after changing the medium.

[0077] (5) Collect cells to extract genomic DNA: After the experimental group cells have been cultured to a certain number, collect some cells to extract genomic DNA.

[0078] 3.2 Extraction of cellular genomic DNA

[0079] Cellular and tissue genomic DNA extraction was performed according to the instructions of the Qiagen Genomic Extraction Kit (69504).

[0080] (1) The total number of cells does not exceed 5×10 6 Centrifuge at 400g for 5 min to collect cells in a 1.5mL centrifuge tube, discard the supernatant, and add 200μL of PBS buffer. When extracting genomic DNA from ciliary body tissue, since the ciliary body tissue is small, only 100μL of PBS buffer needs to be added.

[0081] (2) Transfer 20 μL of proteinase K into a centrifuge tube;

[0082] (3) Add 200 μL of Buffer AL to the sample and vortex for 15 s to mix thoroughly to ensure complete lysis;

[0083] (4) After incubating at 56℃ for 10 min, centrifuge quickly to remove any remaining droplets in the centrifuge tube cap;

[0084] (5) Add an equal volume of anhydrous ethanol to the sample, vortex for 15 seconds to mix, and then centrifuge quickly.

[0085] (6) Transfer the above mixture to a QIAamp Mini centrifuge column, centrifuge at 6000g for 1 min, and place the QIAamp Mini centrifuge column into a new 2mL receiving tube;

[0086] (7) Carefully open the QIAamp Mini centrifuge column, add 500 μL Buffer AW1, centrifuge at 6000g for 1 min, and transfer to a new 2 mL collection tube;

[0087] (8) Carefully open the QIAamp Mini centrifuge column, add 500 μL Buffer AW2, centrifuge at 20000g for 3 min, and transfer to a new 1.5 mL collection tube;

[0088] (9) Carefully open the QIAamp Mini centrifuge column, add 200 μL of Buffer AE, incubate at room temperature for 5 min, and centrifuge at 6000g for 1 min to elute. When extracting tissue, add 100 μL of Buffer AE twice to elute.

[0089] 4. Sequencing to verify the knockout effect

[0090] PCR primers were designed approximately 500 bp upstream and downstream of the sgRNA target site. The primers are shown in Table 6. The PCR reaction system was prepared as shown in Table 7. The reaction procedure is shown in Table 8.

[0091] Table 6 Primers used in the sgRNA knockout efficiency verification experiment.

[0092]

[0093] Table 7

[0094]

[0095] Table 8

[0096]

[0097] After the PCR reaction is complete, take 2 μL of PCR product and separate and detect it using 1% agarose gel electrophoresis. If the target band size is correct, perform sequencing analysis to analyze the knockout effect.

[0098] 5. Screening of T7E1 enzyme digestion efficiency

[0099] T7 endonuclease 1 (T7E1) is commonly used for detecting mutants generated by CRISPR / Cas9 gene editing. T7 endonuclease 1 is a substrate-selective endonuclease that recognizes and cleaves mismatched DNA fragments larger than 1 bp, with the cleavage site located at the first, second, or third phosphodiester bond at the 5' end of the mismatched base. After PCR amplification of the DNA fragment containing the mutation site, treatment with T7 endonuclease 1 followed by agarose gel electrophoresis reveals the cleaved bands. For detailed procedures, refer to the EnGen Mutation Detection Kit (New England Biolabs, E3321S) instruction manual.

[0100] (1) PCR primers were designed approximately 500 bp upstream and downstream of the sgRNA target site. The primers are shown in Table 6. The PCR reaction system was prepared as shown in Table 9, and the reaction procedure is shown in Table 10. The PCR products were annealed. The system is shown in Table 11. The sample was heated to 95°C and cooled to room temperature after 10 min to form heteroduplexes.

[0101] Table 9

[0102]

[0103] Table 10

[0104]

[0105] Table 11

[0106]

[0107] (2) The heteroduplex was digested with enzymes. 1 μL of EnGen T7 Endonuclease 1 was added to the annealed system, mixed thoroughly and shaken, and incubated at 37°C for 15 min. After digestion, 1 μL of Proteinase K was added, mixed thoroughly, and incubated at 37°C for 5 min before agarose gel analysis.

[0108] 6. Viral vector packaging

[0109] Through the aforementioned experiments, six sgRNAs were individually constructed into plasmids ssAAV.U6.sgRNA(n).CAG.SV40NLS-EGFP.WPRE (n = 1, 2, 3, 4, 5, 6). After transfection into cells, the gene editing efficiency of each sgRNA was measured. Finally, we screened out sgRNA3 and sgRNA5 for the subsequent construction of gene drugs targeting Car2.

[0110] Packaging of the ssAAVShH10-sgRNA3-sgRNA5-EGFP viral vector was performed by Packgene. Then, HEK-293T cells were transfected with a triple plasmid to form the ssAAV-sgRNA3-sgRNA5-EGFP virus, which was then combined with the ShH10 capsid plasmid (purchased from Addgene, 64867). Similarly, the ssAAV-miniCMV-SpCas9 plasmid (purchased from Packgene, XA20) was also packaged with the ShH10 capsid plasmid by Packgene using a triple plasmid transfection to form the ssAAVShH10-miniCMV-SpCas9 virus.

[0111] 7. Laboratory animals and group design

[0112] C57 / BL6 mice (6-8 weeks old) were purchased from Beijing Spefol Biotechnology Co., Ltd. First, a carbonic anhydrase 2 knockout experiment was conducted in normal mice, with 40 mice in total. The right eye served as the experimental group, and the left eye as the control group. Baseline intraocular pressure was measured in both eyes of all 40 mice before the experiment. Then, the experimental group received intravitreal injections of a virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9), while the control group received an equal volume of physiological saline intravitreal injections. Intraocular pressure levels in both eyes of the experimental and control groups were monitored weekly.

[0113] Secondly, a treatment experiment was conducted using C57 / BL6 mice to create a chronic ocular hypertension model. A total of 60 mice were divided into a control group (n=10), a chronic ocular hypertension group (n=25), and a treatment group (n=25 each). In both the chronic ocular hypertension group and the treatment group, after baseline ocular pressure was measured, magnetic microbeads were injected into the anterior chamber to induce chronic ocular hypertension. One week after observing an increase in ocular pressure, the treatment group underwent intravitreal injection of a virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9).

[0114] The above-mentioned intravitreal injection procedure in mice is as follows: Mice were anesthetized by intraperitoneal injection of 0.3% sodium pentobarbital (0.2 ml / 10 g), and the pupils were dilated with 1% atropine sulfate. One drop of 0.5% promecaine hydrochloride was instilled for local anesthesia. The animal was placed slightly laterally under a surgical microscope, and 2.5% hydroxypropyl methylcellulose eye drops were instilled to improve the visibility of the procedure. A 33G needle was inserted vertically 1 mm posterior to the limbus. Under the microscope, it was observed that the needle entered the vitreous cavity without damaging the lens. The needle was slowly withdrawn to allow the vitreous fluid to drain. Then, at the same puncture site, 2 μL of virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9) was injected using a 5 μL microsyringe (Hamilton) equipped with a 33G needle. The needle was held in place for 30 seconds and then slowly withdrawn. After surgery, apply tobramycin ointment to the surface of the eyes. Place the animal on absorbent paper on a 37°C heated plate for recovery, then return it to its cage.

[0115] The steps for inducing a chronic ocular hypertension model using magnetic beads are as follows: After intraperitoneal anesthesia, the mice were mydriatic with 1% atropine sulfate and local anesthesia was performed with one drop of 0.5% promecaine hydrochloride. The animal was placed slightly laterally under a surgical microscope, and a 32G needle was inserted obliquely into the anterior chamber at the limbus, taking care not to damage the iris. The needle was then withdrawn to allow the aqueous humor to drain. A suitable amount of air was injected into the needle using a 5μL microsyringe equipped with a 32G needle to form small air bubbles for subsequent magnetic bead distribution. Then, 6 μL of magnetic microbeads (Bangs Laboratories, Fishers, IN, United States, 10 μm in diameter, 25 mg / ml) were injected into the same puncture site using a 10 μL microsyringe containing 32 G. The magnetic beads were held in place by a magnet on the opposite side of the puncture site, and then the magnetic beads were evenly attracted to the anterior chamber angle by a 3 mm diameter ring magnet. After the operation, tobramycin eye ointment was applied to the surface of the mouse eyeball, and then the animal was placed on absorbent paper on a 37°C heating plate for recovery. After waking up, the animal was returned to its cage.

[0116] The intraocular pressure (IOP) measurement procedure described above was as follows: In mice induced with intravitreal injection of the virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9) and chronic IOP, bilateral IOP levels were monitored weekly. Mice were anesthetized with intraperitoneal injection of 0.3% sodium pentobarbital (0.2 ml / 10 g), and IOP was measured using a TonoLab rebound tonometer (Icare, Vantaa, Finland) according to the manufacturer's instructions. IOP measurements were performed between 14:00 and 17:00 Beijing time. Eyes were alternately tested 5 minutes after anesthesia induction. The average of three successful measurements for each eye was used for analysis; each TonoLab measurement included the average of six rebound tests. Bilateral testing was performed to control for the effect of anesthesia on IOP.

[0117] 8. Immunofluorescence staining

[0118] Eyes of normal mice with ciliary carbonic anhydrase 2 knockout (normal mice injected intravitreal with virus) and mice with chronic ocular hypertension (mice with ciliary carbonic anhydrase 2 knockout, induced by magnetic beads and injected intravitreal with virus) were collected. The eyes were fixed overnight with 4% paraformaldehyde, dehydrated in sucrose solutions of different gradients (10%, 20%, and 30%), embedded in OCT, frozen, and sectioned at 12 μm intervals. The slides were stored at -80°C for later use. Before GFP fluorescence imaging, the slides were removed and warmed in a 37°C incubator for 1 hour, then washed once with PBS for 5 min, permeabilized and blocked in 0.1% Triton and 10% goat serum for 30 min, incubated in DAPI solution for 5 min, washed three times with PBS for 3 min each time, and then an anti-fluorescence quenching agent was added. After mounting, the slides were imaged on a Leica SP5 confocal microscope.

[0119] 9. Detection of genome cleavage efficiency

[0120] Ciliary body tissues were collected from mice with ciliary carbonic anhydrase 2 knockout (normal mice were injected intravitreal with the virus). Genomic DNA was extracted from the ciliary body tissues using the Qiagen Genome Extraction Kit (69504). Primers were designed targeting the nucleic acid sequences approximately 500 bp upstream and downstream of the sgRNA3 and sgRNA5 target sites. Since the target sequences of sgRNA3 and sgRNA5 are located close to each other, the designed primers (upstream: CTGTTGTCCAGCAGTTAGCACAT; downstream: TGTTCCAGTGAACCAAGTGAAGC) can simultaneously cover both editing sites. The PCR products were digested using the aforementioned T7 endonuclease 1 assay. Compared with the control group, the DNA fragments in the experimental group were cleaved into multiple fragments, resulting in multiple bands after agarose gel electrophoresis. The gene knockout efficiency could be calculated by grayscale analysis.

[0121] 10. Western blot analysis

[0122] The eyes of mice with ciliary carbonic anhydrase 2 knocked out (normal mice injected intravitreal with the virus) were dissected under an optical microscope. The cornea, ciliary body, and retina were carefully separated. The tissues were placed in lysis buffer (0.1 M Tris, pH 7.4, 1 mM EDTA) to extract proteins. The protein concentration was determined by the BCA method (Biosharp, BL521A). After electrophoresis and membrane transfer, skim milk powder was added and the membrane was blocked overnight at 4°C. Anti-Car2 primary antibody (abcam, ab191343) was added and the membrane was incubated overnight. The membrane was washed three times with TBST on a shaker for 10 min each time. Goat anti-mouse secondary antibody (ThermoFisher, 31430) was added and the membrane was incubated at room temperature for one hour. After washing three times with TBST, fluorescence imaging was performed.

[0123] 11. RGC staining and counting

[0124] Chronic ocular hypertension mice with ciliary body carbonic anhydrase 2 knockout (magnetic bead-induced chronic ocular hypertension model with intravitreal virus injection) were anesthetized intraperitoneally. The abdominal and thoracic cavities were dissected, the right atrial appendage was opened, and the heart was perfused with 4% paraformaldehyde through a 10mL syringe. After anterior fixation, the mouse eyeballs were removed, a notch was cut at the cornea, and the eyeballs were placed in 4% paraformaldehyde for posterior fixation. The mouse retina was carefully dissected, washed twice with PBS buffer, and blocked with 0.5% Triton X100 and 1% BSA for 1 hour. The blocking solution was removed without washing, and Anti-Brn3a antibody (1:1000, 1% BSA, Abcam, ab81213) was added and incubated overnight. After washing three times with PBS, the secondary antibody Goat Anti-Rabbit IgG H&L (Alexa Flour) was added. 488)(1:500, 1% BSA, Abcam, ab150077), incubated at room temperature in the dark for 2 hours, then laid on a glass slide in a clover shape, added with an anti-fluorescence quenching agent, and sealed. Eight images of the visual field at the same distance from the optic disc were selected from each retina, and the mean was obtained by automatic counting using ImageJ.

[0125] 12. Statistical Analysis

[0126] Results are presented as mean ± standard deviation (SD). Paired or unpaired t-tests and the Mann-Whitney test were used to compare two separate groups. Data analysis was performed on GraphPad Prism 9. Two-tailed tests were always used, and a result was considered statistically significant if p < 0.05.

[0127] 13. Results

[0128] 13.1 Design and Screening of Carbonic Anhydrase 2sgRNA Sequences

[0129] (1) Query the sequence of carbonic anhydrase 2

[0130] The gene information for mouse carbonic anhydrase 2 (Car2) was retrieved from the NCBI database. Its gene sequence is NC_000069.7:14951329-14965830. A search of the Ensemble database revealed the gene ID for mouse carbonic anhydrase 2 as ENSMUSG00000027562. Its transcript has three variants: Car2-201 (ENSMUST00000029078.9), Car2-202 (ENSMUST00000192609.6), and Car2-203 (ENSMUST00000195520.2). Car2-201 has been shown to have protein-coding function and participate in aqueous humor secretion. The Car2-201 transcript contains 7 exons. Substitution into Snapgene reveals… Figure 2 Since the first exon is not completely contained in the CDS region, we selected the nucleic acid sequences of exons 2, 3, and 4 on the transcript for sgRNA design.

[0131] (2) Design and screen sgRNA sequences targeting exons 2, 3, and 4.

[0132] The sequences of exons 2, 3, and 4 in the coding region were imported into http: / / crispor.tefor.net / crispor.py, which predicted several sgRNA sequences. Based on specificity, effectiveness, and the number of mismatched bases, six sgRNA sequences were selected, as shown in Table 1. Their target sequence positions are as follows: Figure 2 As shown.

[0133] (3) Verification of sgRNA knockout effect

[0134] The above 6 sgRNA sequences were used to construct the plasmid ssAAV.U6.sgRNA(n).CAG.SV40 NLS-EGFP.WPRE (n = 1, 2, 3, 4, 5, 6). Figure 3 ), and combine it with

[0135] N2A cells were co-transfected with the plasmid ssAAV.miniCMV.SpCas9 and cultured for 72 hours. Afterward, puromycin was added for antibiotic selection. Surviving cells were cultured for another 72 hours, and the medium was changed. Once a sufficient number of cells were cultured, a portion was collected to extract the genome. PCR primers were designed approximately 500 bp upstream and downstream of the sgRNA target site. The extracted genome was used as a template to amplify the target DNA, and the knockout effect was confirmed by sequencing. Since sgRNA2 and sgRNA4 target exon 3, sgRNA1 and sgRNA3 target exon 4, and sgRNA5 and sgRNA6 target exon 5, the sgRNAs targeting the same exon are located close to each other in sequence; therefore, the same primer was used.

[0136] From the sequencing peak diagram ( Figure 4 Analysis revealed that sgRNAs 1, 2, 3, 4, 5, and 6 all exhibited varying degrees of gene editing effects in the N2A cell genome. In short, at the recognition and cleavage sites of sgRNAs ( Figure 4 The presence of overlapping peaks downstream of the black standard indicates that sgRNA has a knockout effect. The cellular genomic DNA is cut, causing the downstream of the cut site to initiate a self-repair mechanism. Because the base repair methods of genomic DNA in different cells of the verified cell lines are different, the repaired bases after the cut site are different, resulting in overlapping peaks in PCR sequencing.

[0137] T7 endonuclease 1 recognizes mismatched bases and cleaves the DNA double strand. T7E1 experiments showed that, compared to the control group, the DNA double strand after plasmid transfection was cleaved into two fragments at the sgRNA recognition site, resulting in two additional bands on DNA agarose gel electrophoresis. Figure 5 ImageJ analysis of the band grayscale revealed that the knockout efficiency of sgRNA1 was approximately 73.9%, sgRNA2 approximately 32.5%, sgRNA3 approximately 77.8%, sgRNA4 approximately 52.9%, sgRNA5 approximately 66.4%, and sgRNA6 approximately 59.7%. Furthermore, co-transfection of cells with sgRNA3 and sgRNA5 plasmids achieved a knockout efficiency of 82.3%.

[0138] Therefore, through screening, sgRNA3 and sgRNA5 (sgRNA3 and sgRNA5 are the protected sequences as shown in SEQ ID NO.1 and SEQ ID NO.2) were ultimately used for the construction of the subsequent two-site knockout viral vector.

[0139] (4) Constructing the ssAAVShH10-sgRNA3-sgRNA5-EGFP viral vector

[0140] The synthetic ssAAV-sgRNA3-sgRNA5-EGFP plasmid was transfected into HEK-293T cells using a triple plasmid transfection method, and combined with the ShH10 capsid plasmid (purchased from Addgene, 64867) to form the ssAAVShH10-sgRNA3-sgRNA5-EGFP virus. Similarly, the ssAAV-miniCMV-SpCas9 plasmid (purchased from Packgene, XA20) was also transfected into the ShH10 capsid plasmid by Packgene to package it into the ssAAVShH10-miniCMV-SpCas9 virus. Plasmid mapping and sequencing results are shown below. Figure 6 Furthermore, the enzyme digestion pattern is basically consistent with the simulated pattern. Figure 7 A viral vector containing the target fragment was successfully constructed.

[0141] 15.2 Knockout of ciliary body carbonic anhydrase 2 in normal mice

[0142] Baseline intraocular pressure (IOP) was measured in both eyes of 40 mice (control group: 16.91 mmHg; experimental group: 16.19 mmHg). The experimental group received intravitreal injections of a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9 to specifically knock out carbonic anhydrase 2 in achromatic ciliary epithelial cells. The control group received an equal volume of physiological saline. IOP levels were monitored weekly, and a significant IOP-lowering effect was observed in the first week. Figure 8 A). The average intraocular pressure in the experimental group was 13.53 mmHg, while the average intraocular pressure in the control group was 16.10 mmHg, which was statistically significant (Table 12). The effect of lowering intraocular pressure by 2-3 mmHg could be maintained for more than one month, and the effect of lowering intraocular pressure was obvious and long-lasting.

[0143] Table 12 Intraocular pressure levels in carbonic anhydrase 2 knockout mice

[0144]

[0145]

[0146] Mice were euthanized under anesthesia, and ciliary body tissue was collected. Genomic DNA was extracted from the ciliary body tissue, primers were designed, and the sequence was amplified. The amplified product was digested with T7 endonuclease 1. The DNA agarose gel electrophoresis results are as follows: Figure 8 As shown in B, compared to the control group, the gene knockout efficiency, calculated using grayscale analysis, was approximately 54%.

[0147] The cornea, ciliary body, and retina of mice were isolated and proteins were extracted using a lysis buffer. Protein concentration was determined by the BCA method (Biosharp, BL521A). Western blot analysis showed that the expression of carbonic anhydrase 2 in the ciliary body was significantly reduced in the experimental group, while the cornea and retina were almost unaffected. Furthermore, quantitative analysis using grayscale banding also confirmed a statistically significant downregulation of carbonic anhydrase 2 protein levels in the ciliary body of the experimental group. Figure 8 C, D).

[0148] Immunofluorescence staining results showed that ciliary body epithelial cells from knockout eyes expressed GFP, indicating that the virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9) could effectively transduce ciliary body epithelial cells. Figure 8 E).

[0149] 15.3 Knockout of ciliary body carbonic anhydrase 2 in mice with chronic ocular hypertension

[0150] A chronic ocular hypertension (OPH) model was induced in mice by injecting magnetic microbeads into the anterior chamber and attracting them to the iridocorneal angle using a magnet, thereby blocking the iridocorneal angle. OPH changes were monitored after one week, with a successful model defined as an OPH increase of 5 mmHg or more. We observed that approximately 60% of the mice (29 successfully treated mice in the chronic OPH group and treatment group) showed a significant increase in OPH, with an average increase of approximately 10 mmHg (Table 13). In the treatment group, after observing an OPH increase in week 1, intravitreal injection of a virus (a 1:1 mixture of ssAAVShH10-sgRNA3-sgRNA5-EGFP and ssAAVShH10-miniCMV-SpCas9) resulted in a significant decrease in OPH during the first week of gene therapy, with no significant difference in OPH levels compared to the control group. Figure 9 A) indicates that specific knockout of carbonic anhydrase 2 in achromatic ciliary epithelial cells can reduce intraocular pressure by inhibiting aqueous humor production.

[0151] Table 13 Carbonic anhydrase 2 knockout therapy for chronic ocular hypertension

[0152]

[0153]

[0154] Retinas from three groups of mice were used for patch staining. The transcription factor Brn3a plays a crucial role in the differentiation, survival, and axonal elongation of retinal ganglion cells during retinal development in mice and is an important marker of retinal ganglion cells. In a mouse model of chronic intraocular pressure, progressive apoptosis of retinal ganglion cells is a pathophysiological mechanism of glaucoma functional impairment. This was confirmed by Brn3a staining and single visual field cell counting. Figure 9 C) We found that the number of retinal ganglion cells in the slow-growth group mice was significantly reduced, with an average decrease of approximately 45% in the number of cells per microscopic field of view. Figure 9 B). After gene therapy, apoptosis of retinal ganglion cells in the treatment group mice was significantly reduced, and there was no significant difference compared to the control group. Figure 9 B).

[0155] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications are also considered to be within the scope of protection of the present invention.

Claims

1. An sgRNA targeting carbonic anhydrase 2, characterized in that, It consists of sgRNA as shown in SEQ ID NO 1 and sgRNA as shown in SEQ ID NO 2.

2. A DNA molecule encoding the sgRNA of claim 1.

3. A recombinant vector having the DNA molecule of claim 2.

4. The use of the sgRNA of claim 1, the DNA molecule of claim 2, or the recombinant vector of claim 3 in the preparation of a drug for treating glaucoma.

5. A drug for treating glaucoma, characterized in that, Its active ingredient is the sgRNA of claim 1, the DNA molecule of claim 2, or the recombinant vector of claim 3.