Key genes for improving synthesis of terpenoids in saccharomyces cerevisiae and application thereof
By enhancing the expression of glutamate decarboxylase, pantothenic acid-β-alanine ligase, and pantothenic acid kinase genes in Saccharomyces cerevisiae, the problem of low synthesis efficiency of terpenoids was solved, achieving efficient squalene production and meeting market demand.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF MICROBIOLOGY CHINESE ACAD OF SCI
- Filing Date
- 2021-11-12
- Publication Date
- 2026-06-19
AI Technical Summary
In existing technologies, the extraction of terpenoids from plants and animals is costly and inefficient, failing to meet market demand. Furthermore, the synthesis of terpenoids in microbial cells is insufficient, necessitating biotechnology modifications to improve synthesis efficiency.
By constructing recombinant Saccharomyces cerevisiae, the expression levels of glutamate decarboxylase, pantothenic acid-β-alanine ligase, and pantothenic acid kinase genes were enhanced, and the metabolic flux of terpenoid synthesis was increased by utilizing a chromosome integration model. The specific method included constructing an expression cassette and introducing it into the ADH2 site of the Saccharomyces cerevisiae alcohol dehydrogenase gene.
It significantly improved the ability of Saccharomyces cerevisiae to synthesize squalene, a terpene compound, achieving high-efficiency squalene production and showing important prospects for industrial application.
Smart Images

Figure QLYQS_2 
Figure QLYQS_4 
Figure QLYQS_6
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to key genes that enhance the synthesis of terpenoid compounds in Saccharomyces cerevisiae and their applications. Background Technology
[0002] Terpenes are a class of compounds with isoprene as their basic structural unit. They possess a variety of physiological and pharmacological functions, including antioxidant, antiviral, antiparasitic, antitumor, and immunomodulatory effects, and have a huge market demand in nutrition, health care, and pharmaceutical fields. Direct extraction from animal and plant raw materials is the main production method for terpenes. However, the long growth cycle of animals and plants, complex raw material pretreatment, low content of active ingredients, and issues related to animal resource protection not only lead to high production costs but also limit the large-scale development of related industries, failing to meet the ever-growing market demand.
[0003] Microbial fermentation for the synthesis of terpenoids is characterized by its short cycle time, its green and natural attributes, and its economic and environmental friendliness, making it a production route with a significant competitive advantage. However, terpenoids are usually metabolic intermediates in wild-type microbial cells, resulting in generally low terpenoid content. Therefore, biotechnological modification is needed to significantly improve cellular synthesis efficiency. Yeast, a widely used microorganism in industrial biotechnology, can synthesize terpenoids via the mevalonic acid pathway, making it a preferred chassis cell for terpenoid synthesis.
[0004] Squalene is an unsaturated triterpenoid compound composed of six isoprene molecules. It possesses physiological functions such as antioxidation, anti-aging, immunomodulation, and anti-tumor activity, and has wide applications in health foods, cosmetics, and pharmaceuticals. Shark liver extraction is the primary production method. Given animal protection restrictions, developing green synthesis technologies is an urgent need and an important direction for the industry's development. Summary of the Invention
[0005] The technical problem to be solved by this invention is how to increase the metabolic flux of terpenoid synthesis or how to synthesize terpenoid compounds.
[0006] To address the aforementioned technical problems, the present invention first provides recombinant bacteria.
[0007] The recombinant strain can be a recombinant Saccharomyces cerevisiae obtained by increasing or enhancing the expression levels of the glutamate decarboxylase gene, the pantothenic acid-β-alanine ligase gene, and the pantothenic acid kinase gene in the target Saccharomyces cerevisiae.
[0008] The expression levels of the glutamate decarboxylase gene, pantothenic acid-β-alanine ligase gene, and pantothenic acid kinase gene in the recombinant Saccharomyces cerevisiae can be higher than those in the target Saccharomyces cerevisiae.
[0009] In the recombinant bacteria described above, the glutamate decarboxylase may be selected from any of the following proteins:
[0010] A1) The amino acid sequence is the protein shown in Sequence 1 of the sequence listing.
[0011] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein shown in A1), which has more than 80% identity with the protein shown in A1) and has glutamate decarboxylase activity.
[0012] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0013] The pantothenic acid-β-alanine ligase is selected from any of the following proteins:
[0014] B1) The amino acid sequence is the protein shown in sequence 2 of the sequence listing.
[0015] B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein shown in B1), which has more than 80% identity with the protein shown in B1) and has pantothenic acid-β-alanine ligase activity.
[0016] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).
[0017] The pantothenic acid kinase is selected from any of the following proteins:
[0018] The C1 amino acid sequence is the protein shown in sequence 3 of the sequence listing.
[0019] C2) A protein obtained by substituting and / or deleting and / or adding amino acid residues to the protein shown in C1) that has more than 80% identity with the protein shown in C1) and has pantothenic acid kinase activity.
[0020] C3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of C1) or C2).
[0021] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0022] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0023] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0024] In the recombinant strains described above, increasing or enhancing the expression levels of the glutamate decarboxylase gene, the pantothenic acid-β-alanine ligase gene, and the pantothenic acid kinase gene in the target Saccharomyces cerevisiae can be achieved by introducing an expression cassette containing the glutamate decarboxylase gene, the pantothenic acid-β-alanine ligase gene, and the pantothenic acid kinase gene into the target Saccharomyces cerevisiae.
[0025] In the recombinant strain described above, the expression cassette can be introduced into the ADH2 site of the alcohol dehydrogenase gene of the target Saccharomyces cerevisiae.
[0026] The nucleotide sequence of the ADH2 site of the alcohol dehydrogenase gene of the target Saccharomyces cerevisiae can be the reverse complementary sequence of nucleotides 878668-880763 in GenBank No. CP020135.1 (21-MAR-2017).
[0027] In the recombinant strains described above, introducing the expression cassette into the target Saccharomyces cerevisiae can replace the alcohol dehydrogenase gene ADH2 of the target Saccharomyces cerevisiae with the expression cassette.
[0028] The nucleotide sequence of the alcohol dehydrogenase gene ADH2 of the target Saccharomyces cerevisiae is the reverse complementary sequence of nucleotides 878668-880763 in GenBank No. CP020135.1 (21-MAR-2017).
[0029] In the recombinant bacteria described above, the expression cassette may contain the coding sequence of the glutamate decarboxylase gene, the coding sequence of the pantothenic acid-β-alanine ligase gene, and the coding sequence of the pantothenic acid kinase gene.
[0030] The coding sequence of the glutamate decarboxylase gene (GAD1) can be the DNA molecule represented by nucleotides 3744-5501 of sequence 4 in the sequence listing. The coding sequence of the pantothenic acid-β-alanine ligase gene (PAN6) can be the DNA molecule represented by nucleotides 5931-6860 of sequence 4 in the sequence listing. The coding sequence of the pantothenic acid kinase (CAB1) can be the DNA molecule represented by nucleotides 7531-8634 of sequence 4 in the sequence listing.
[0031] In the recombinant bacteria described above, the expression cassette may also contain a promoter sequence, which may be the DNA molecule represented by nucleotides 3194-3743 of sequence 4 in the sequence listing, the DNA molecule represented by nucleotides 5522-5930 of sequence 4, and the DNA molecule represented by nucleotides 6881-7530 of sequence 4.
[0032] In the recombinant bacteria described above, the expression cassette may also contain a terminator sequence, which may be the DNA molecule represented by nucleotides 5502-5521 of sequence 4 in the sequence listing, the DNA molecule represented by nucleotides 6861-6880 of sequence 4, and the DNA molecule represented by nucleotides 8635-9034 of sequence 4.
[0033] In the recombinant bacteria described above, the expression cassette can be the DNA molecule shown in Sequence 4 of the sequence listing. Alternatively, the expression cassette can be the DNA molecule represented by nucleotides 3194-9034 of Sequence 4 in the sequence listing.
[0034] The target brewing yeast may be Saccharomyces cerevisiae YS58, Saccharomyces cerevisiae YEH-56, or Saccharomyces cerevisiae YEH56-E(M5).
[0035] To address the aforementioned technical problems, this invention also provides the application of substances that increase or enhance the expression levels of glutamate decarboxylase gene, pantothenic acid-β-alanine ligase gene, and pantothenic acid kinase gene in Saccharomyces cerevisiae in the preparation of squalene-producing recombinant Saccharomyces cerevisiae.
[0036] In the above-described applications, the substance that increases or enhances the expression levels of the glutamate decarboxylase gene, the pantothenic acid-β-alanine ligase gene, and the pantothenic acid kinase gene in *Saccharomyces cerevisiae* can be any of the following:
[0037] E1) The expression box as described in any one of claims 3-8;
[0038] E2) A recombinant vector containing the expression cassette described in E1);
[0039] E3) Recombinant microorganisms containing the expression cassette described in E1) or recombinant microorganisms containing the recombinant vector described in E2).
[0040] This invention, through metabolomics analysis, identified novel targets capable of enhancing the metabolic flux of terpenoid synthesis. By enhancing the expression of β-alanine metabolism-related genes GAD1, PAN6, and CAB1 through chromosomal integration, the ability of yeast to synthesize the terpenoid compound squalene was significantly improved, resulting in a high-yield recombinant squalene strain, YEH56-E(M5)-GPC. After 24 hours of shake-flask cultivation, the recombinant strain YEH56-E(M5)-GPC achieved a squalene yield of 449.37 mg / L. The recombinant strain provided by this invention can effectively improve the synthesis efficiency of the terpenoid compound squalene and has significant potential for industrial application. Detailed Implementation
[0041] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0043] In the quantitative experiments described below, all experiments were performed in triplicate, and the results were averaged. Unless otherwise specified, in the following examples, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.
[0044] The PrimeSTAR Max Premix (2x) is a product of TaKaRa, catalog number R045A.
[0045] The squalene standard is a product of Aladdin Reagent (Shanghai) Co., Ltd., with product code S109119-25mL.
[0046] The plasmid YEp-GMZC is a plasmid constructed by our research group in the early stage, which carries a Zeocin resistance selection marker and a galactose-induced mazF expression cassette as a reverse selection marker. The construction method is described in paragraphs 0167-0183 of Chinese invention patent application with publication number CN 113151262 A (application number 202110188875.9, invention title: Yeast promoter with weakened regulatory strength and its application in metabolic flux regulation).
[0047] Saccharomyces cerevisiae YS58: Related references: Teunissen AW, Vanden Berg JA, Stensma HY. Physical localization of the flocculation gene FLO1on chromosome I of Saccharomyces cerevisiae. Yeast, 1993, 9:1-10.; Available to the public from the Institute of Microbiology, Chinese Academy of Sciences, for the purpose of replicating this invention only.
[0048] Saccharomyces cerevisiae YEH-56 is a strain preserved by our laboratory research group and is described in the following literature: He XP, Huai WH, Tie CJ, Liu YF, Zhang BR (2000) Breeding of highergosterol-producing yeast strains. J Ind Microbiol Biotechnol, 25:39-44), hereinafter referred to as Saccharomyces cerevisiae YEH-56, which can be obtained by the public from the Institute of Microbiology, Chinese Academy of Sciences, and is only used for the purpose of replicating this invention.
[0049] Saccharomyces cerevisiae YEH56-E(M5) (referred to as recombinant strain YEH56-E(M5) or Saccharomyces cerevisiae YEH56-E(M5)) is obtained by replacing the wild-type ERG1p in the genome with the mutant promoter ERG1p(M5) based on Saccharomyces cerevisiae YEH-56. The construction method is described in paragraphs 0167-0202 of Chinese invention patent application CN113151262 A (application number 202110188875.9, invention title: Yeast promoter with weakened regulatory strength and its application in metabolic flux regulation). Specifically, compared to the promoter sequence of wild-type ERG1p (Sequence 5 in the sequence listing), nucleotides 128-149 of Sequence 5 are replaced with TGCCAGGGCA nucleotides, and a nucleotide sequence of TTGCCAGGGCAA is inserted between nucleotides 451-452 while keeping the other nucleotides of Sequence 5 unchanged to obtain the DNA molecule.
[0050] YPD medium: This medium consists of solutes and solvents; the solutes are yeast extract, peptone, and glucose, and the solvent is water; the concentrations of the solutes are as follows: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose; natural pH.
[0051] SCG induction medium: This medium consists of solutes and solvents; the solutes are yeast nitrogen base (YNB), galactose, leucine, histidine, tryptophan, and uracil, and the solvent is water; the concentrations of the solutes are as follows: 6.7 g / L YNB, 20 g / L galactose, 30 mg / L leucine, 30 mg / L histidine, 30 mg / L tryptophan, and 30 mg / L uracil; natural pH.
[0052] The solid culture medium described above is made by adding 20 g / L agar powder, and the other components and concentrations are the same as those of the liquid culture medium.
[0053] Example 1: Metabolomics analysis to identify genes with positive effects on terpene synthesis.
[0054] I. Effects of yeast powder on squalene synthesis in brewer's yeast
[0055] 1.1 Effects of different yeast powders on squalene synthesis in Saccharomyces cerevisiae YS58
[0056] (1) Saccharomyces cerevisiae YS58 was inoculated into 3 mL of YPD liquid medium and cultured at 30℃ and 200 rpm for 20 h; 5% (volume ratio) of the inoculum was transferred into 5 mL of YPD liquid medium and cultured at 30℃ and 200 rpm for 20 h; 10% (volume ratio) of the inoculum was transferred into 45 mL of YPD liquid medium prepared with yeast powder from different manufacturers (A and B) and cultured at 30℃ and 200 rpm with shaking for 24 h to obtain two fermentation broths.
[0057] (2) Take 40 mL of fermentation broth, centrifuge at 5000 rpm for 5 min to collect the cells, wash twice with distilled water, centrifuge at 5000 rpm for 5 min to collect the cells; weigh and calculate the weight of the wet cells; accurately weigh 0.5 g of wet cells, dry them in a 65℃ oven to constant weight, weigh them, and calculate the wet-to-dry ratio of the cells. The cell biomass is the number of grams of dry cells per liter of fermentation broth (g / L). The results are shown in Table 1. There was no significant difference in cell biomass among the yeast fermentation broths obtained from fermentation in YPD medium prepared with yeast powder from different manufacturers.
[0058] (3) Preparation of squalene standard curve: Squalene standard was dissolved in acetone to prepare standard solutions with concentrations of 0.03 mg / mL, 0.07 mg / mL, 0.13 mg / mL, 0.27 mg / mL, 0.4 mg / mL, and 0.54 mg / mL, with three replicates for each concentration. The standards were analyzed by high-performance liquid chromatography (HPLC) using an Aglient 1260 Infinity (Column Plus-C18, column temperature 40℃; mobile phase: acetonitrile, flow rate 1 mL / min; detector: UV / VIS, 195 nm; injection volume: 10 μL). The experiment was repeated three times, and the average value was calculated. A standard curve was plotted with squalene concentration as the x-axis and peak area as the y-axis, yielding the following function formula:
[0059] Squalene concentration (mg / mL) = 1.34 × 10 -5 ×peak area
[0060] (4) Accurately weigh 0.1 g of the wet bacterial cells collected in step (2) into a 7 mL centrifuge tube, add 2 mL of 3M HCl and mix well. Incubate at 95℃ for 5 min, then on ice for 10 min, centrifuge at 12000 rpm for 3 min, wash twice with double-distilled water, add 1 mL of acetone, shake for 10 min, centrifuge at 12000 rpm for 3 min, filter the supernatant through a 0.22 μm filter membrane, and perform HPLC analysis on the filtrate. Calculate the squalene content of the sample according to the standard curve. The squalene content of the cells is the number of milligrams of squalene contained in each gram of stem cells (mg / g). The results are shown in Table 1. Yeast powder from different sources has a significant effect on the squalene content of strain YS58 cells. The squalene content of yeast cells cultured using yeast powder from manufacturer B is 1.9 times that of yeast cells cultured using yeast powder from manufacturer A.
[0061] Table 1. Effects of different yeast extracts on cell growth and squalene content of strain YS58
[0062] Yeast powder source Biomass (g / L) Cellular squalene content (mg / g) A 3.56 0.09 B 3.68 0.17
[0063] 1.2 Effects of different yeast powders on squalene synthesis in the industrial strain of Saccharomyces cerevisiae YEH-56
[0064] (1) Cultivate Saccharomyces cerevisiae YEH-56 according to the method in step 1.1 (1) above.
[0065] (2) Cell biomass was determined and calculated according to the method in step 1.1 (2) above. The results are shown in Table 2. The two different sources of yeast powder had no significant effect on cell growth.
[0066] (3) The squalene content was determined according to the method in step 1.1 (4) above, and the cellular squalene content was calculated based on the standard curve. The results are shown in Table 2. Yeast powder from different sources had a significant impact on the squalene content of yeast strain YEH-56 cells. The squalene content of yeast cells cultured using yeast powder from manufacturer B was significantly higher than that of yeast cells cultured using yeast powder from manufacturer A.
[0067] 1.4 times.
[0068] The above results indicate that yeast powder from different sources has a significant impact on the ability of Saccharomyces cerevisiae cells to synthesize squalene.
[0069] Table 2. Effects of different yeast extracts on cell growth and squalene content of strain YEH-56
[0070] yeast powder source Biomass (g / L) Cellular squalene content (mg / g) A 4.50 1.93 B 4.35 2.72
[0071] II. Metabolomics Analysis of Yeast Extract Cultured Under Different Conditions
[0072] 2.1 Sample Preparation for Metabolomics Analysis
[0073] Following step one described above, Saccharomyces cerevisiae YEH-56 was cultured, and samples were taken at 6h, 12h, 18h, and 24h for cell biomass and squalene content analysis. The results are shown in Table 3. Differences in squalene content between the two yeast powder cultures began to appear at 12h, with the most significant difference at 18h. Therefore, yeast cells cultured for 18h were used for metabolomics analysis.
[0074] Table 3 Comparison of fermentation performance of strain YEH-56 in different yeast extract media
[0075]
[0076] 2.2 Metabolomics analysis to identify key genes
[0077] (1) Take 40 mL of bacterial culture fermented with yeast powder A for 18 h and 40 mL of bacterial culture fermented with yeast powder B for 18 h respectively, centrifuge at 5000 rpm for 5 min to collect bacterial cells, wash twice with distilled water, centrifuge at 5000 rpm for 5 min to collect the two groups of bacterial cell samples, and then have Shanghai Baiqu Biotechnology Co., Ltd. perform metabolomics analysis.
[0078] (2) Analysis of the obtained metabolomics data revealed significant differences in amino acid metabolism between the two groups of bacterial samples. When the amino acid metabolic pathway was active, the mevalonate pathway was also more active. Among them, the differences in β-alanine metabolism and its directly related amino acid metabolism were the most significant. Therefore, it is speculated that the β-alanine metabolism-related genes GAD1 (coding sequence shown as nucleotides 3744-5501 of sequence 4 in the sequence listing), PAN6 (coding sequence shown as nucleotides 5931-6860 of sequence 4 in the sequence listing), and CAB1 (coding sequence shown as nucleotides 7531-8634 of sequence 4 in the sequence listing) may be genes that increase the metabolic flux of mevalonate and have a positive effect on the synthesis of terpenoids. The amino acid sequence of GAD1 protein is shown as Sequence 1 in the sequence listing, the amino acid sequence of PAN6 protein is shown as Sequence 2 in the sequence listing, and the amino acid sequence of CAB1 protein is shown as Sequence 3 in the sequence listing.
[0079] Example 2: Effects of enhanced GAD1, PAN6, and CAB1 expression on the synthesis of terpenoids in yeast
[0080] I. Construction of GAD1, PAN6, and CAB1 gene expression cassettes and selection markers for homologous recombination
[0081] 1.1 Construction of a screening marker expression cassette with a 5' homologous arm containing ADH2
[0082] (1) Based on the nucleotide sequence of the Saccharomyces cerevisiae alcohol dehydrogenase gene ADH2 reported in GenBank (GenBank No. CP020135.1) and the selection marker G-mazF-zeoR sequence in plasmid YEp-GMZC, the following primers were designed and synthesized:
[0083] S061:5'-AGTTGGAGAAATAAGAGAATTTCAG-3'
[0084] S062:5'-gagcaccgcgggcatgcGGCTTTTTGAGTTTCTGGAATAG-3'
[0085] S063:5'-CTATTCCAGAAACTCAAAAAGCCgcatgcccgcggtgctc-3'
[0086] S064:5'-CTTTGATTAGTCTCTTCAAACAAACAGCAAATTAAAGCCTTCGAG-3'
[0087] S065:5'-CTCGAAGGCTTTAATTTGCTGTTTGTTTGAAGAGACTAATCAAAG-3'
[0088] S066:5'-AGATACCTTGGTTATGGCGCCCGTTCCGGCAGAGGAGATCAG-3'
[0089] (2) PCR amplification was performed using the Saccharomyces cerevisiae YEH-56 genome and plasmid YEp-GMZC as templates, respectively.
[0090] PCR reaction system: 50 ng DNA template, 0.3 μmol / L concentration of each primer in the reaction system, 25 μL PrimeSTAR Max Premix (2x), add deionized water to make up to 50 μL, and mix well.
[0091] PCR reaction conditions: 98℃ / 3min, 1 cycle; 98℃ / 10sec, 55℃ / 10sec, 72℃ / 30sec, 32 cycles; 72℃ / 5min.
[0092] The 5' homologous arm of ADH2, which was 323 bp (positions 1-323 of sequence 4 in the sequence listing) was amplified from the YEH-56 genome by PCR using primers S061 and S062 and named ADH2-5.
[0093] The selection marker G-mazF-zeoR (positions 284-2870 of sequence 4 in the sequence listing) was amplified from plasmid YEp-GMZC using primers S063 and S064 and named GMZ.
[0094] The upstream sequence of ADH2, 390 bp (positions 2826-3215 of sequence 4 in the sequence listing), was amplified from the YEH-56 genome by PCR using primers S065 and S066 and named ADH2-5up.
[0095] (3) Mix PCR products ADH2-5, GMZ and ADH2-5up in equal molar amounts. Using this mixture as a template, perform PCR using primer pair S061 / S066 to amplify a 3215bp DNA fragment (nucleotide sequence is nucleotides 1-3215 of sequence 4 in the sequence listing), which is a selection marker expression cassette with the 5' homologous arm of ADH2 and the upstream sequence of the 5' end at both ends, named ADH2-5'-GMZ-5up.
[0096] 1.2 Construction of GAD1 expression cassette
[0097] (1) Based on the nucleotide sequences of the Saccharomyces cerevisiae translation elongation factor gene TEF2 (GenBank No. CP020124.1) and the nucleotide sequence of the glutamate decarboxylase gene GAD1 (GenBank No. CP020135.1) reported in GenBank, the following primers were designed and synthesized:
[0098] S067: 5'-CTGATCTCCTCTGCCGGAACGGGCGCCATAACCAAGGTATCT-3'
[0099] S068:5'-AGAACCGTGCCTGTGTAACATTCGACATGACCGATAACGACAAC-3'
[0100] S069: 5'-GTTGTCGTTATCGGTCATGTCGAATGTTACACAGGCACGGTTCT-3'
[0101] S070: 5'-GGCTCGCTTAGAGAGACATAAAAAACAAAAAAATCAACATGTTCCTCTATAGTTTCTC-3'
[0102] (2) PCR amplification was performed using the genome of Saccharomyces cerevisiae YEH-56 as a template. The PCR reaction system and reaction conditions are as shown in step 1.1 of Example 2 above.
[0103] The TEF2 promoter sequence, named TEF2p, was amplified from the YEH-56 genome by primers S067 and S068 to a length of 591 bp (positions 3174-3764 of sequence 4 in the sequence listing). The DNA fragment, named GAD1, was amplified from the YEH-56 genome by primers S069 and S070 to a length of 1814 bp (positions 3721-5534 of sequence 4 in the sequence listing), which included a 1758 bp GAD1 coding sequence, a 20 bp SUP4 terminator sequence, and an overlapping sequence for fusion PCR.
[0104] (3) Mix the PCR products TEF2p and GAD1 in equal molar amounts. Using this mixture as a template, perform PCR using primer pair S067 / S070 to amplify a 2361bp DNA fragment, namely the GAD1 expression cassette TEF2p-GAD1 (the DNA molecule shown by the nucleotide sequence of sequence 4 in the sequence listing, where nucleotides 3194-3743 in sequence 4 are the TEF2 promoter sequence, nucleotides 3744-5501 are the GAD1 coding sequence, and nucleotides 5502-5521 are the SUP4 terminator sequence).
[0105] 1.3 Construction of the PAN6 expression cassette
[0106] (1) Based on the nucleotide sequence of the Saccharomyces cerevisiae GTPase activator gene IRA1 (GenBank No. CP020124.1) and the nucleotide sequence of the pantothenic acid-β-alanine ligase gene PAN6 (GenBank No. CP020131.1) reported in GenBank, the following primers were designed and synthesized:
[0107] S071:
[0108] 5'-ACTATAGAGGAACATGTTGATTTTTTTGTTTTTTATGTTCTCTCTAAGCGAGCCGACAC-3'
[0109] S072:
[0110] 5'-CTTCGACAGTATGGAAGATTTTCATCTGTTTTTTTAGAAAGAGCC-3'
[0111] S073:
[0112] 5'-GGCTCTTTCTAAAAAAACAGATGAAAATCTTCCATACTGTCGAAG-3'
[0113] S074:
[0114] 5'-GCCCAAATCGAGACATAAAAAACAAAAAAATTAAATAACGATGTTATCTATTAGTCTG-3'
[0115] (2) PCR amplification was performed using the genome of Saccharomyces cerevisiae YEH-56 as a template. The PCR reaction system and reaction conditions are as shown in step 1.1 of Example 2 above.
[0116] The IRA1 promoter sequence, named IRA1p, was amplified from the YEH-56 genome by PCR using primers S071 and S072. The sequence consisted of 474 bp (positions 5482-5955 of sequence 4 in the sequence listing). The DNA fragment, named PAN6, was amplified from the YEH-56 genome by PCR using primers S073 and S074. The fragment included a 930 bp PAN6 coding sequence, a 20 bp SUP4 terminator sequence, and an overlapping sequence for fusion PCR.
[0117] (3) Mix the PCR products IRA1p and PAN6 in equal molar amounts. Using this mixture as a template, perform PCR using primer pair S071 / S074 to amplify a 1409bp DNA fragment, namely the PAN6 expression cassette IRA1p-PAN6 (the DNA molecule shown by the nucleotide sequence of sequence 4 in the sequence listing, where positions 5522-5930 in sequence 4 are the IRA1 promoter sequence, positions 5931-6860 are the PAN6 coding sequence, and positions 6861-6880 are the SUP4 terminator sequence).
[0118] 1.4 Construction of CAB1 expression cassette
[0119] (1) Based on the nucleotide sequences of the Saccharomyces cerevisiae phosphoglycerate kinase gene PGK1 (GenBank No. CP020125.1), the pantothenic acid kinase gene CAB1 (GenBank No. CP020126.1), and the alcohol dehydrogenase gene ADH2 (GenBank No. CP020135.1) reported in GenBank, the following primers were designed and synthesized:
[0120] S075:5'-TAGATAACATCGTTATTTAATTTTTTTGTTTTTTATGTCTCGATTTGGGCGCGAATCC-3'
[0121] S076:5'-CTCTTGAGTAATTCGCGGCATTGTTTTATATTTGTTGTAAAAAGTAGATAAT-3'
[0122] S077:5'-ATTATCTACTTTTTACAACAAATATAAAACAATGCCGCGAATTACTCAAGAG-3'
[0123] S078:5'-CGTAAAGACATAAGAGATCCGCCTACGTACTTGTTTTCTTAGTAGATGAAT-3'
[0124] S079: 5'-ATTCATCTACTAAGAAAACAAGTACGTAGGCGGATCTCTTATGTCTTTACG-3'
[0125] S080:5'-TAGAATTATATAACTTGATGAGATGAG-3'
[0126] (2) PCR amplification was performed using the genome of Saccharomyces cerevisiae YEH-56 as a template. The PCR reaction system and reaction conditions are as shown in step 1.1 of Example 2 above.
[0127] The PGK1 promoter sequence, 711 bp (positions 6841-7551 of sequence 4 in the sequence listing), was amplified from the YEH-56 genome using primers S075 and S076 and named PGK1p. A DNA fragment, including the coding sequence of CAB1 and the fusion PCR overlap sequence, was amplified from the YEH-56 genome using primers S077 and S078 and named CAB1. The ADH2 gene terminator sequence and the 3' homologous arm sequence, 429 bp (positions 8606-9034 of sequence 4 in the sequence listing), were amplified from the YEH-56 genome using primers S079 and S080 and named ADH2-3.
[0128] (3) Mix the PCR products PGK1p, CAB1 and ADH2-3 in equal molar amounts. Using this mixture as a template, perform PCR using primer pair S075 / S080 to amplify a 2194bp DNA fragment, namely the CAB1 expression cassette PGK1p-CAB1-ADH2-3' with the 3' homologous arm of the ADH2 gene (the DNA molecule shown by the nucleotide sequence of sequence 4 in the sequence listing, where positions 6881-7530 are the PGK1 promoter sequence, positions 7531-8634 are the CAB1 coding sequence, and positions 8635-9034 are the ADH2 gene terminator sequence, which also serve as the 3' homologous arm sequence of the ADH2 gene).
[0129] 1.5 Construction of the ADH2 knockout box
[0130] (1) Based on the nucleotide sequence of the Saccharomyces cerevisiae alcohol dehydrogenase gene ADH2 reported in GenBank (GenBank No. CP020135.1) and the selection marker G-mazF-zeoR sequence in plasmid YEp-GMZC, the following primers were designed and synthesized:
[0131] S081: 5'-GCTACAAAAAGCATACAATCAACTATCAACTATTAACTATATCGTAATACACAATGTCTATTCCAGAAACTCAAAAAGCCgcatgcccgcggtgctc-3'
[0132] S082: 5'-GCAAATTAAAGCCTTCGTGTTTGTTTGAAGAGACTAATCAAAGAATCGTTTTAGGCGGATCTCTTATGTCTTTACGATTTATAGTTTTCATTATCAAGT-3'
[0133] (2) PCR amplification was performed using YEp-GMZC as a template. The PCR reaction system and reaction conditions are as shown in step 1.1 of Example 2 above.
[0134] A 2690bp DNA fragment was amplified from plasmid YEp-GMZC using primers S081 and S082 (the DNA molecule shown in nucleotides 1-2690 of sequence 6 in the sequence listing; in sequence 6, nucleotides 1-53 are the 5' homologous arm sequence of the ADH2 gene, nucleotides 54-2591 are the selection marker cassette G-mazF-zeoR sequence, nucleotides 2592-2645 are the upstream sequence of the 5' end of the ADH2 gene, and nucleotides 2646-2690 are the 3' homologous arm sequence of the ADH2 gene). This selection marker cassette G-mazF-zeoR, with the upstream and downstream homologous arms of the ADH2 gene at both ends, was named the ADH2 knockout cassette ADH2-5-GMZ-5up-ADH2-3.
[0135] II. Construction of recombinant strains integrating GAD1, PAN6, and CAB1 expression cassettes on chromosomes
[0136] 2.1 Yeast Transformation
[0137] The aforementioned constructed selection marker cassette ADH2-5'-GMZ-5up and expression cassettes TEF2p-GAD1, IRA1p-PAN6, and PGK1p-CAB1-ADH2-3' were introduced into *Saccharomyces cerevisiae* YS58 via electroporation (conditions: 1.5 kV, 50 μF, 200 Ω, 3 mSec). 100 μL of the transformed bacterial culture was plated onto YPD agar plates containing 200 μg / mL of the antibiotic Zeocin and incubated at 30°C. Each of the four DNA fragments has a 145 bp overlap sequence. Only through double-crossover homologous recombination, integrating the four DNA fragments into the ADH2 site on the genome, could the yeast cells develop Zeocin resistance. A single colony was generated on the selection plate, and this single colony was named YS58-GAD1-PAN6-CAB1. As a control, the ADH2 knockout box ADH2-5-GMZ-5up-ADH2-3 was introduced into Saccharomyces cerevisiae YS58 in the same way. Single colonies were screened on YPD medium plates containing 200 μg / mL Zeocin to obtain recombinant yeast single colonies with Zeocin resistance. This single colony was named YS58-GMZ-ADH2.
[0138] 2.2 Reverse Filtering
[0139] YS58-GAD1-PAN6-CAB1 and YS58-GMZ-ADH2 were inoculated into 2 ml of SCG induction medium and cultured at 30°C and 200 rpm for 6 h. The bacterial cultures were then spread onto SCG solid medium plates and incubated statically at 30°C. Galactose in the medium induced the expression of the toxic protein MazF, which had a lethal effect on yeast. Therefore, yeast cells that had GMZ knocked out of their genome could only grow when homologous recombination occurred between the downstream of the selection marker GMZ integrated into the ADH2 site and the same sequence upstream of ADH2, resulting in single colonies of recombinant yeast cells with the knockout resistance selection marker.
[0140] Ten recombinant yeast colonies with the resistance selection marker knocked out were randomly inoculated into sterile water and incubated at room temperature for 2 hours. 4 μL of each colony was then spotted onto YPD agar plates and YPD agar plates containing 200 μg / mL Zeocin, and incubated at 30°C for 48 hours. None of the colonies tested grew on the Zeocin-containing plates, indicating that the resistance selection marker was knocked out. The colony derived from YS58-GMZ-ADH2 with the resistance selection marker knocked out was named YS58-adh2 and served as the control strain; the colony derived from YS58-GAD1-PAN6-CAB1 with the resistance selection marker knocked out was named the recombinant strain YS58-GPC, which was the engineered strain.
[0141] The recombinant strain YS58-GPC contains the nucleotide sequence shown in sequence 4 of the sequence listing, positions 3194-9034.
[0142] 2.3 Gene Expression Level Analysis
[0143] (1) Primers were designed and synthesized based on the coding sequences of the GAD1, PAN6 and CAB1 genes of Saccharomyces cerevisiae reported in GenBank:
[0144] GAD-S083:5'-TCCCAAATTGAGGCCAAGCA-3'
[0145] GAD-S084:5'-CTCCATAGCACCCAACCCAG-3'
[0146] PAN6-S085:5'-CCTCGAACTTTGCCAGACGA-3'
[0147] PAN6-S086:5'-TGCTCTTCTATGTCGAGCGG-3'
[0148] CAB1-S087:5'-AGTAGGCCGTTCTTCACTGG-3'
[0149] CAB1-S088:5'-GAATTGTCACCCTCTTGTGCC-3'
[0150] ACT1-qF:5'-TGTGATGTCGATGTCCGTAA-3'
[0151] ACT1-qR:5'-AAGAAGCCAAGATAGAACCA-3'
[0152] (2) Total RNA was extracted from the original strain YS58, the control strain YS58-adh2, and the recombinant strain YS58-GPC. Reverse transcription was performed using a qRT-PCR kit (SYBR Green I) to obtain the corresponding cDNA. Using this cDNA as a template, the relative expression levels of the three genes GAD1, PAN6, and CAB1 were analyzed using primer pairs S083 / S084, S085 / S086, and S087 / S088 via the Quant two-step quantitative qRT-PCR method (SYBR Green I). Experimental data were collected using LightCycler96 software SW 1.1 (Roche). The expression levels of each gene were analyzed using the ΔCT calculation method. The relative expression level of each gene was calculated using the *Saccharomyces cerevisiae* ACT1 gene as a control. The relative expression level of each gene in the original strain YS58 was set to 1. Each experiment was repeated three times. The results are shown in Table 4. The relative expression levels of genes GAD1, PAN6, and CAB1 in strain YS58-GPC were 2.0, 1.7, and 1.6 times that of the original strain YS58 and the control strain YS58-adh2, respectively, indicating that GAD1, PAN6, and CAB1 were enhanced in the recombinant strain YS58-GPC.
[0153] Table 4. Comparison of relative expression levels of genes GAD1, PAN6, and CAB1 in different strains
[0154] strain GAD1 PAN6 CAB1 YS58 1.00 1.00 1.00 YS58-adh2 1.02 0.98 1.04 YS58-GPC 2.03 1.65 1.64
[0155] The recombinant strain YS58-GPC can overexpress the GAD1 protein with the amino acid sequence shown in Sequence 1 of the sequence listing, the PAN6 protein with the amino acid sequence shown in Sequence 2 of the sequence listing, and the CAB1 protein with the amino acid sequence shown in Sequence 3 of the sequence listing.
[0156] III. Effects of GAD1, PAN6, and CAB1 Chromosomal Integration Expression on Squalene Synthesis in Cells
[0157] 3.1. Culture yeasts YS58-adh2 and YS58-GPC according to the steps described in Example 1.
[0158] 3.2 Cell biomass was determined and calculated according to the method described in Example 1. The results are shown in Table 5. Compared with the control strain YS58-adh2, the cell growth of the recombinant strain YS58-GPC was affected, and the cell dry weight yield decreased by 14.8%.
[0159] (3) The squalene content was determined according to the method described in Example 1, and the cellular squalene content was calculated based on the standard curve. The results are shown in Table 5. Compared with the control strain YS58-adh2, the squalene content of the recombinant strain YS58-GPC was increased by 54.5%, resulting in a 30.6% increase in squalene yield. There was no significant difference between the control strain and the original strain.
[0160] Table 5. Cell growth and squalene content analysis of recombinant strain YS58-GPC and control strain YS58-adh2
[0161]
[0162] The above results indicate that enhancing the expression of β-alanine metabolism-related genes GAD1, PAN6, and CAB1 through chromosomal integration can improve the synthesis of squalene, a terpene compound. This suggests that these genes have a positive effect on terpene synthesis and can serve as new modification targets for constructing chassis cells with efficient terpene synthesis.
[0163] Example 3: Construction of a high-yield squalene strain by integrating GAD1, PAN6, and CAB1 into chromosomes.
[0164] I. Strain Construction
[0165] 1.1 Following the electroporation transformation method described in step two of Example 2, the screening marker cassette ADH2-5'-GMZ-5up, expression cassettes TEF2p-GAD1, IRA1p-PAN6, and PGK1p-CAB1-ADH2-3' constructed in Example 2 were introduced into Saccharomyces cerevisiae YEH56-E(M5) via electroporation, and the transformed strains were screened on YPD medium plates containing 200 μg / mL Zeocin.
[0166] 1.2. Following the reverse screening method described in step two of Example 2, single colonies of recombinant strains with lost Zeocin resistance selection markers were screened on SCG induction medium plates.
[0167] 1.3 Following the gene expression level analysis method described in step two of Example 2, qRT-PCR (SYBR Green I) analysis was performed on the selected single colonies using primer pairs S083 / S084, S085 / S086, and S087 / S088. The results showed that the expression levels of the three genes GAD1, PAN6, and CAB1 in the selected recombinant strain (named YEH56-E(M5)-GPC) single colonies were 2.0, 2.8, and 2.1 times higher than those in the control strain YEH56-E(M5), respectively. This indicates that the expression of the relevant genes was enhanced by tandem integration of the expression cassettes TEF2p-GAD1, IRA1p-PAN6, and PGK1p-CAB1 at the ADH2 site of the genome.
[0168] The recombinant strain YEH56-E(M5)-GPC contains the DNA molecule represented by nucleotides 3194-9034 in sequence 4 of the sequence listing, and can overexpress the GAD1 protein with amino acids as shown in sequence 1 of the sequence listing, the PAN6 protein with amino acids as shown in sequence 2 of the sequence listing, and the CAB1 protein with amino acids as shown in sequence 3 of the sequence listing.
[0169] II. Analysis of Recombinant Yeast Cell Growth and Squalene Levels
[0170] 2.1. Culture yeast YEH56-E(M5) and recombinant yeast YEH56-E(M5)-GPC according to the steps described in Example 1.
[0171] 2.2 Cell biomass was determined and calculated according to the method described in Example 1. The results are shown in Table 6. Compared with the control strain YEH56-E(M5), the cell growth of the recombinant strain YEH56-E(M5)-GPC was affected to some extent, and the cell dry weight yield decreased by 16.7%.
[0172] (3) The squalene content was determined according to the method described in Example 1, and the cellular squalene content was calculated based on the standard curve.
[0173] The results are shown in Table 5. Compared with the starting control strain YEH56-E(M5), the squalene content of the recombinant strain YEH56-E(M5)-GPC was increased by 32.4%, and the squalene yield was increased by 10.3%.
[0174] Table 6. Cell growth and squalene content analysis of recombinant strain YEH56-E(M5)-GPC and control strain
[0175]
[0176] Enhancing the expression of β-alanine metabolism-related genes GAD1, PAN6, and CAB1 through chromosomal integration significantly improved the ability of yeast to synthesize squalene, a high-squalene-producing strain, YEH56-E(M5)-GPC. After 24 hours of shake-flask culture, the squalene yield reached 449.37 mg / L, demonstrating significant potential for industrial application.
[0177] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Institute of Microbiology, Chinese Academy of Sciences <120> Key genes for enhancing terpene synthesis in Saccharomyces cerevisiae and their applications <130> GNCSQ212431 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 585 <212> PRT <213> Saccharomyces cerevisiae <400> 1 Met Leu His Arg His Gly Ser Lys Gln Lys Asn Phe Glu Asn Ile Ala 1 5 10 15 Gly Lys Val Val His Asp Leu Ala Gly Leu Gln Leu Leu Ser Asn Asp 20 25 30 Val Gln Lys Ser Ala Val Gln Ser Gly His Gln Gly Ser Asn Asn Met 35 40 45 Arg Asp Thr Ser Ser Gln Gly Met Ala Asn Lys Tyr Ser Val Pro Lys 50 55 60 Lys Gly Leu Pro Ala Asp Leu Ser Tyr Gln Leu Ile His Asn Glu Leu 65 70 75 80 Thr Leu Asp Gly Asn Pro His Leu Asn Leu Ala Ser Phe Val Asn Thr 85 90 95 Phe Thr Thr Asp Gln Ala Arg Lys Leu Ile Asp Glu Asn Leu Thr Lys 100 105 110 Asn Leu Ala Asp Asn Asp Glu Tyr Pro Gln Leu Ile Glu Leu Thr Gln 115 120 125 Arg Cys Ile Ser Met Leu Ala Gln Leu Trp His Ala Asn Pro Asp Glu 130 135 140 Glu Pro Ile Gly Cys Ala Thr Thr Gly Ser Ser Glu Ala Ile Met Leu 145 150 155 160 Gly Gly Leu Ala Met Lys Lys Arg Trp Glu His Arg Met Lys Asn Ala 165 170 175 Gly Lys Asp Ala Ser Lys Pro Asn Ile Ile Met Ser Ser Ala Cys Gln 180 185 190 Val Ala Leu Glu Lys Phe Thr Arg Tyr Phe Glu Val Glu Cys Arg Leu 195 200 205 Val Pro Val Ser His Arg Ser His His Met Leu Asp Pro Glu Ser Leu 210 215 220 Trp Asp Tyr Val Asp Glu Asn Thr Ile Gly Cys Phe Val Ile Leu Gly 225 230 235 240 Thr Thr Tyr Thr Gly His Leu Glu Asn Val Glu Lys Val Ala Asp Val 245 250 255 Leu Ser Gln Ile Glu Ala Lys His Pro Asp Trp Ser Asn Thr Asp Ile 260 265 270 Pro Ile His Ala Asp Gly Ala Ser Gly Gly Phe Ile Ile Pro Phe Gly 275 280 285 Phe Glu Lys Glu His Met Lys Ala Tyr Gly Met Glu Arg Trp Gly Phe 290 295 300 Asn His Pro Arg Val Val Ser Met Asn Thr Ser Gly His Lys Phe Gly 305 310 315 320 Leu Thr Thr Pro Gly Leu Gly Trp Val Leu Trp Arg Asp Glu Ser Leu 325 330 335 Leu Ala Asp Glu Leu Arg Phe Lys Leu Lys Tyr Leu Gly Gly Val Glu 340 345 350 Glu Thr Phe Gly Leu Asn Phe Ser Arg Pro Gly Phe Gln Val Val His 355 360 365 Gln Tyr Phe Asn Phe Val Ser Leu Gly His Ser Gly Tyr Arg Thr Gln 370 375 380 Phe Gln Asn Ser Leu Phe Val Ala Arg Ala Phe Ser Phe Glu Leu Leu 385 390 395 400 Asn Ser Ser Lys Leu Pro Gly Cys Phe Glu Ile Val Ser Ser Ile His 405 410 415 Glu Ser Ile Glu Asn Asp Ser Ala Pro Lys Ser Val Lys Asp Tyr Trp 420 425 430 Glu His Pro Gln Ala Tyr Lys Pro Gly Val Pro Leu Val Ala Phe Lys 435 440 445 Leu Ser Lys Lys Phe His Glu Glu Tyr Pro Glu Val Pro Gln Ala Ile 450 455 460 Leu Ser Ser Leu Leu Arg Gly Arg Gly Trp Ile Ile Pro Asn Tyr Pro 465 470 475 480 Leu Pro Lys Ala Thr Asp Gly Ser Asp Glu Lys Glu Val Leu Arg Val 485 490 495 Val Phe Arg Ser Glu Met Lys Leu Asp Leu Ala Gln Leu Leu Ile Val 500 505 510 Asp Ile Glu Ser Ile Leu Thr Lys Leu Ile His Ser Tyr Glu Lys Val 515 520 525 Cys His His Ile Glu Leu Ala Ser Glu Gln Thr Pro Glu Arg Lys Ser 530 535 540 Ser Phe Ile Tyr Glu Met Leu Leu Ala Leu Ala Ser Pro Gln Asp Asp 545 550 555 560 Ile Pro Thr Pro Asp Glu Ile Glu Lys Lys Asn Lys Leu Lys Glu Thr 565 570 575 Thr Thr Arg Asn Tyr Arg Gly Thr Cys 580 585 <210> 2 <211> 309 <212> PRT <213> Saccharomyces cerevisiae <400> 2 Met Lys Ile Phe His Thr Val Glu Glu Val Val Gln Trp Arg Thr Gln 1 5 10 15 Glu Leu Arg Glu Thr Arg Phe Arg Glu Thr Ile Gly Phe Val Pro Thr 20 25 30 Met Gly Cys Leu His Ser Gly His Ala Ser Leu Ile Ser Gln Ser Val 35 40 45 Lys Glu Asn Thr Tyr Thr Val Val Ser Ile Phe Val Asn Pro Ser Gln 50 55 60 Phe Ala Pro Thr Glu Asp Leu Asp Asn Tyr Pro Arg Thr Leu Pro Asp 65 70 75 80 Asp Ile Lys Leu Leu Glu Ser Leu Lys Val Asp Val Leu Phe Ala Pro 85 90 95 Asn Ala His Val Met Tyr Pro Gln Gly Ile Pro Leu Asp Ile Glu Glu 100 105 110 Gln Lys Gly Pro Phe Val Ser Val Leu Gly Leu Ser Glu Lys Leu Glu 115 120 125 Gly Lys Thr Arg Pro Asn Phe Phe Arg Gly Val Ala Thr Val Val Thr 130 135 140 Lys Leu Phe Asn Ile Val Met Ala Asp Val Ala Tyr Phe Gly Gln Lys 145 150 155 160 Asp Ile Gln Gln Phe Ile Val Leu Gln Cys Met Val Asp Glu Leu Phe 165 170 175 Val Asn Thr Arg Leu Gln Met Met Pro Ile Val Arg Asn Asn Asn Gly 180 185 190 Leu Ala Leu Ser Ser Arg Asn Lys Tyr Leu Cys Pro Glu Ser Leu Lys 195 200 205 Ile Ser Glu Asn Leu Tyr Arg Gly Leu Lys Ala Ala Glu Asn Ala Ile 210 215 220 Arg Arg Leu Ala Pro Gly Gly Arg Leu Ser Arg Ser Glu Ile Ile Asp 225 230 235 240 Thr Val Thr Gln Ile Trp Ala Pro Tyr Val Asp Ser His Asp Phe Lys 245 250 255 Ile Asp Tyr Val Ser Leu Ala Asp Phe Lys Thr Leu Asp Glu Leu Ser 260 265 270 Asp Val Glu Asn Thr Ser Glu Gln Gln Pro Ile Val Ile Ser Cys Ala 275 280 285 Val Tyr Val Thr Asp Arg Glu Lys Pro Asp Thr Val Val Arg Leu Ile 290 295 300 Asp Asn Ile Val Ile 305 <210> 3 <211> 367 <212> PRT <213> Saccharomyces cerevisiae <400> 3 Met Pro Arg Ile Thr Gln Glu Ile Ser Tyr Asn Cys Asp Tyr Gly Asp 1 5 10 15 Asn Thr Phe Asn Leu Ala Ile Asp Ile Gly Gly Thr Leu Ala Lys Val 20 25 30 Val Phe Ser Pro Ile His Ser Asn Arg Leu Met Phe Tyr Thr Ile Glu 35 40 45 Thr Glu Lys Ile Asp Lys Phe Met Glu Leu Leu His Ser Ile Ile Lys 50 55 60 Glu His Asn Asn Gly Cys Tyr Arg Met Thr His Ile Ile Ala Thr Gly 65 70 75 80 Gly Gly Ala Phe Lys Phe Tyr Asp Leu Leu Tyr Glu Asn Phe Pro Gln 85 90 95 Ile Lys Gly Ile Ser Arg Phe Glu Glu Met Glu Gly Leu Ile His Gly 100 105 110 Leu Asp Phe Phe Ile His Glu Ile Pro Asp Glu Val Phe Thr Tyr Asn 115 120 125 Asp Gln Asp Gly Glu Arg Ile Ile Pro Thr Ser Ser Gly Thr Met Asp 130 135 140 Ser Lys Ala Ile Tyr Pro Tyr Leu Leu Val Asn Ile Gly Ser Gly Val 145 150 155 160 Ser Ile Leu Lys Val Thr Glu Pro Asn Asn Phe Ser Arg Val Gly Gly 165 170 175 Ser Ser Leu Gly Gly Gly Thr Leu Trp Gly Leu Leu Ser Leu Ile Thr 180 185 190 Gly Ala Gln Thr Tyr Asp Gln Met Leu Asp Trp Ala Gln Glu Gly Asp 195 200 205 Asn Ser Ser Val Asp Met Leu Val Gly Asp Ile Tyr Gly Thr Asp Tyr 210 215 220 Asn Lys Ile Gly Leu Lys Ser Ser Ala Ile Ala Ser Ser Phe Gly Lys 225 230 235 240 Val Phe Gln Asn Arg Met Thr Ser Asn Lys Ser Leu Glu Asn Asn Glu 245 250 255 Asn Lys Leu Tyr Ser Ser His Glu Ser Ile Glu Lys Asn Asn Gly Gln 260 265 270 Met Phe Lys Asn Pro Asp Ile Cys Lys Ser Leu Leu Phe Ala Ile Ser 275 280 285 Asn Asn Ile Gly Gln Ile Ala Tyr Leu Gln Ala Lys Ile Asn Asn Ile 290 295 300 Gln Asn Ile Tyr Phe Gly Gly Ser Tyr Thr Arg Gly His Leu Thr Thr 305 310 315 320 Met Asn Thr Leu Ser Tyr Ala Ile Asn Phe Trp Ser Gln Gly Ser Lys 325 330 335 Gln Ala Phe Phe Leu Lys His Glu Gly Tyr Leu Gly Ala Met Gly Ala 340 345 350 Phe Leu Ser Ala Ser Arg His Ser Ser Thr Lys Lys Thr Ser Thr 355 360 365 <210> 4 <211> 9034 <212> DNA <213> Artificial Sequence <400> 4 agttggagaa attagagaat ttcagattga gagaatgaa aaaaaaaaaaaggc 60 agaggagagc atagaatgg gttcacttt ttggtaagc tatagcatgc ctatcacata 120 taaatagagt gccagtagcg acttttca cactcgaaat actcttacta ctgctctctt 180 gttgtttta tcactcttg tttctcttg gtaaatagaa tatcaagcta caaaagcat 240 acaatcact atcaactatt aactatatcg taatacacaa tgtctattcc agaaactca 300 aaagccgcat gcccgcggtg ctcattgcta tattgaagta cggattagaa gccgccgagc 360 gggtgacagc cctccgaagg aagactctc tccgtgcgtc ctcgtctca ccggtcgcgt 420 tcctgaaacg cagatgtgcc tcgcgccgca ctgctccgaa cataaagat tctacaatac 480 tagcaagctt tgctcattgc tatttgag tacggatt aagccgccga gcgggtgaca 540 gccctccgaa ggaagactct cctccgtgcg tcctcgctt caccggtcgc gttcctgaaa 600 cgcagatgtg cctcgcgccg cactgctccg aacataaag attctacaat actagctttt 660 atggttatga agaggaaaaa ttggcagtaa cctggccttc aaatgaacga atcaaattaa 720 caaccatagg atgataatgc gattagtttt ttagccttat aattaatcag cgaagcgatg 780 atttttgatc tattaacaga tatataaatg caaaaactgc ataaccactt taactaatac 840 tttcaacatt ttcggttttgt attacttctt attcaaatgt aataaaagta tcaaaaaa 900 attgttaata tacctctata ctttaacgtc aaggagatgg taagccgata cgtacccgat 960 atgggcgatc tgatttgggt tgatttgac ccgacaaaag gtagcgagca agctggacat 1020 cgtccagctg ttgtcctgag tcctttcatg tacaacaaca aaacaggtat gtgtctgtgt 1080 gttccttgta caacgcaatc aaaaggatat ccgttcgaag ttgttttatc cggtcaggaa 1140 cgtgatggcg tagcgttagc tgatcaggta aaaagtatcg cctggcgggc aagaggagca 1200 acgaagaaag gaacagttgc cccagaggaa ttacaactca ttaaagccaa aattaacgta 1260 ctgattgggt agtctagaac aaaaactcat ctcagaagag gatctgaata gcgccgtcga 1320 ccatcatcat catcatt gagttttagc cttagacatg actgttcctc agttcaagtt 1380 gggcacttac gagaagaccg gtcttgctag attctaatca agaggatgtc agaatgccat 1440 ttgcctgaga gatgcaggct tcatttttga tactttttta tttgtaacct atatagtata 1500 ggattttttt tgtcattttg tttcttctcg tacgagcttg ctcctgatca gcctatctcg 1560 cagctgatga atatcttgtg gtaggggttt gggaaaatca ttcgagtttg atgtttttct 1620 tggtatttcc cactcctctt cagagtacag aagattaagt gagaccttcg tttgtgcccc 1680 acacaccata gcttcaaaat gtttctactc cttttttact cttccagatt ttctcggact 1740 ccgcgcatcg ccgtaccact tcaaaacacc caagcacagc atactaaatt ttccctcttt 1800 cttcctctag ggtgtcgtta attacccgta ctaaaggttt ggaaaagaaa aaagagaccg 1860 cctcgtttct ttttcttcgt cgaaaaaggc aataaaaatt tttatcacgt ttctttttct 1920 tgaaattttt ttttttagtt tttttctctt tcagtgacct ccattgatat ttaagttaat 1980 aaacggtctt caatttctca agtttcagtt tcatttttct tgttctatta caactttttt 2040 tacttcttgt tcattagaaa gaaagcatag caatctaatc taagggcggt gttgacaatt 2100 aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac taaaccatgg 2160 ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga cgtcgccgga gcggtcgagt 2220 tctggaccga ccggctcggg ttctcccggg acttcgtgga ggacgacttc gccggtgtgg 2280 tccgggacga cgtgaccctg ttcatcagcg cggtccagga ccaggtggtg ccggacaaca 2340 ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta cgccgagtgg tcggaggtcg 2400 tgtccacgaa cttccgggac gcctccgggc cggccatgac cgagatcggc gagcagccgt 2460 gggggcggga gttcgccctg cgcgacccgg ccggcaactg cgtgcacttc gtggccgagg 2520 agcaggactg acacgtccga cggcggccca cgggtcccag gcctcggaga tccgtccccc 2580 ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcccccc 2640 acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat 2700 ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt 2760 ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg 2820 ggacgctcga aggctttaat ttgctgtttg tttgaagaga ctaatcaaag aatcgttttc 2880 tcaaaaaaaat taatatctta actgatagtt tgatcaaagg ggcaaaacgt aggggcaaac 2940 aaacggaaaa atcgtttctc aaattttctg atgccaagaa ctctaaccag tcttatctaa 3000 aaattgcctt atgatccgtc tctccggtta cagcctgtgt aactgattaa tcctgccttt 3060 ctaatcacca ttctaatgtt ttaattaagg gattttgtct tcattaacgg ctttcgctca 3120 taaaaatgtt atgacgtttt gcccgcaggc gggaaaccat ccacttcacg agactgatct 3180 cctctgccgg aacgggcgcc ataaccaagg tatctataga ccgccaatca gcaactacc 3240 tccgtacatt catgttgcac ccacacattt atacacccag accgcgacaa attacccata 3300 aggttgtttg tgacggcgtc gtacaagaga acgtgggaac tttttaggct caccaaaaaa 3360 gaaagaaaaa atacgagttg ctgacagaag cctcaagaaa aaaaaattc ttcttcgact 3420 atgctgggagg cagagatgat cgagccggta gttaactata tatagctaaa ttggttccat 3480 caccttcttt tctggtgtcg ctcctttag tgctatttct ggcttttcct atttttttt 3540 ttccattttt ctttctctct ttctaatata taaattctct tgcattttct attttctct 3600 ctatctattc tacttgttta ttcccttcaa ggtttttttt taaggagtac ttgtttttag 3660 aatatacggt caacgaacta taattaacta aacatgggta aagagaagtc tcacattaac 3720 gttgtcgtta tcggtcatgt cgaatgttac acaggcacgg ttctaagcag aagaacttcg 3780 agaatatcgc tggaaaagtt gtccacgacc ttgcaggtct gcaattgctt tctaacgacg 3840 ttcaaaaatc cgctgtccaa agtggtcatc aaggatcgaa caatatgaga gatacttcgt 3900 ctcagggcat ggctaataag tattcagttc caaaaaaggg actacctgct gatttgtctt 3960 accaactgat tcataatgaa ttaacacttg atggtaatcc gcatttgaac cttgccagtt 4020 tcgtgaacac ttttaccact gatcaggcaa ggaaattgat tgatgaaaat ttgaccaaaa 4080 atcttgctga caatgatgaa tatccgcaat taattgagct aactcagcgt tgtatttcta 4140 tgctagctca attatggcac gctaatcccg atgaagaacc aataggctgt gccaccacag 4200 gttctagtga ggcaatcatg ttgggtggac tcgccatgaa aaaaagatgg gaacacagaa 4260 tgaagaatgc tggtaaagat gcttccaagc cgaacattat aatgtcttct gcgtgccaag 4320 tggcattaga gaagtttacg agatattttg aagtggaatg ccgattggtt ccggtatccc 4380 acagaagcca tcatatgctt gacccagagt cgttatggga ttatgtagat gagaacacta 4440 ttggctgttt tgtaatttta ggaaccacct acactggcca tttggaaaat gtagagaaag 4500 ttgcagatgt cttgtcccaa attgaggcca agcatcctga ttggagcaat actgatattc 4560 caatccatgc ggatggcgct tcaggtgggt ttattatccc atttggcttt gaaaaagagc 4620 acatgaaagc ttatggcatg gaacgttggg ggttcaacca tccgcgtgtg gttagtatga 4680 acactagtgg tcataagttt ggcttaacca ctcccggtct gggttgggtg ctatggagag 4740 atgaatcctt actggctgat gaattgagat tcaaactaaa gtacctcggt ggcgtggaag 4800 aaactttcgg tttgaatttt tcaagacctg gatttcaagt tgtccatcaa tacttcaatt 4860 ttgtttctct aggccattca gggtatagaa cacaattcca aaattctcta tttgttgcaa 4920 gagcgtttc tttcgaatta ttgaattcgt caaaattgcc cggatgcttt gaaattgtta 4980 gcagtatcca tgaaagcatt gagaacgatt ccgcccctaa gtcagttaaa gactattggg 5040 aacaccccca ggcttacaaa ccaggtgtac cgctggtagc ctcaattg tccaagaat 5100 tccacgaaga atatccagaa gtgccacaag caatcctttc ctctttactg agaggtaggg 5160 gttggataat accaattac ccactaccaa agcaacgga tggatccgat gagaaggagg 5220 tattagagt gttttcaga tcggagatga agttgattt agcacagttg ttgatcgttg 5280 acatcgagag tatcttgaca aagttgattc atagttacga aaagttttgt catcatatag 5340 aacttgccctc tgagcaact ccagagcgca agagttcgtt catctacgaa atgttgctgg 5400 cattggcatc tccacagat gataccca cgccggatga atcgaaag aaaataagc 5460 taaaggaaac aaaacgaga aactatagag gaacatgttg atttttttgtttttgtc 5520 tctctaagcg agccgacacc gcctggaagt tttcataaa gggatacaat atagaagat 5580 gtgtaaaaac gttaagtaaa agatgagcaa atgaacagtg ttcgaggag ataacaga 5640 gttactgctc ataaaact atatactaa aggttttcgc ttgtattac gattgaaaca 5700 attaactgtt tttttttt ccgcttatta cacagtaccg gttcattta cgccttgat 5760 cattttattg gcattgggct catagtagtt ttcagcgcgt ggttaagcta tttaacgaaa 5820 gcgtataaag tcaagtgatc atcttttgcc ctgcaaatag agcttcaaac ttaacattct 5880 tcttcagcat ataacataca acaagattaa ggctttct aaaaaaacag atgaaaatct 5940 tccatactgt cgaagaagtt gttcaatgga gaacacagga gctgagggaa actagattta 6000 gagaaactat tgggttcgtt cccacaatgg gttgcctgca ttcgggtcac gctagtttga 6060 tctcgcagtc tgtgaaggaa aacacctata ctgtggtcag tatatttgta aatccctccc 6120 agtttgcgcc aacggaagat ctagataact atcctcgaac tttgccagac gacatcaaat 6180 tgcttgagtc gttgaaggtg gatgttctat ttgctcctaa tgcacacgtg atgtatccac 6240 agggaattcc gctcgacata gaagagcaga aaggcccttt tgttagtgtt cttggattga 6300 gtgaaaaatt agaggggaag acgagaccta acttctttag gggcgtggca actgtcgtga 6360 ctaaactatt caatatcgtt atggcggatg tggcttattt tgggcagaag gacattcaac 6420 agttcattgt tttacagtgt atggtggacg aactgtttgt tatacaagg ctacaaatga 6480 tgcctattgt aagaaacaat aatggactgg ctctgagtag tagaaacaaa tatctttgtc 6540 cagagtcttt aaagatctct gaaaaccttt accgcgggct gaaagctgcg gaaaatgcta 6600 ttaggagact agcaccaggg ggacgtctct ccagatcaga aatcatcgat actgtgactc 6660 aaatatgggc accctacgtt gattcccacg atttcaaaat cgactatgtt tccttagcag 6720 atttaagac tcttgatgaa ctctccgatg ttgaaaacac cagcgaacag cagccaatag 6780 tcattagttg tgctgtatac gtgactgacc gcgaaaaacc cgatacggtc gtcagactaa 6840 tagataacat cgttatttaa ttttttgtt ttttatgtct cgatttgggc gcgaatcctt 6900 tattttggct tcaccctcat actattatca gggccagaaa aaggaagtgt ttccctcctt 6960 cttgaattga tgttaccctc ataaagcacg tggcctctta tcgagaaaga aattaccgtc 7020 gctcgtgatt tgtttgcaaa aagaacaaaa ctgaaaaaac ccagacacgc tcgacttcct 7080 gtcttcctat tgattgcagc ttccaatttc gtcacacaac aaggtcctag cgacggctca 7140 caggttttgt aacaagcaat cgaaggttct ggaatggcgg gaaagggttt agtaccacat 7200 gctatgatgc ccactgtgat ctccagagca aagttcgttc gatcgtactg ttactctctc 7260 tctttcaaac agaattgtcc gaatcgtgtg acaacaacag cctgttctca cacactcttt 7320 tcttctaacc aagggggtgg tttagtttag tagaacctcg tgaaacttac atttacatat 7380 atataaactt gcataaattg gtcaatgcaa gaaatacata tttggtcttt tctaattcgt 7440 agtttttcaa gttcttagat gctttctttt tctctttttt acagatcatc aggaaagtaa 7500 ttatctactt tttacaacaa atataaaaca atgccgcgaa ttactcaaga gatatcttac 7560 aattgcgatt atggcgacaa tactttcaac cttgctattg atataggagg cactctggct 7620 aaagtagtct tctcgcctat acacagtaac aggctgatgt tctacaccat tgaaacagag 7680 aaaattgaca agttcatgga acttctgcat tctattatca aagaacataa caatggatgc 7740 tatagaatga ctcatataat tgccactggt ggtggcgcct tcaagtttta tgatttgttg 7800 tatgaaaatt ttcctcaaat aaaaggtata tcgaggttcg aagaaatgga aggcttaatt 7860 cacggtttag actttttcat tcatgagatt cccgatgaag ttttcactta caacgatcaa 7920 gatggcgaaa ggatatacc caccagttcc ggcaccatgg actcaaggc tatctaccca 7980 taccttctag tcaatagg gtcgggtgtc tcaatattaa aagtcaccga accaacaat 8040 tttagtagag taggcggttc ttcactggga ggaggaacctc ttggggcct attatcacta 8100 attactggcg ctcaactta tgatcagatg ctcgattggg cacaagaggg tgacattct 8160 agcgttgata tgctagttgg agatttat ggacagact ataataaat tggtctaaag 8220 tcgtcagcta ttgcaagttc atttggtaaa gttttccaaa atagaatgac atctaacaa 8280 tctttggaaa acaacgaaaa taaattata tcctcacatg agtctattga gaaaaacaat 8340 ggacaaatgt ttaagaatcc tgatatttgt aaaagtctc tattcgccat ctccaacaat 8400 attgggcaaa tagcttattt gcaagctaa atcaatata tacagaata attackttggc 8460 ggatcttata ccagaggaca ttgactacc atgacactt tgagctacgc tattaattt 8520 tggtcacaag gatcaaagca agcgtttttt ctcaaacatg aaggctattt gggtgcaatg 8580 ggtgctttcc taagcgcgtc tcgtcattca tctactaaga aaacaagtac gtaggcggat 8640 ctcttatgtc tttacgattt atagttttca tttcaagta tgcctatatt agtatatagc 8700 atctttagat gacagtgttc gaagtttcac gaataaaaga tatattcta cttttgctc 8760 ccaccgcgt tgctagcacg agtgaacacc atccctcgcc tgtgagttgt acccattcct 8820 ctaaactgta gacatggtag cttcagcagt gttcgttatg tacggcatcc tccaacaaac 8880 agtcggttat agttgtcct gctcctctga atcgtctccc tcgatatttc tcattttcct 8940 tcgcatgcca gcattgaaat gatcgaagtt caatgatgaa acggtaattc ttctgtcatt 9000 tactcatctc atctcatcaa gttatataat tcta 9034 <210> 5 <211> 516 <212> DNA <213> Artificial Sequence <400> 5 ccaagctttg agcgtggttc agggcactct acgggatcgt ggcgaatggg aatcgttctg 60 caagctcttc taccaaacca tcggcgaatt tgcgtcgctt taatgcgata ctgccgtagc 120 gggccttcgt atagctcggc cgagctcgta caaaaggcaa gcagtgtatc ggacagagct 180 gatataacac aatacgctcg tagtcgatgc atgccgtggc tgctctcggt cgggtataag 240 tcttagacaa tagtcttacc tcgcatgtat aataaatctt ttgtatttaa tctattatat 300 gttctatgc ttttttttcc tattgttgtt tgctttcct tttccttatt tctttctagc 360 ttctaattt cttcttttt tttttttt tcattgaaaa ttatatatat atatatatat 420 cagaacaatt gtccagtatt gaacaataca ggttattcg aacaattgaa aaaaaaaaat 480 cacagaaaaa catatcgaga aaagggtcgg atcccg 516 <210> 6 <211> 2690 <212> DNA <213> Artificial Sequence <400> 6 gctacaaaaa gcatacaatc aactatcaac tattaactat atcgtaatac acagcatgcc 60 cgcggtgctc attgctatat tgaagtacgg attagaagcc gccgagcggg tgacagccct 120 ccgaaggaag actctcctcc gtgcgtcctc gtcttcaccg gtcgcgttc tgaaacgcag 180 atgtgcctg cgccgcactg ctccgaacaa taaagattct acaatactag caagctttgc 240 tcattgctat attgaagtac ggattagaag ccgccgagcg ggtgacagcc ctccgaagga 300 agactctcct ccgtgcgtcc tcgtcttcac cggtcgcgtt cctgaaacgc agatgtgcct 360 cgcgccgcac tgctccgaac aaaagatt ctacaatact agcttttg gttatgaaga 420 ggaaaaattg gcagtaacct ggccttcaa tgaacgaatc aattacaa ccataggatg 480 ataatgcgat tagtttttta gccttatat taatcagcga agcgatt ttgatctat 540 taacagatat ataaatgca aaactgcata accactttaa ctaatacttt ciecattttc 600 ggtttgtatt acttcttatt aaatgtaat aaagtatca acaaaaatt gttaatatac 660 ctctatactt taacgtcaag gagatggtaa gccgatacgt acccgatg ggcgatctga 720 tttgggttga tttgacccg aaaaggta gcgagcaagc tggacatcgt ccagctgttg 780 tcctgagtcc ttcatgtac aacaacaaa caggtatgtg tctgtgtgtt ccttgtacaa 840 cgcaatcaaa aggatatccg ttcgaagttg ttttaccgg tcaggaacgt gatggcgtag 900 cgttagctga tcaggtaaa agtatcgcct ggcgggcaag aggagcaacg agaaaaggaa 960 cagttgcccc agaggaatta caaccatta aagccaaat taacgtactg attgggtagt 1020 ctagaacaaa aactcatctc agaagaggat ctgaatagcg ccgtcgacca tcatcatcat 1080 catcattgag ttttagcctt agacatgact gttcctcagt tcaagttggg cacttacgag 1140 aagaccggtc ttgctagatt ctaatcaaga ggatgtcaga atgccatttg cctgagagat 1200 gcaggcttca tttttgatac ttttttattt gtaacctata tagtatagga ttttttttgt 1260 cattttgttt cttctcgtac gagcttgctc ctgatcagcc tatctcgcag ctgatgaata 1320 tcttgtggta ggggtttggg aaaatcattc gagtttgatg tttttcttgg tatttcccac 1380 tcctcttcag agtacagaag attaagtgag accttcgttt gtgccccaca caccatagct 1440 tcaaaatgtt tctactcctt ttttactctt ccagattttc tcggactccg cgcatcgccg 1500 taccacttca aaacacccaa gcacagcata ctaaattttc cctctttctt cctctagggt 1560 gtcgttaatt acccgtacta aaggtttgga aaagaaaaaa gagaccgcct cgtttctttt 1620 tcttcgtcga aaaaggcaat aaaaattttt atcacgtttc tttttcttga aatttttttt 1680 tttagttttt ttctctttca gtgacctcca ttgatattta agttaataaa cggtcttcaa 1740 tttctcaagt ttcagtttca tttttcttgt tctattacaa ctttttttac ttcttgttca 1800 ttagaaagaa agcatagcaa tctaatctaa gggcggtgtt gacaattaat catcggcata 1860 gtatatcggc atagtataat acgacaaggt gaggaactaa accatggcca agttgaccag 1920 tgccgttccg gtgctcaccg cgcgcgacgt cgccggagcg gtcgagttct ggaccgaccg 1980 gctcgggttc tcccgggact tcgtggagga cgacttcgcc ggtgtggtcc gggacgacgt 2040 gaccctgttc atcagcgcgg tccaggacca ggtggtgccg gacaacaccc tggcctgggt 2100 gtgggtgcgc ggcctggacg agctgtacgc cgagtggtcg gaggtcgtgt ccacgaactt 2160 ccgggacgcc tccgggccgg ccatgaccga gatcggcgag cagccgtggg ggcgggagtt 2220 cgccctgcgc gacccggccg gcaactgcgt gcacttcgtg gccgaggagc aggactgaca 2280 cgtccgacgg cggcccacgg gtcccaggcc tcggagatcc gtcccccttt tcctttgtcg 2340 atatcatgta attagttatg tcacgcttac attcacgccc tccccccaca tccgctctaa 2400 ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt tttatagtta 2460 tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg 2520 tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg 2580 ctttaatttg ctgcccgcag gcgggaaacc atccacttca cgagactgat ctcctctgcc 2640 ggaacgcgga tctcttatgt ctttacgatt tatagttttc attatcaagt 2690
Claims
1. A recombinant bacterium, characterized in that: The recombinant bacteria are produced by enhancing or strengthening the glutamate decarboxylase gene and pantothenic acid gene in the target brewer's yeast. β The expression levels of the alanine ligase gene and the pantothenic acid kinase gene were obtained from recombinant Saccharomyces cerevisiae.
2. The recombinant bacteria of claim 1, wherein: The glutamate decarboxylase is selected from any of the following proteins: A1) The amino acid sequence is that of the protein shown in Sequence 1 of the sequence listing; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); said pantoic acid beta alanine ligase is selected from any one of the following proteins: B1) The amino acid sequence is that of the protein shown in sequence 2 of the sequence listing; B2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1); The pantothenic acid kinase is selected from any of the following proteins: C1) The amino acid sequence is the protein shown in sequence 3 of the sequence listing; C2) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of C1).
3. The recombinant bacteria according to claim 1 or 2, characterized in that: The method of improving or enhancing the glutamate decarboxylase gene and pantothenic acid in the target brewing yeast. β The expression levels of alanine ligase gene and pantothenic acid kinase gene are related to the expression levels of genes containing glutamate decarboxylase and pantothenic acid ligase. β Expression cassettes for the alanine ligase gene and the pantothenic acid kinase gene were introduced into the target Saccharomyces cerevisiae.
4. The recombinant bacteria according to claim 3, characterized in that: The expression cassette is introduced into the ADH2 site of the alcohol dehydrogenase gene of the target Saccharomyces cerevisiae.
5. The recombinant bacteria of claim 3 or 4, wherein: The expression cassette is introduced into the target Saccharomyces cerevisiae to replace the alcohol dehydrogenase gene ADH2 of the target Saccharomyces cerevisiae with the expression cassette.
6. The recombinant bacteria according to claim 3, 4 or 5, characterized in that: The expression cassette contains the coding sequence of the glutamate decarboxylase gene and the pantothenic acid. β The coding sequence of the alanine ligase gene and the coding sequence of the pantothenic acid kinase gene.
7. The recombinant bacteria of claim 3, wherein: The expression cassette also contains a promoter sequence, which is sequence number 3194 of sequence 4 in the sequence list. The DNA molecule shown at nucleotide 3743, sequence 4, number 5522. The DNA molecule shown at position 5930 and sequence 4 at position 6881 The DNA molecule shown at position 7530.
8. According to claim 1 The recombinant bacteria according to any one of claims 4 is characterized in that: The expression cassette is the DNA molecule shown in sequence 4 of the sequence listing or 3194 of sequence 4 in the sequence listing. The DNA molecule shown at position 9034 nucleotides.
9. Enhance or strengthen the glutamate decarboxylase gene and pantothenic acid in Saccharomyces cerevisiae. β Application of substances that measure the expression levels of alanine ligase gene and pantothenic acid kinase gene in the preparation of squalene-producing recombinant Saccharomyces cerevisiae; The improvement or enhancement of the glutamate decarboxylase gene and pantothenic acid in Saccharomyces cerevisiae β The substances that determine the expression levels of the alanine ligase gene and the pantothenic acid kinase gene are any one of the following: E1) claim 3 The expression box as described in any of the 8 claims; E2) A recombinant vector containing the expression cassette described in E1); E3) Recombinant microorganisms containing the expression cassette described in E1) or recombinant microorganisms containing the recombinant vector described in E2).