Molecular markers, primers, PCR methods and their applications for identifying reproductive failure in geese

Abstract

The present invention belongs to the field of biotechnology, and discloses a molecular marker for identifying geese with reproductive disorders, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; the molecular marker is located on chromosome 3 of the goose, wherein the reference genome of the goose is PRJNA813978. The molecular marker has a high directivity for reproductive disorders of the goose. The present invention also provides a primer pair for amplifying the molecular marker, a PCR amplification method and an application.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a molecular marker, a primer, a PCR method and an application for identifying goose reproductive disorders. Background Art

[0002] The low egg production of geese has always been the biggest problem restricting the development of the industry. Due to the limitation of the ground-based feeding method of geese, it has been impossible to record the individual egg production of geese in the past, and the egg production of geese can only be selected based on the family lineage. With the transformation and upgrading of goose feeding methods, the feeding method of geese has gradually transitioned from flat feeding to individual cage feeding, and the individual egg production records of geese have been recorded. However, the results of previous studies have shown that about 10% of the individuals in the group at around 365 days of age have not yet started laying eggs, and they define these individuals as individuals with reproductive disorders. The emergence of geese with reproductive disorders has increased the cost of breeding and greatly reduced the egg production level and benefits of the group. Therefore, it is particularly important to identify and eliminate geese with reproductive disorders in the early stages of breeding.

[0003] "Goose Reproduction Obstacles and Countermeasures", written by Zhou Guangfu and others, the article states that the most important solution to goose reproduction obstruction is to select goose breeds properly. The method proposed is to select goose breeds through natural methods such as breeding and observation.

[0004] However, the genes of geese are very likely to mutate from one generation to the next. If geese with reproductive disorders can be accurately screened out at the gosling stage, it will significantly reduce the breeding cost and improve the overall egg-laying efficiency of geese.

[0005] The applicant developed a method for identifying Sichuan white geese using ISSR markers in 2003. After years of research, we believe that it is feasible to screen for reproductive disorders in geese through genetic means.

[0006] However, in the process of analyzing goose reproductive disorders based on whole genome sequencing technology, the following difficulties were encountered:

[0007] In the hybrid F2 population of Sichuan white geese and Landes geese, individual egg laying records of 236 geese were collected until the geese were 365 days old. Blood or tissues of each goose were collected and placed in liquid nitrogen, and then transferred to a -80℃ refrigerator for storage. Genomic DNA was extracted from blood or tissues of each breed using the DNeasy blood and tissue kit. The quality of DNA was evaluated using Agilent2200TapeStation, Qubit 2.0 fluorometer and agarose gel electrophoresis. According to the manufacturer's instructions, a double-end library with an insert size of 350 bp was constructed using the TruSeq library construction kit and sequenced on the IlluminaNovaSeq6000 platform. The raw reads obtained by sequencing were first tested using FastQC software. According to the quality of the raw data, the raw sequencing data was quality controlled using the NGS QC Toolkit tool to remove residual primer and adapter sequences, and the base sequencing quality of each sequencing read with less than 70% of the bases above 20 was also removed. The quality-controlled data were then tested using FastQC software. Subsequently, the quality-controlled data were aligned to the Sichuan white goose reference genome (version number: PRJNA813978) using the 'bwa-k 40-M-R' parameters of the BWA-MEM software. The obtained SAM file was converted into the BAM format using the SAMtools software, and unmapped and non-uniquely mapped reads were filtered. The acquisition of variation information was carried out according to the best practice workflow recommended by the GATK (v4.1.7.0) software. A total of 25,212,504,941 original reads were obtained in the present invention, with an average sequencing depth of 25.95× for each sample and an average alignment rate of 99.71%. These data had 97.49% and 89.28% data coverage of the genome 1× and 4×, respectively. Through data analysis, a total of 12,515,997 SNP sites and 1,344,581 gain and loss positions (Indels) were obtained.

[0008] It becomes particularly difficult to further screen sequences indicating reproductive disorders in geese from such a large number of SNP sites and gain-loss sites.

[0009] The technical problem solved in this case is: how to screen and obtain a more accurate sequence as a molecular marker to indicate reproductive disorders in geese. Summary of the invention

[0010] In view of the shortcomings of the prior art, the object of the present invention is to provide a molecular marker that is highly targeted at reproductive disorders in geese.

[0011] The invention also provides a primer pair for amplifying the molecular marker, a PCR expansion method and an application.

[0012] To achieve the purpose of the invention, the present invention adopts the following technical scheme: a molecular marker for identifying geese with reproductive disorders, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.3; the molecular marker is located on chromosome 3 of the goose, wherein the reference genome of the goose is PRJNA813978.

[0013] Meanwhile, the present invention also discloses a primer for amplifying the molecular marker as described above, and the nucleotide sequence of the primer is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0014] In addition, the present invention also discloses a PCR method, which adopts the primers as mentioned above and takes goose genome DNA as a template to amplify gene fragments.

[0015] In the above-mentioned PCR method, the steps are as follows:

[0016] S1: Extract genomic DNA from the goose to be tested;

[0017] S2: Using the goose genomic DNA extracted from S1 as a template, PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2;

[0018] S3: Sequence and identify the product amplified in S2.

[0019] In the above PCR method, the amplification system and procedure of S2 are as follows:

[0020] The total volume of the PCR amplification reaction system was 25 μL, including 1 μL of each of the primers shown in SEQ ID NO.1 and SEQ ID NO.2 with a concentration of 10 μM, 1 μL of DNA template, 12.5 μL of 2×Rapid Taq Master Mix, and 9.5 μL of ddH2O;

[0021] PCR amplification reaction procedure:

[0022] Step 1: 95°C for 3 minutes;

[0023] Step 2: 95℃ for 15 seconds;

[0024] Step 3: 60℃ for 15 seconds;

[0025] Step 4: 72°C for 18 seconds;

[0026] Steps 2-4 were repeated for 35 cycles, followed by step 5;

[0027] Step 5: React at 72°C for 5 min.

[0028] Finally, the present invention also discloses a use of any of the above methods to determine the risk of reproductive failure in geese.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention uses the provided primers to perform PCR amplification on the geese's genome DNA to be tested, and based on the amplification result, it can be determined whether the goose to be tested has a reproductive disorder. The result can be determined by the presence or absence of the amplification product or the specific sequence. This method can efficiently and accurately identify geese with reproductive disorders, and has significant application value in goose breeding, and is particularly useful for the identification and screening of geese with reproductive disorders, providing a reliable reference for goose breeding. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0032] Example 1

[0033] In the hybrid F2 population of Sichuan white geese and Landes geese, individual egg laying records of 236 geese were collected until the geese were 365 days old. Blood or tissues of each goose were collected and placed in liquid nitrogen, and then transferred to a -80℃ refrigerator for storage. Genomic DNA was extracted from blood or tissues of each breed using the DNeasy blood and tissue kit. The quality of DNA was evaluated using Agilent2200TapeStation, Qubit 2.0 fluorometer and agarose gel electrophoresis. According to the manufacturer's instructions, a double-end library with an insert size of 350 bp was constructed using the TruSeq library construction kit and sequenced on the IlluminaNovaSeq6000 platform. The raw reads obtained by sequencing were first tested using FastQC software. According to the quality of the raw data, the raw sequencing data was quality controlled using the NGS QC Toolkit tool to remove residual primer and adapter sequences, and the base sequencing quality of each sequencing read with less than 70% of the bases above 20 was also removed. The quality-controlled data were then tested using FastQC software. Subsequently, the quality-controlled data were aligned to the Sichuan white goose reference genome (version number: PRJNA813978) using the 'bwa-k 40-M-R' parameters of the BWA-MEM software. The obtained SAM file was converted into the BAM format using the SAMtools software to map the results and filter out unmapped and non-uniquely mapped reads. The acquisition of variation information was performed according to the best practice workflow recommended by the GATK (v4.1.7.0) software. A total of 25,212,504,941 original reads were obtained in the present invention, with an average sequencing depth of 25.95× for each sample and an average alignment rate of 99.71%. These data had 97.49% and 89.28% coverage of the genome 1× and 4×, respectively. Through data analysis, a total of 12,515,997 SNP sites and 1,344,581 Indels were obtained.

[0034] The genome-wide association study (GWAS) was performed using the LM procedure implemented in the genome-wide efficient mixed-model association (GEMMA) software. The Manhattan plot and QQ plot of the GWAS results were visualized using the qqman package in R software. P < 10-7 was set as the threshold for significant and potential association with the trait, respectively, and the variant information was annotated to the gene name. As shown in Table 1, there were 8 SNP sites that achieved significant association, which were annotated to the relevant regions of the mcph1, DYM, SLC10A2, and ZNF451 genes. There was only one indel site that achieved significant association, which was annotated to the intron region of the ZNF451 gene.

[0035] The intersection of the candidate genes screened by the above two different methods revealed that only the ZNF451 gene was screened by both methods. The significant markers in the bag2 gene are all located in the Chr3:96567626-96568859 region, and this region belongs to a linked region, that is, theoretically, CHR3:96567626, CHR3:96567841, CHR3:96568092, CHR3:96568859, and CHR3:96568856 all have the same reproductive disorder indication function. CHR3snp96567626 located on the exon may have the most obvious function.

[0036] The loci significantly associated with reproductive disorders in geese and their annotations are shown in Table 1;

[0037] Table 1 Loci significantly associated with reproductive disorders in geese and their annotations

[0038]

[0039] Take CHR3:96567626 as an example to explain the mutation location. CHR3 represents the third chromosome of the goose, and 96567626 represents the location of the mutation.

[0040] According to the mutation site of the above marker, molecular marker primers F and R that can specifically identify the site information through PCR amplification were developed, and the specific sequences are shown below. The goose reproductive disorder was identified by the primers (F and R), and PCR amplification was performed using goose genomic DNA as a template. When the nucleotide sequence of the amplified product is as shown in SEQ ID NO.3, it indicates that the identified goose has a reproductive disorder; when the nucleotide sequence of the amplified product is different from SEQ ID NO.3, it indicates that the identified goose does not have a reproductive disorder. At the same time, the fragment of the nucleotide sequence as shown in SEQ ID NO.3 can be used as a molecular marker. By identifying the presence or absence of the molecular marker, it can be used to identify whether the goose to be tested has a reproductive disorder. It has significant application value in goose breeding, especially for the identification and screening of geese with reproductive disorders. In the sequence of the molecular marker (SEQ ID NO.3), the 1bp in bold and underlined is a mutation site. When the 1bp of this site in the gene mutates, it means that the risk of the goose being detected being a goose with reproductive disorders is high.

[0041] The specific primers are (5'→3'):

[0042] F(SEQ ID NO.1): CAAAACACATAGTAAGACCAGCC;

[0043] R(SEQ ID NO.2):CAGAGGAAGATGCAGAATTAGAAG;

[0044] Molecular marker (SEQ ID NO.3):

[0045] CAAAACACATAGTAAGACCAGCCTACTAATTAGGCAACAACTTATACAACTAGACTGGTGAGACTTAGTCATCACCCGCCAGAAACAGAAAATGAAAAGACTTTAAAATTTATTCTTATCATACACAATATATTGCAGCAGATATCCATAAACTCCAGCTGTTCATC AGCACGACAGAGAATGTAAGATTATAAATCTAACAATTCAAGATACAGACATGTTTTTGAAGCAGTATTTCTAAACCTTTGTAAATAGATGAACAAGCTTCCATTTTTGTGAGCAGCTTTGATGACATGGTGTTAGTGTATGGAAGTATCTTCATTTACATCTCCTCG G GGCTTCTCTTGATAGCTTCTTCTAATTCTGCATCTTCCCTCTG;

[0046] In SEQ ID NO. 3, the underlined nucleotides are the mutation positions of the mutant nucleotides.

[0047] Blood or tissues were collected from geese with individual egg-laying records for DNA extraction. The extracted DNA was used as a template to perform PCR amplification using the primers developed above according to the PCR amplification system shown in Table 2 and the PCR amplification program shown in Table 3, and then the genotype was determined after sequencing using Sanger sequencing. The genotype of the marker was used to identify and eliminate geese with reproductive disorders at an early stage, and the proportion of reproductive disorders in the group decreased by 6.33% (from 20.34% to 14.01%) after 365 days of age.

[0048] Table 2 PCR amplification reaction system

[0049]

[0050]

[0051] Table 3 PCR amplification reaction program

[0052]

[0053] In summary, the molecular markers, molecular marker primers and detection methods provided by the present invention can efficiently and accurately identify whether the identified goose has reproductive disorders, which has significant application value in goose breeding, and is particularly useful for the early identification and screening of geese with reproductive disorders, providing a reliable reference for goose breeding.

[0054] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A PCR method for determining the risk of reproductive failure in geese, characterized in that: The PCR method is: using primers and goose genomic DNA as a template to amplify gene fragments; the nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.2; When the nucleotide sequence of the amplified product is as shown in SEQ ID NO.3, it indicates that the identified goose has a reproductive disorder; when the nucleotide sequence of the amplified product is different from SEQ ID NO.3, it indicates that the identified goose does not have a reproductive disorder; The reproductive disorder of the goose means that if an individual does not start laying eggs at 365 days of age, the individual is identified as an individual with reproductive disorder.

2. The use according to claim 1, characterized in that: The PCR method comprises the following steps: S1: Extract genomic DNA from the goose to be tested; S2: Using the goose genomic DNA extracted from S1 as a template, PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO.1 and SEQ ID NO.2; S3: Sequence and identify the product amplified in S2.

3. The use according to claim 2, characterized in that: The amplification system and procedure of S2 are as follows: The total volume of the PCR amplification reaction system was 25 µL, including 1 µL of each of the primers shown in SEQ ID NO.1 and SEQ ID NO.2 at a concentration of 10 µM, 1 µL of DNA template, 12.5 µL of 2× Rapid Taq Master Mix, and 9.5 µL of ddH2O; PCR amplification reaction procedure: Step 1: 95°C for 3 minutes; Step 2: 95℃ for 15 seconds; Step 3: 60℃ for 15 seconds; Step 4: 72°C for 18 seconds; Steps 2-4 were repeated for 35 cycles, followed by step 5; Step 5: React at 72°C for 5 min.

Images