Application of animal domestication behavior related rrm1 gene mutant
By detecting and editing the c.1020A>G mutation in the goat RRM1 gene, a docile animal model was constructed, which solved the problem of the lack of research on docile genes in the domestication process of domesticated animals in the existing technology, and realized a simple and effective mutation detection and animal behavior improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2023-03-06
- Publication Date
- 2026-06-26
AI Technical Summary
Current technologies have limited research on genes related to animal stress behavior and the analysis of their genetic mechanisms. In particular, there are few reports on functional genes that determine docility during the domestication of domesticated animals, and no effective methods for identifying gene mutations have been found.
By detecting the c.1020A>G mutation in the goat RRM1 gene, the genotype at position 1020 of the CDS region of the RRM1 gene was identified using PCR amplification and sequencing methods. A docile animal model was constructed using CRISPR/Cas9 gene editing, and a mouse model containing the c.1020A>G mutation in the RRM1 gene was prepared.
This study revealed the correlation between the c.1020A>G mutation in the RRM1 gene and animal tameness behavior, validated its role as a safe gene editing target for generating docile animal models, and achieved simple and effective mutation detection and model preparation, significantly reducing animal stress response.
Smart Images

Figure BDA0004110716460000031 
Figure BDA0004110716460000041 
Figure HDA0004110716470000011
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular breeding and genetic engineering, and relates to the detection and functional verification of RRM1 gene mutants related to animal domestication behavior. Background Technology
[0002] Stress response refers to the various physiological and behavioral changes animals undergo in response to external or internal stimuli, evolving to better survive in the face of threats. However, severe stress responses can damage the physical and mental health of animals. In livestock and poultry, severe stress responses can cause nutritional metabolic disorders, immune dysfunction, organ damage, and even death. Therefore, the discovery and verification of genes related to animal stress behavior is particularly important; however, current understanding of the genes and genetic mechanisms related to animal stress behavior is very limited.
[0003] For stress responses, a good animal model exists in nature: domesticated animals. Domesticated animals undergo a transformation from wild to domesticated, a process involving changes in their environment, physiology, and behavior, resulting in populations that can reproduce and survive normally and are completely different from their wild ancestors. During domestication, wild animals are forced into captivity by humans, living in confined and restricted environments while facing the pressure of human management. Therefore, reducing fear of humans and adapting to captive environments are essential for domesticated animals; for example, dogs are less aggressive than wolves, and cattle and sheep are less afraid of humans than their wild relatives. However, to date, few functional genes determining the docile nature of animals during domestication have been reported.
[0004] The ribonuclease catalytic subunit M1 gene (RRM1) encodes the ribonuclease subunit, an enzyme essential for converting ribonucleic acid (RNA) to deoxyribonucleic acid (DNA). Previous studies have shown that the RRM1 gene is one of the most potent domestication genes in goats. Furthermore, genome-wide association studies have shown a significant association between the RRM1 gene and attention deficit hyperactivity disorder (ADHD) and disruptive behavior disorder (DBD). However, there are currently no reports of studies on the effects of the RRM1 gene on animal behavior changes, nor are there any reports of studies identifying effective gene mutations through analysis of domesticated animals and their wild counterparts. Summary of the Invention
[0005] The purpose of this invention is to provide an application of an RRM1 gene mutant related to animal domestication behavior.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for detecting the RRM1 gene c.1020A>G mutation includes the following steps:
[0008] Using the genomic DNA of the animal to be tested as a template, a partial fragment of the RRM1 gene was amplified by PCR. Then, the genotype corresponding to the 1020th position of the CDS region of the RRM1 gene in the amplified fragment was identified. The 1020th position of the CDS region of the RRM1 gene is located at chr15:32335551 on the goat reference genome (GCF_001704415.1).
[0009] Preferably, the animal to be tested is a goat or a sheep.
[0010] Preferably, the animals to be tested are collected from wild goats, domestic goats, or hybrid goat populations with wild goat lineage.
[0011] Preferably, the PCR amplification primer pair is:
[0012] Upstream primer: 5′-AATGGGAGACAGTTGGTAA-3′
[0013] Downstream primer: 5′-GAATTGTGGGAATGAAGAT-3′.
[0014] Preferably, the PCR reaction system includes 1 μL of 10 μmol / L upstream primer, 1 μL of 10 μmol / L downstream primer, and 500 ng of genomic DNA.
[0015] Preferably, the PCR reaction program is as follows: pre-denaturation at 94.0℃ for 2 min; denaturation at 94.0℃ for 30 s, annealing at 60.0℃ for 30 s, extension at 68.0℃ for 30-60 s, for 34 cycles.
[0016] Preferably, the genotype at position 1020 of the CDS region of the RRM1 gene is identified by direct sequencing (e.g., Sanger sequencing) and based on the sequencing results.
[0017] The above-mentioned detection method for the RRM1 gene c.1020A>G mutation is applied in marker-assisted selection breeding of domesticated animals.
[0018] Preferably, the domesticated animal is a goat or a sheep.
[0019] Preferably, individuals with the GG genotype among the domesticated animals exhibit a reduced stress response.
[0020] A detection kit for the c.1020A>G mutation in the RRM1 gene, comprising primer pairs, such as the upstream and downstream primers described above, for PCR amplification of a partial fragment of the RRM1 gene corresponding to position 1020 of the CDS region of the RRM1 gene.
[0021] Preferably, the kit further includes reagents for amplifying fragment sequencing.
[0022] A kit for preparing docile animal models includes a donor and a gRNA expression vector. The gRNA expression vector includes gRNA for guiding Cas9 protein to cleave a region within the RRM1 gene containing the 1020th position of the CDS region of the RRM1 gene. The donor includes an RRM1 gene homologous sequence for introducing the mutant base G corresponding to the 1020th position of the CDS region of the RRM1 gene into the animal genome via homologous recombination. The 1020th position of the CDS region of the RRM1 gene is located at chr15:32335551 on the goat reference genome (GCF_001704415.1).
[0023] Preferably, the kit also includes Cas9 mRNA.
[0024] Preferably, the docile animal model is a mouse model containing the RRM1 gene c.1020A>G mutation and the genotype of the corresponding mutation site is GG.
[0025] Preferably, the GG genotype increases the taming behavior of mice and inhibits their fear behavior.
[0026] A method for preparing a docile animal model includes the following steps:
[0027] An animal model with a reduced stress response phenotype containing the c.1020A>G mutation in the RRM1 gene was constructed by editing the CDS region at position 1020.
[0028] Preferably, the docile animal model is a mouse model containing the RRM1 gene c.1020A>G mutation and the genotype of the corresponding mutation site is GG.
[0029] The beneficial effects of this invention are reflected in:
[0030] This invention reveals the correlation between the RRM1 gene c.1020A>G mutation and animal taming behavior, and verifies that the RRM1 gene c.1020A>G mutation can serve as a safe gene editing target for generating docile animal models.
[0031] Furthermore, the detection kit and detection method based on PCR amplification and sequencing of the present invention can easily and effectively detect RRM1 gene mutations. Attached Figure Description
[0032] Figure 1 This is an amplified sequencing image of the RRM1 gene fragment (containing the c.1020A>G mutation site) from a hybrid individual with wild goat lineage.
[0033] Figure 2 A bar chart showing the statistical results of the goat behavior experiment (Flight Distance test).
[0034] Figure 3 The results of the association analysis between the goat RRM1 gene c.1020A>G mutation (c.1020A>G mutation site located at GCF_001704415.1chr15:32335551) and goat flight distance.
[0035] Figure 4 This is a sequence diagram of the amplified RRM1 gene fragment from a mouse model with the c.1020A>G mutation in the RRM1 gene.
[0036] Figure 5 The statistical results of mouse taming behavior. Detailed Implementation
[0037] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are only used to explain the present invention and are not intended to limit the scope of protection of the present invention.
[0038] (I) Identification of causal variations in goat domestication
[0039] First, the whole genome resequencing data of 210 modern domestic goats of different breeds and 24 wild goats (see Table 1) were aligned to the goat reference genome (GCF_001704415.1) using BWA-MEM software.
[0040] Table 1. Sample Information Table
[0041]
[0042]
[0043] Next, genetic variations were filtered and obtained using ANGSD software, and variation-related genes were annotated using ANNOVAR. The filtering criteria were as follows:
[0044] 1) Retain sites whose sequencing depth is between 1 / 3 and 3 times the sum of the average depths of all samples, remove sites with a minimum allele frequency <1 / 2n (where n is the total number of SNPs), and retain sites with a p-value <1×10⁻⁶. -6 The mutation sites;
[0045] 2) Only SNPs are retained (indels are removed), SNPs with a deletion rate higher than 10% are removed, and multi-allelic loci are removed.
[0046] Then, selection analysis (including FST, π, and XP-EHH, etc.) was performed using VCFtools and SweeD software. The results showed that the RRM1 gene is one of the strongest selected genes in goat domestication. The selection analysis was performed on the whole genome with a sliding window of 20kb step size and 50kb size.
[0047] Finally, through ancient genomics and comparative genomics analysis, the c.1020A>G mutation in the RRM1 gene (c.1020A>G mutation site located at GCF_001704415.1chr15:32335551) was identified as the causative variant. The analyzed SNPs exhibited the following characteristics: 1) they were completely absent in wild goat populations; 2) their frequency was >0.96 in modern domestic goats.
[0048] (II) Association analysis between RRM1 gene mutation and goat domestication behavior
[0049] 2.1 Whole-genome sequencing and mutation site typing verification of goat samples
[0050] The experiment used hybrid individuals of Siberian ibex (Capra sibirica) and Xinjiang cashmere goats (Capra hircus) raised on a ranch in Karamay, Xinjiang. The sires of the Siberian ibex on this ranch were sourced from the Xinjiang Tianshan Wildlife Park. Specifically, blood samples were collected from 16 healthy female hybrid goats aged 4-6 years (Karamay, Xinjiang, March 2018). The blood samples were preserved in heparin anticoagulant tubes and mailed to Shanghai Sangon Biotech Co., Ltd. for genome sequencing (resequencing results were used for association analysis). In addition, whole-genome DNA was extracted from a portion of the blood samples using the standard phenol-chloroform method. The extracted DNA was quality-tested using an Agilent 2100 Bioanalyzer; then PCR amplification was performed, and the PCR products were directly sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to genotype the c.1020A>G mutation site in the RRM1 gene. Figure 1 The required MIX for PCR is AccuPrime. TMTaq high-fidelity DNA polymerase (purchased from Thermo Fisher Scientific), and the required primers were synthesized by Shanghai Sangon Biotech Co., Ltd. The specific primer sequences, reaction system, and PCR reaction procedure are as follows:
[0051] The PCR amplification primer pair is:
[0052] Upstream primer F1: 5′-AATGGGAGACAGTTGGTAA-3′
[0053] Downstream primer R1: 5′-GAATTGTGGGAATGAAGAT-3′
[0054] Reaction system: 10×AccuPrime TM PCR Buffer II 5 μL, upstream primer 1 μL (10 μmol / L), downstream primer 1 μL (10 μmol / L), genomic DNA template 500 ng, AccuPrime TM Add 0.2 μL of Taq DNA Polymerase to a final volume of 50 μL with water.
[0055] The PCR reaction program was as follows: 94.0℃ pre-denaturation for 2 min; 94.0℃ denaturation for 30 s, 60.0℃ annealing for 30 s, 68.0℃ extension for 35 s, for 34 cycles.
[0056] 2.2 Flight Distance test was used to test the domestication behavior of goats.
[0057] Prior to the test, all the test goats (i.e., the aforementioned 16 hybrid goats) were kept in separate enclosures (4.4m × 18.9m) for three weeks and provided with their own exercise area (16.4m × 18.9m). The test was conducted in adjacent enclosed enclosures where goats had never been previously kept. To improve the reliability of the data, the entire test was conducted in a double-blind, controlled-variable manner for three consecutive days in mid-March 2018 by two researchers who had never been in contact with the goats. The researchers wore coats of the same color and style (white lab coats) for each test, and the order of the test animals was randomly assigned each day.
[0058] After the test began, the test goats were allowed one minute to acclimatize, with the experimenter standing seven meters away. Then, an experimenter approached the goat from the front, maintaining eye contact and keeping their arm and hand close to their body. When the goat retreated at least two steps or ran away from either side, the distance between the goat's foreleg and the experimenter's foot before the behavior was measured using a measuring tape; this distance was recorded as the Flight Distance. The goats were then returned to another enclosure, and the next goat was brought to the same enclosure for testing. Measurements were repeated six times for each goat throughout the day. For each goat, the four remaining measurements, after removing the maximum and minimum values, were used for subsequent analysis.
[0059] 2.3 Genome-wide association analysis of domestication behavior
[0060] In the association analysis between the RRM1 gene c.1020A>G mutation and the domestication behavior of hybrid goats, the genotypic data of the mutation site were obtained from the whole-genome resequencing results of hybrid individuals, and the phenotypic data were obtained from the statistical results (mean and standard deviation) after the Flight Distance test. Figure 2 and Figure 3 As shown, the RRM1 gene c.1020A>G mutation is significantly associated with domestication behavior during goat domestication, and goat individuals with the GG genotype at the corresponding mutation site have a significantly reduced stress response (i.e., exhibit docility) compared to goat individuals with the AG genotype.
[0061] (III) Using RRM1 gene mutants to prepare docile animal models of different species
[0062] For the mutations related to domestication behavior that were screened and identified (i.e., the above-mentioned RRM1 gene c.1020A>G mutation), the occurrence of the corresponding site mutation will lead to a missense mutation (p.241:I>V) in the eighth exon of the RRM1 gene. Therefore, by constructing mice with the RRM1 gene c.1020A>G mutation in their genome, the function of the corresponding mutant was investigated.
[0063] Based on the RRM1 gene information in NCBI, the donor sequence (i.e., donor oligo) and gRNA sequence required for CRISPR / Cas9 were designed and synthesized respectively:
[0064] M-Rrm1-AtG-oligo:
[0065] 5′-gatgacagcattgaaggaatttatgatactctgaagcagtgtgccttgGtttctaagtccgctgggggaattggtgttgctgtg attgtattc-3′
[0066] M-RRM1-EA-gRNA up: 5′-TAGGCCTTGATTTCTAAGTCCGC-3′
[0067] M-RRM1-EA-gRNA down: 5′-AAACGCGGACTTAGAAATCAAGG-3′
[0068] Then, Cas9 mRNA, a gRNA expression vector constructed using the gRNA sequence, and the donor sequence were injected into the fertilized eggs of C57BL / 6J mice (Zhaoqing Huaxia Kaiqi Biotechnology Co., Ltd.) to generate gene-edited mice (F0) containing the RRM1 gene c.1020A>G mutation. F0 mice were then crossed with C57BL / 6J mice to produce F1 mice. These F1 mice were then self-crossed to produce mice with homozygous wild-type (AA), heterozygous (AG), and homozygous mutant (GG) mutations at the corresponding sites. The mouse genotype identification method is as follows:
[0069] Genome DNA was extracted from mouse tail tissue using the phenol-chloroform method, and the quality of the extracted DNA was tested using an Agilent 2100 Bioanalyzer. PCR amplification was then performed, and the PCR products were directly sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. This allowed for genotyping of the c.1020A>G mutation site in the mouse RRM1 gene (specific primer sequences are shown below; the reaction system and PCR procedure were the same as above, and the results are as follows). Figure 4 (As shown).
[0070] The PCR amplification primer pair is:
[0071] Upstream primer F2: 5′-GAGTTCAGTTCCCAGCAACC-3′
[0072] Downstream primer R2: 5′-CCTCCTACTCACACCAACAGG-3′
[0073] Behavioral tests were then conducted on mice with homozygous wild-type (AA) and homozygous mutant (GG) genotypes. The tests included the Active tame test, Passive tame test, and Stay-on-hand test. In the Active tame test, the mouse was placed in an empty box, and the experimenter held their hand close to the mouse, maintaining a distance of 10 cm while slightly moving their finger, so the mouse perceived the finger as a moving object. The entire test lasted 1 minute, and the mouse's Heading time, Contacting time, and Locomotion were recorded. After the Active tame test, the Passive tame test was performed. The experimenter held their finger close to the mouse and gently touched it, maintaining contact as much as possible throughout the test. This test also lasted 1 minute, and the mouse's Heading time, Accepting time, and Locomotion were recorded. After the Passive tame test, the Stay-on-hand test was performed. The experimenter gently placed the mouse in their hand and lightly stroked its back with their thumb, recording the time the mouse remained in their hand. All experiments were recorded and analyzed by ANY-Maze. The comparison results between GG genotype mice and AA genotype mice are as follows: Figure 5 As shown, the GG genotype significantly increases docile behavior and suppresses fear behavior in mice, therefore, GG genotype mice can be used as docile animal models.
[0074] In summary, this invention, through the identification of missense mutation sites and functional analysis of the RRM1 gene, revealed that the RRM1 gene c.1020A>G mutation is associated with goat domestication behavior using multi-omics and behavioral methods. Combined with behavioral analysis of mice with the corresponding mutant gene, it was determined that the RRM1 gene c.1020A>G mutation can increase animal domestication behavior and has broad-spectrum effects across species.
Claims
1. A kind RRM1 The application of a method for detecting gene c.1020A>G mutations in marker-assisted selection breeding of domesticated animals is characterized by: The RRM1 The detection method for gene c.1020A>G mutation includes the following steps: Using the genomic DNA of the animal to be tested as a template, PCR amplification was performed. RRM1 A partial fragment of the gene, and then the amplified fragment containing... RRM1 The genotype at position 1020 of the gene's CDS region was identified. RRM1 The 1020th position of the gene's CDS region is located at chr15: 32335551 on the goat reference genome GCF_001704415.1; the domesticated animal is a goat. Individuals with the GG genotype among the domesticated animals exhibited a reduced stress response.
2. A kit for preparing docile animal models, characterized in that: The kit includes a donor and a gRNA expression vector, the gRNA expression vector comprising a component for guiding Cas9 protein pairs containing... RRM1 The 1020th position of the gene's CDS region RRM1 gRNAs that are used to cut gene regions, with donors including those for... RRM1 The mutated base G at position 1020 of the gene's CDS region was introduced into the animal genome via homologous recombination. RRM1 Gene homologous sequences; RRM1 The 1020th position of the gene's CDS region is located at chr15: 32335551 on the goat reference genome GCF_001704415.1; The donor sequence is: 5′- gatgacagcattgaaggaatttatgatactctgaagcagtgtgccttggtttctaagtccgctgggggaattggtgttgctgtgattgtattc -3′; The sequence of the gRNA is as follows: M-RRM1-EA-gRNA up: 5′-TAGGCCTTGATTTCTAAGTCCGC -3′ M-RRM1-EA-gRNA down: 5′- AAACGCGGACTTAGAAATCAAGG -3′; The docile animal model contains RRM1 A mouse model with gene c.1020A>G mutation and genotype GG at the corresponding mutation site.
3. The kit for preparing docile animal models according to claim 2, characterized in that: The kit also includes Cas9 mRNA.
4. A method for preparing a docile animal model, characterized in that: Includes the following steps: Through the RRM1 Gene editing was performed at position 1020 of the gene's CDS region to construct a gene containing... RRM1 An animal model with a gene c.1020A>G mutation and a reduced stress response phenotype, wherein... RRM1 The 1020th position of the gene's CDS region is located at chr15: 32335551 on the goat reference genome GCF_001704415.1; The containing RRM1 The construction of an animal model with a c.1020A>G gene mutation and a reduced stress response phenotype specifically includes the following steps: injecting Cas9 mRNA, a gRNA expression vector constructed using gRNA sequences, and a donor into the fertilized eggs of wild-type mice to produce a gene containing... RRM1 Gene-edited mice with the c.1020A>G mutation, i.e., F0 mice, are used to cross F0 mice with wild-type mice to produce F1 mice. These F1 mice are then self-crossed to produce mice with homozygous wild-type AA, heterozygous AG, and homozygous mutant GG mutations at the corresponding sites. The docile animal model refers to mice containing... RRM1 Mouse models with gene c.1020A>G mutation and corresponding mutation site genotype GG exhibit significantly reduced stress response, i.e., are docile. The donor sequence is: 5′- gatgacagcattgaaggaatttatgatactctgaagcagtgtgccttggtttctaagtccgctgggggaattggtgttgctgtgattgtattc -3′; The sequence of the gRNA is as follows: M-RRM1-EA-gRNA up: 5′-TAGGCCTTGATTTCTAAGTCCGC -3′ M-RRM1-EA-gRNA down: 5′- AAACGCGGACTTAGAAATCAAGG -3′.