Hybridoma cell strain secreting anti-fish cd28 monoclonal antibody and its application

By preparing and purifying the hybridoma cell line 1B6A2, which contains an anti-fish CD28 monoclonal antibody, the problem of the lack of tools for activating fish T cells was solved. This enabled the in vitro simulation of a second signal to activate T cells and promote their proliferation, providing an effective tool for adaptive immune responses and disease control in fish.

CN116355861BActive Publication Date: 2026-02-10EAST CHINA NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310436759.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-05-06
Filing Date
2023-04-21
Publication Date
2026-02-10
Estimated Expiration
2043-04-21

AI Technical Summary

Technical Problem

Currently, there is a lack of effective activation tools in fish T cell research, especially for simulating T cell activation and proliferation in vitro. Furthermore, the regulatory mechanism of CD28 molecules in Nile tilapia is unclear, which affects research on its adaptive immune response.

Method used

A hybridoma cell line 1B6A2 that secretes a monoclonal antibody against fish CD28 was provided. The monoclonal antibody against the fish T lymphocyte surface membrane protein CD28 was prepared and purified by lentivirus-mediated expression of the fish CD28 gene and used to mimic the second signal to activate fish T cells.

Benefits of technology

A monoclonal antibody that specifically recognizes and binds to the CD28 protein in fish was successfully prepared. It can mimic the second signal to activate T cells in vitro and promote their proliferation, providing a tool for studying adaptive immune responses in fish and can be applied to the development of fish disease prevention and control reagents and vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116355861B_ABST
    Figure CN116355861B_ABST
Patent Text Reader

Abstract

The application relates to a hybridoma cell strain 1B6A2 secreting an anti-fish T lymphocyte surface membrane protein CD28 monoclonal antibody, the hybridoma cell strain 1B6A2 is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: C202291, and the preservation date is May 5, 2022. The application provides a powerful tool for simulating a second signal in vitro and exploring a CD28-mediated T cell adaptive immune response mechanism.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of fish immunology and disease prevention and control, and relates to a hybridoma cell strain secreting a monoclonal antibody against fish T lymphocyte surface membrane protein CD28, a monoclonal antibody and a preparation method thereof, and application of the monoclonal antibody in adaptive immunity of bony fish. BACKGROUND

[0002] T cells are executors of adaptive immune response, and participate in response and clearance of pathogens through processes such as release of effector factors, assistance of B cells to produce antibodies, and killing of target cells. Activation of T cells requires co-stimulation of first and second signals: the first signal is a specific stimulation signal generated by combination of CD3 / TCR and MHC-antigen peptide complex on the surface of APC; the second signal (co-stimulation signal) is the interaction of B7 family ligand (CD80 / CD86) on the surface of APC with T cell surface co-stimulatory molecule CD28, and the first and second signals start different signal pathways. Higher vertebrate CD28 is a member of immunoglobulin superfamily, and is composed of extramembrane functional region Ig structure, transmembrane region and intracellular region with signal motif. Although Chinese patent application 202011478707.5, “Preparation method and application of anti-tilapia T lymphocyte surface membrane protein CD3 epsilon monoclonal antibody” relates to a preparation method of T lymphocyte surface membrane protein CD3 epsilon monoclonal antibody, it needs to be noted that although CD28 is similar in structure to CD3 epsilon, CD28 mediates different downstream signals and immune events, such as driving biological events of immune synapse, downstream phosphorylation and post-translational modification, transcription change and cytoskeleton remodeling, and production of key cytokines, chemokines and survival signals, which are essential for long-term expansion and differentiation of T cells. In addition, CD28 signal can also regulate metabolism, such as increasing glycolysis rate to produce energy required for proliferation. The second signal mediated by CD28 is triggered by the first signal and guides amplification of CD3-TCR signal, reduces the TCR threshold for its cross-linking with MHC-polypeptide, and if the synergistic stimulation signal provided by the co-stimulatory molecule is lacking, T cells cannot be fully activated. The absence of the second signal leads to transcriptional inactivation of many genes, especially the gene encoding IL-2, resulting in inability of T cells to proliferate and differentiate, and even apoptosis. In addition, blocking the co-stimulatory signal of T cell activation can negatively regulate T cell activity, thereby inducing T cells to produce immune tolerance. Anti-CD3 combined with anti-CD28 stimulation is so far the most effective tool for in vitro activation of T cells in higher animals, however, anti-CD3 epsilon stimulation alone cannot induce sufficient activation and proliferation of T cells, which indicates that in addition to the antigen stimulation signal, the antigen-specific CD28 co-stimulation signal is essential for the biological function of T cells.

[0003] Compared to higher animals, research on fish T cells is still in its early stages, especially regarding T cell activation, proliferation, differentiation, and effector functions. The biggest limiting factor is the lack of effective T cell activation tools in fish. Currently, PHA and PMA+ionomycin are mainly used to study T cell activation in fish, but these stimuli lack specificity. Furthermore, in vitro stimulation using a single signal provided by anti-CD3 is insufficient to fully induce T cell activation and proliferation.

[0004] Nile tilapia are fast-growing fish with a wide temperature and salinity tolerance, making them a major freshwater aquaculture species in my country. In the past decade, my country's tilapia farming industry has developed rapidly, ranking first in the world in terms of production output, value, and exports. However, increased stocking density and deteriorating farming environments have led to a series of diseases, causing serious damage to Nile tilapia farming. Therefore, research on the immune mechanisms of tilapia, especially T cell-mediated adaptive immune responses, is urgently needed. The CD28 molecule has been cloned in Nile tilapia. After infection with Streptococcus agalactiae, CD28 expression in the spleen of Nile tilapia was significantly upregulated, indicating that CD28 is involved in T lymphocyte activation, but the specific regulatory mechanism remains unclear. Summary of the Invention

[0005] This invention addresses the current state of research on fish T cells and the difficulties in preparing monoclonal antibodies by providing a hybridoma cell line 1B6A2 that can stably secrete anti-fish CD28 monoclonal antibodies, the monoclonal antibodies, their preparation methods, and applications. It provides a powerful tool for simulating a second signal in vitro and exploring the mechanism of CD28-mediated T cell adaptive immune response.

[0006] The technical solution provided by this invention to solve the above-mentioned technical problems is as follows:

[0007] A hybridoma cell line 1B6A2 secreting a monoclonal antibody against the fish T lymphocyte surface membrane protein CD28 was provided. Hybridoma cell line 1B6A2 is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: C202291 and deposit date of May 5, 2022.

[0008] A method for preparing the above-mentioned hybridoma cell line 1B6A2 is provided, which includes the following steps:

[0009] Cells were infected with a lentivirus containing the CD28 gene, a protein on the surface membrane of fish T lymphocytes.

[0010] Infected cells were used as immunogens to immunize animals.

[0011] After animal immunization, cell fusion, cell screening, and cloning were performed to obtain the hybridoma cell line 1B6A2.

[0012] Preferably, the preparation process of lentivirus containing the CD28 gene of fish T lymphocyte surface membrane protein includes: transfecting cells with a plasmid containing the CD28 gene of fish T lymphocyte surface membrane protein to obtain a supernatant containing lentivirus.

[0013] Preferably, the cells comprise fish CD28-transfected HEK-293T cells.

[0014] Preferably, MEF cells are transfected with a lentivirus containing the CD28 gene, a protein on the surface membrane of fish T lymphocytes.

[0015] A monoclonal antibody against the fish T lymphocyte surface membrane protein CD28 secreted by the hybridoma cell line 1B6A2 described above is provided.

[0016] A method for preparing the above-mentioned monoclonal antibody is provided, which includes the following steps:

[0017] BALB / c mice were intraperitoneally injected with sterile paraffin oil.

[0018] The above hybridoma cell line 1B6A2 was resuspended and then injected intraperitoneally into mice.

[0019] The mice were euthanized, ascites fluid was collected, centrifuged, and aliquoted for storage.

[0020] The ascites fluid was purified to obtain the monoclonal antibody against the fish T lymphocyte surface membrane protein CD28.

[0021] This study provides an application of the aforementioned monoclonal antibody in adaptive immune response research in fish.

[0022] This invention provides an application of the aforementioned monoclonal antibody in the specific recognition of fish CD28 protein.

[0023] An application of the above-mentioned monoclonal antibody in activating fish T cells by simulating a second signal is provided.

[0024] An application of the above-mentioned monoclonal antibody in inducing fish T cell proliferation by mimicking a second signal and in combination with a first signal is provided.

[0025] This invention provides an application of the above-mentioned monoclonal antibody in the preparation of fish disease prevention and treatment reagents / drugs.

[0026] Preferably, the fish disease prevention and control reagent / drug includes a fish disease prevention and control vaccine.

[0027] This invention is the first to use a lentiviral method to insert a complete fish (such as Nile tilapia and other bony fish) CD28 gene fragment into a mouse homologous MEF cell line, enabling the cell line to express fish CD28 protein on its cell surface. This successfully prepared a monoclonal antibody against fish (such as Nile tilapia and other bony fish) CD28, providing a powerful tool for in vitro simulation of the second signal and exploring the mechanism of CD28-mediated adaptive immune response of fish T cells. Attached Figure Description

[0028] Figure 1 To detect the infection effect of MEF cells by flow cytometry;

[0029] Figure 2 The results of flow cytometry analysis of the supernatant of 1B6A2 hybridoma cells;

[0030] Figure 3 To identify the specific recognition of CD28 in fish spleen leukocytes by the 1B6A2 monoclonal antibody using immunofluorescence assay;

[0031] Figure 4 To identify the specific recognition of CD28 in fish spleen leukocytes by 1B6A2 monoclonal antibody using a semi-quantitative method;

[0032] Figure 5 To detect CD28 in fish head kidney, spleen and peripheral blood leukocytes by flow cytometry + Flow cytometry analysis results of cells;

[0033] Figure 6 To detect CD28 in fish before and after infection with Edwardsiella tarda by flow cytometry + Changes in cell population;

[0034] Figure 7 The results of experiments induced by anti-CD28 monoclonal antibody-simulated second signal stimulation to activate fish T cells;

[0035] Figure 8 The results of experiments simulating dual-signal induction of fish T cell proliferation by anti-CD3 combined with anti-CD28. Detailed Implementation

[0036] Preparation of hybridoma cell lines:

[0037] S1. Cloning of the CD28 gene, a protein on the surface membrane of fish T cells:

[0038] (1) Total RNA was extracted from tilapia spleen leukocytes and reverse transcribed to synthesize cDNA as CD28 gene.

[0039] Because of the template used for cloning;

[0040] (2) Design a primer pair set for PCR amplification, which includes forward primer F1 and reverse primer F2.

[0041] The primers are R1 and F1, with the forward primer F1 sequence being: CGGAATTCGCCACCATGAGGATTTCATGGATGTTC; and the reverse primer R1 sequence being: CGGGATCCTTAGAAGTGTCTTTGTATATTCTGA.

[0042] (3) Prepare the amplification reaction system, amplify according to the program to obtain the amplification product, and then perform gel extraction and recovery after 1% agarose gel electrophoresis on the amplification product. The reaction system is 50 μL: 2 × PrimerSTAR DNA Polymerase 25 μL, cDNA template 2 μL, F1 2.5 μL, R1 2.5 μL, ddH2O 18 μL. Amplification reaction program: 98℃, 12 s, 58℃, 15 s, 72℃, 10 s, 50 cycles; then add 1 μL rTaq and incubate at 72℃ for 20 min; incubate at 4℃.

[0043] S2, Construction of fish CD28 gene expression vector:

[0044] (1) Take 0.5 μL of PMD19T vector, 5 μL of solution Ⅰ, and 4.5 μL of the solution from step (3) above.

[0045] The recovered products were mixed and bonded overnight at 12-15°C to obtain the first bonded system;

[0046] (2) Add 10 μL of the first ligation system to 50 μL of DH5α competent cells and place them in a container.

[0047] Place on ice for 30 min, then in a 42°C water bath for 90 s, and then on ice for 2 min;

[0048] (3) Then add 500 μL of LB liquid medium and incubate at 37°C in a shaker for 1-2 h; take

[0049] 100 μL of suspension was spread and cultured in LB solid medium containing ampicillin resistance overnight at 37°C;

[0050] (4) Select positive clones and sequence them, and use TaKaRa MiniBEST Plasmid Purification.

[0051] Kit Ver.4.0 extracts the PMD19T plasmid containing the CD28 gene (i.e., CD28-PMD19T plasmid).

[0052] (5) Take 1 μg each of CD28-PMD19T plasmid and pLVX-IRES-ZsGreen1 plasmid respectively.

[0053] Add the double digestion system (5 μL Cutsmart buffer, 2.5 μL EcoR Ⅰ, 2.5 μL BamHI, 30 μL ddH2O), and digest at 37℃ for 4-5 h to obtain two digestion products. Perform agarose gel electrophoresis on both digestion products and then recover them by gel excision.

[0054] (6) Take 4 μL of each of the two enzyme digestion products and mix them with 1 μL of ddH2O and 1 μL of Ligase Buffer.

[0055] Furthermore, the connection is carried out overnight at 15-18℃ to obtain a second connection system;

[0056] (7) Add the above 10 μL second-linkage system to 5 μL of DH5α competent cells and place on ice.

[0057] After 30 min, incubate in a 42℃ water bath for 90 s, then place on ice for 2 min; add 500 μL of LB liquid medium and incubate at 37℃ for 1-2 h; take 100 μL of suspension and spread it on LB solid medium containing ampicillin resistance and incubate overnight at 37℃.

[0058] (8) Screen positive clones using CD28 specific primers F1 and R1 and expand the culture, then extract

[0059] Lentiviral plasmids containing the CD28 gene (i.e., CD28-pLVX-IRES-ZsGreen1 plasmid).

[0060] S3, Lentiviral preparation:

[0061] (1) HEK-293T cells were cultured in 4 mL DMEM (1% penicillin antibody, 10% FBS) at 60 mm temperature.

[0062] In a culture dish; when the confluence of HEK-293T cells in the culture dish reaches about 80-85%, add 3 mL of DMEM (1% penicillin antibody, 10% FBS) containing 25 mM chloroquine;

[0063] (2) Take 5 μg of CD28-pLVX-IRES-ZsGreen1 plasmid and 2.5 μg of psPAX2 plasmid respectively.

[0064] Add 1 μg pMD2.G plasmid and 50 μL 2.5 M CaCl2 to 500 μL ddH2O, and slowly add 50 μL 2×HEBS Buffer solution dropwise using a pipette. Mix the above components thoroughly to prepare the transfection system.

[0065] (3) The above transfection system was added to HEK-293T cells and transfected at 37°C.

[0066] nourish;

[0067] (4) Discard the supernatant 8 h after transfection and add 3 mL of DMEM medium (1% penicillin antibody, 10% FBS).

[0068] Transfect for another 48 hours, then centrifuge at 1200 rpm for 7 min. The collected supernatant is the lentivirus suspension, which is then aliquoted and stored at -80℃.

[0069] S4 and MEF cell infection:

[0070] (1) MEF cells were cultured in DMEM medium (1% penicillin antibody, 10% FBS) at 60 mm.

[0071] In the culture dish, when the confluence of MEF cells reaches about 45-50%, discard the supernatant and add 5 mL of DMEM medium containing 5 μM polybrene (1% penicillin and 10% FBS).

[0072] (2) Add 600 μL of the above lentivirus suspension to a culture dish, mix well, and incubate at 37°C.

[0073] 3.5-6 h to complete MEF cell infection;

[0074] (3) Add 5 mL of DMEM without polybrene to the culture dish where MEF cell infection has been completed.

[0075] Mix the culture medium (1% penicillin and antibiotics, 10% FBS) thoroughly, and replace it with DMEM medium (1% penicillin and antibiotics, 10% FBS) every 12 h, changing it 1-2 times.

[0076] (4) Centrifuge 24 h after the last culture medium change, collect the cell pellet, and use 500 μL of pancreatic acid...

[0077] The cell pellet was digested with enzymes at 37°C for 1 min; the cells were then resuspended in 3 mL of DMEM medium, centrifuged at 1000 rpm for 2-3 min, the supernatant was discarded, the resulting cell pellet was resuspended in 10 mL of PBS, centrifuged at 1000 rpm for 3 min, and repeated once. The cells were then resuspended in 300 μL of PBS to obtain transfected MEF cells, and the infection efficiency was detected by flow cytometry.

[0078] like Figure 1 As shown, the infection efficiency of MEF cells can reach over 75%, indicating that they can be used as immunogens for animal immunization and for the preparation of monoclonal antibodies.

[0079] S5. Animal Immunization:

[0080] The transfected MEF cells were used as antigens to immunize animals (4-6 week old female BALb / c mice) via intraperitoneal injection. The immunization was performed 3-4 times, with each dose being 2 × 10⁻⁶ mg / L. 6 Cells / animal, with a 2-week interval between the first two immunizations and a 1-week interval between the next two immunizations.

[0081] S6, Cell Fusion:

[0082] (1) Three days after the completion of animal immunization, the animals were euthanized by dislocating their cervical vertebrae and then soaked in 75% alcohol by volume.

[0083] After 30 seconds, the thymus and spleen were aseptically removed. The thymus was ground in RPMI-1640 with a spatula, filtered through a sieve, and RPMI-1640 was added to 35 mL to prepare a single-cell suspension. The suspension was centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the pellet was resuspended in 10 mL of HAT-GIT to obtain a thymocyte suspension, which was stored at 37°C for later use. The spleen was ground in RPMI-1640 with a spatula, filtered through a sieve, and RPMI-1640 was added to 35 mL to prepare a single-cell suspension. The suspension was centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the pellet was resuspended in 12 mL of RPMI-1640 to obtain a spleen cell suspension, which was stored at 37°C for later use.

[0084] (2) Resuscitate SP2 cells one week before fusion, and passage SP2 cells to 75 cm culture medium one day before fusion.

[0085] In the flask; during fusion, blow SP2 cells from the culture flask with 12 mL RPMI-1640, and mix the spleen cell suspension and SP2 cell suspension at a volume ratio of 1:10 in a centrifuge tube. Then centrifuge at 1200 rpm for 5-10 min, discard the supernatant to obtain a mixed cell pellet containing the two types of cells, and make the cell pellet into a paste by tapping the bottom of the centrifuge tube.

[0086] (3) Slowly add 1 mL of PEG to the mixed cell pellet of the two types of cells mentioned above and let it stand for 90 s;

[0087] Then, slowly add 10 mL of RPMI-1640 preheated to 37°C over 5 min to terminate the PEG reaction; then add RPMI-1640 to 40 mL, centrifuge at 800 rpm for 6 min, discard the supernatant, and obtain the cell pellet.

[0088] (4) Add 3 ml of GIT culture medium to resuspend the cell pellet obtained in (3) to obtain a cell resuspension.

[0089] Take 300 μL of cell resuspension and add 10 mL of thymocyte suspension. Mix well to obtain the fused cell system. Then add the fused cell system to the wells of a cell culture plate (such as a 96-well plate) at a rate of 100 μL / well.

[0090] (5) Place the well plate in an incubator at 37°C and 5% CO2 concentration for 5-7 days. During the incubation process...

[0091] In the process, the cell growth was observed daily under an inverted microscope. When the fused cells filled 1 / 3 of the well plate, the supernatant of the fused cells was collected by centrifugation.

[0092] Observation under an inverted microscope revealed that the fused cells were in good growth condition, with vigorous division, plump and round appearance, strong refractive index, uniform cell size, good adhesion, and the ability to proliferate indefinitely.

[0093] S7. Fusion cell screening and cloning:

[0094] S7-1. Flow cytometry is used to screen fused cells, specifically including the following steps:

[0095] (1) Take the spleen of healthy fish, wash, grind, and pass it through a 200-mesh sieve using L15 culture medium.

[0096] The obtained tissue pellet was added to Percoll separation medium (4 mL 52% Percoll + 4 mL 34% Percoll), and centrifuged at 24-25℃ and 500-520 g for 30-40 min. The white ring layer cells in the middle were taken, resuspended and washed with 12 mL L15 medium, and then centrifuged at 2500 rpm for 3 min. The supernatant was discarded to obtain white blood cells.

[0097] (2) The leukocytes were resuspended in 1-2 mL PBS (2% FBS), and the resulting suspension was prepared at a concentration of 100 μL / well (approximately

[0098] 500,000 cells were added to the wells of a 96-well cell culture plate, cultured for a predetermined time, centrifuged at 2500 rpm for 3 min, and the supernatant was discarded to obtain the white blood cell pellet.

[0099] (3) Add the collected fused cell supernatant to the leukocyte precipitate as the primary antibody system, and add to the control wells.

[0100] SP2 cell culture supernatant was used as a control; after incubation on ice for 30 min, the cells were centrifuged at 2500 rpm for 3 min, the supernatant was discarded, and the cell pellet was obtained. The cell pellet was washed with 200 μL PBS (2% FBS) and the washing was repeated once.

[0101] (4) Add Alexa Fluor 647 (1:2000) to the wells of the cell culture plate at a rate of 50 μL / well.

[0102] The fluorescent secondary antibody was incubated on ice in the dark for 30 min, centrifuged at 2500 rpm for 3 min, the supernatant was discarded, and the cell pellet was obtained. The cell pellet was washed with 20 μL PBS (2% FBS) and the washing was repeated once.

[0103] (5) Resuspend the cell pellet obtained in (4) in 200 μL PBS (2% FBS) / well and use flow cytometry.

[0104] Positive wells were selected by cell culture.

[0105] S7-2. Cloning positive fusion cells, which specifically includes the following steps:

[0106] (1) Mice were euthanized by cervical dislocation, soaked in 75% alcohol for 30 seconds, and removed under sterile conditions.

[0107] The thymus was ground on a 200-mesh sieve and pipetted with RPMI-1640 solution to form a thymocyte suspension; centrifuged at 1000 rpm for 5 min, the supernatant was discarded, and the thymocytes were resuspended in GIT culture medium preheated to 37℃ to obtain a thymocyte GIT suspension.

[0108] (2) Gently blow up the cells in the positive wells, count them using a hemocytometer, and remove 100 fused cells.

[0109] Add the above thymocyte GIT suspension to 10 mL, mix well by pipetting, and then add 100 μL / well to the wells of a 96-well plate or other cell culture plate, and incubate at 37°C with 5% CO2.

[0110] (3) When the cloned fusion cells have grown to 1 / 3 of the wells, collect the supernatant and analyze it by flow cytometry.

[0111] Cells from the cell culture supernatant of each well were detected as hybridoma cell line 1B6A2, which secretes monoclonal antibody against CD28, the surface membrane protein of Nile tilapia T lymphocytes. This hybridoma cell line 1B6A2 was further deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C202291 and deposit date of May 5, 2022.

[0112] In steps S1-S7 above, the fish include bony fish, preferably tilapia, and particularly preferably Nile tilapia (Oreochromis niloticus).

[0113] After testing, such as Figure 2 As shown, the hybridoma cell line 1B6A2 can clearly recognize approximately 25.3% of the positive cell population in fish spleen leukocytes, indicating that the hybridoma cell line 1B6A2 can secrete monoclonal antibodies and can recognize and bind to a certain type of cell population in fish spleen leukocytes.

[0114] Therefore, by cloning the fish CD28 gene fragment and ligating it into the lentiviral expression vector pLVX-IRES-ZsGreen1 plasmid, and then using HEK-293T cells to generate lentiviral supernatant containing fish CD28, mouse MEF cells were infected with this supernatant, enabling the cell line to express fish CD28 protein on the cell membrane. This protein maximally replicates the immunogenic activity of fish CD28 under natural conditions, thus ensuring the efficacy and specificity of the prepared monoclonal antibody. Furthermore, compared to traditional retroviruses, the lentiviral vector used in this monoclonal antibody preparation produced a high-titer lentivirus with strong infectivity, ensuring sufficient antigen immunization dose while maintaining protein antigen activity.

[0115] Purification of monoclonal antibody:

[0116] This section provides a monoclonal antibody secreted by the hybridoma cell line 1B6A2 against the fish T lymphocyte surface membrane protein CD28, and the monoclonal antibody (hereinafter referred to as "anti-CD28") is... Monoclonal antibody CD28 The purification process of ) includes the following steps:

[0117] Ascites preparation: 500 μL of sterile paraffin oil per mouse was injected intraperitoneally into 10-week-old female BALB / c mice; 10 days later, the hybridoma cell line 1B6A2, which was cultured in a 24-well plate and was in good growth condition, was gently blown off with PBS and washed 1-2 times. After centrifugation, the supernatant was discarded to obtain the hybridoma cell line precipitate.

[0118] Resuspend the hybridoma cell line pellet in 200-300 μL of sterile PBS, and inject 2 × 10⁻⁶ cells into each mouse intraperitoneally. 5One cell per mouse; observe the mice daily, and when the mice become swollen and unable to move, they are euthanized by dislocating their cervical vertebrae and collecting ascites fluid.

[0119] Centrifuge the ascites at 5000 rpm for 5 min, collect the pale yellow ascites in the middle, and aliquot and store at -80℃.

[0120] Antibody purification: Take 200 μL of Protein G Agarose into a 15 mL centrifuge tube, wash three times with pre-cooled PBS, then add 500 μL of aliquoted ascites fluid and dilute with PBS to 8 mL, incubate overnight at 4°C; centrifuge at 2000 rpm for 1 min, discard the supernatant, and wash the beads 6 times with PBS, each time using 10 mL of PBS, centrifuge at 2000 rpm for 1 min;

[0121] The antibody was then eluted with 1 mL of 0.1 M glycine-HCl (pH 2.8) to obtain a monoclonal antibody against CD28, the surface membrane protein of tilapia T lymphocytes. The pH was neutralized by adding 1 / 10 volume of 1 M Tris-HCl (pH 8.5), and the antibody was aliquoted and stored at -80℃.

[0122] Indirect immunofluorescence identification of monoclonal antibody CD28:

[0123] Spleens from healthy fish were selected, and leukocytes were obtained by Percoll separation. The cells were resuspended in PBS, and an appropriate amount of cells were prepared into cell drops. The cells were fixed in methanol for 5 min, dried, and then 100 μL of 1% BSA was added. The cells were then blocked in a 37°C incubator for 1 h. The cells were washed twice with PBST and once with PBS, 5 min each time. 100 μL of hybridoma cell supernatant from Example 1 (1B6A2) was added, and the cells were incubated at 37°C for 1 h. The cells were washed twice with PBST and once with PBS, 5 min each time. 100 μL of Alexa Fluor 594 (1:800) fluorescent secondary antibody was added, and the cells were incubated at 37°C for 1 h. The cells were washed twice with PBST and once with PBS, 5 min each time. 2.5 μL of anti-fluorescence quenching mounting medium containing DAPI dye was added, and the cells were mounted. The cells were examined under a fluorescence microscope.

[0124] The results show that, Figure 3 As shown, approximately 30% of the leukocytes (shown in the anti-CD28 section) exhibit red fluorescence under a fluorescence microscope, indicating that hybridoma cells can secrete monoclonal antibodies that can specifically recognize proteins on the surface of fish leukocytes.

[0125] Semi-quantitative identification of monoclonal antibody CD28:

[0126] Spleens were isolated from healthy Nile tilapia to obtain leukocytes. The leukocytes were resuspended in an appropriate amount of L15 medium (containing 2% FBS). 100 μL of cell suspension was added to each well of a 96 V-plate, and centrifuged at 2500 rpm for 3 min. The supernatant was discarded, and the supernatant of the 1B6A2 hybridoma cell line from Example 1 was added as the primary antibody. For the control wells, SP2 cell culture supernatant was added. The cells were incubated on ice for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and 200 μL of FACS Buffer (L15, 2% FBS) was added to resuspend the cells. The cells were centrifuged at 2500 rpm for 3 min, and the supernatant was discarded. The resulting pellet was washed once more. 50 μL of Alexa Fluor 647 (1:2000) fluorescent secondary antibody was added to each well, and the cells were incubated on ice in the dark for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and 200 μL of FACS Buffer (L15, 2% FBS) was added to each well. Cells were resuspended in FBS, centrifuged again, and the resulting precipitate was washed once more and resuspended in 1 mL L15 medium (containing 10% FBS). Positive and negative cell populations were separated by flow cytometry and centrifuged at 2500 rpm for 5 min to obtain positive and negative cells respectively. Total RNA was extracted from each cell and reverse transcribed into cDNA templates. The cDNA templates from positive and negative cells were used for PCR reactions. The PCR products were subjected to agarose gel electrophoresis, and the β-actin levels of the positive and negative cells were adjusted to be consistent.

[0127] like Figure 4 As shown, CD28 gene expression was detected in the positive cell population but not in the negative cell population. At the same time, the positive cell population showed obvious T cell characteristic genes (high expression of CD3ε, TCRβ, CD4-1, CD8α) but not B cell characteristic genes (IgM, IgD). This indicates that the monoclonal antibody CD28 can specifically recognize the CD28 protein on the surface of fish T lymphocytes.

[0128] Monoclonal antibody cd28 for detecting cd28 in fish + Use of t cell populations for tissue distribution :

[0129] Healthy fish were selected, and white blood cells were isolated from the head kidney, peripheral blood, and spleen.

[0130] Peripheral blood was drawn, and 2 mL of anticoagulant (450 mM NaCl, 0.1 M glucose, 10 mM EDTA, 15 mM sodium citrate, pH 7.0) was added to the drawn peripheral blood. The mixture was centrifuged at 2500 rpm for 3 min, the supernatant was discarded, and the cell pellet was resuspended in 3 mL of L15 medium. The cells were then separated by Percoll to obtain leukocytes. For spleen and head kidney tissue, leukocytes were separated from the head kidney according to the method in Example 2. Resuspend leukocytes from each tissue in 1 mL of FACS buffer (PBS, 2% FBS). Add 100 μL of the leukocyte resuspension to each well in a 96V plate. Centrifuge at 2500 rpm for 3 min and discard the supernatant. Add the purified monoclonal antibody (1:10000) from Example 2 as the primary antibody to the corresponding well. For the control group, use SP2 culture supernatant. Incubate on ice for 30 min. Centrifuge at 2500 rpm for 3 min and discard the supernatant. Resuspend the cells in 200 μL of FACS buffer (L15, 2% FBS), centrifuge again, and wash the resulting pellet once. Add 50 μL of Alexa Fluor 647 (1:2000) fluorescent secondary antibody per well and incubate on ice in the dark for 30 min. Centrifuge at 2500 rpm for 3 min and discard the supernatant. Resuspend the cells in 200 μL of FACS buffer (L15, 2% FBS), centrifuge again, and wash the resulting pellet once. Add 50 μL of FACS buffer (L15, 2% FBS) per well. The cells were resuspended in a buffer / well for flow cytometry analysis.

[0131] like Figure 5 As shown, the percentages of CD28-positive cells in head kidney leukocytes, peripheral blood leukocytes, and spleen leukocytes were 22.1%, 57.2%, and 33.8%, respectively, indicating that the monoclonal antibody CD28 can specifically recognize CD28-positive cells, and that fish CD28... + T cells are distributed in a variety of tissues.

[0132] Application of monoclonal antibody CD28 in detecting T cell population changes in fish infected by Edwardsiella tarda (Edwardsiella piscicida) Figure 6 Application of monoclonal antibody CD28 in simulating secondary signal to activate fish T cells: :

[0133] Select healthy fish and inject them intraperitoneally with 7×10 5The infection group consisted of Edwardsiella piscicida at CFU / mL, while the control group received the same dose of PBS. On day 6 after infection, leukocytes were obtained from the spleens of both the infection and control groups using Percoll. Leukocytes from the spleens of both groups were resuspended in 2 mL FACSBuffer (PBS, 2% FBS) to prepare leukocyte suspensions. 100 μL of the leukocyte suspension was added to each well of a 96-well plate and centrifuged at 2500 rpm for 3 min. The supernatant was discarded, and 100 μL of the purified antibody (1:10000) from Example 2 was added to each well. The plates were incubated on ice for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and 200 μL of FACS Buffer (L15, 2% FBS) was added to resuspend the cells. The cells were centrifuged at 2500 rpm for 3 min, and the washing was repeated once. 50 μL of Alexa Fluor 647 (1:2000) fluorescent secondary antibody was added to each well and incubated on ice in the dark for 30 min. The plates were then centrifuged at 2500 rpm for 3 min. After 3 min, discard the supernatant, resuspend the cells in 200 μL FACS Buffer (L15, 2% FBS), centrifuge at 2500 rpm for 3 min, and repeat the washing once; resuspend the cells in 200 μL FACS Buffer / well for flow cytometry detection.

[0134] The results are as follows Figure 7 As shown, 6 days after Edwardsiella infection, CD28 + The proportion of T cells among white blood cells increased from 22.8% before infection to 42% after infection, indicating that during infection, the CD28 receptor antagonist recognized by the monoclonal antibody CD28... + T cells participate in the adaptive immune response in fish and play an important role in resisting bacterial infections.

[0135] CD28

[0136] Healthy fish spleens were selected, and leukocytes were obtained using the Percoll method. Cells were resuspended in PBS and aliquoted into four 1.5 mL EP tubes. Each tube contained 500 μL of D-PBS and incubated at 28 °C for 30 min. 1 μg / mL anti-CD28 was added to stimulate leukocytes for 5, 15, and 45 min, respectively. Then, 500 μL of PBS was added, and the reaction was stopped by incubating on ice for 2 min. The cells were centrifuged at 2500 rpm for 3 min, and the supernatant was discarded. 200 μL of 1% NP40 (0.1% PMSF, 0.1% protease inhibitor, 1% phosphorylase inhibitor) was added, and the cells were lysed on ice for 30 min. The cells were then centrifuged at 10000 rpm at 4 °C for 10 min, and the supernatant was collected. An appropriate amount of protein loading buffer was added, and the mixture was boiled for 5 min.

[0137] Protein concentration measurement: Add 10 μL of protein sample to the microplate, and add 300 μL of G250 staining solution to each well. Measure the absorbance of each sample at OD595 using a microplate reader, and calculate their protein concentration based on the standard curve and dilution factor.

[0138] Western blot (WB) detection of protein expression changes: Protein samples were added to a 12% SDS-polyacrylamide gel and kept at a constant current of 40 mA. When the sample transitioned from the stacking gel to the separating gel, the current was increased to 80 mA. The electrophoresis end time was determined based on the size of the target band. A wet transfer system was used to transfer the protein from the gel to a nitrocellulose membrane at a constant voltage of 100 V for 120 min. During this process, the transfer system should be placed in ice water. After transfer, the nitrocellulose membrane was placed in PBST containing 4% skim milk powder (PBS and Tween-20 were mixed at a ratio of 2000:1) and blocked on a shaker at room temperature for 1 h. The blocked bands were washed three times with PBST on a shaker for 10 min each time. The washed membrane was cut to the desired target band size and added to diluted primary antibody (1:1000), incubated overnight on a shaker at 4°C. The bands were washed three times with PBST for 10 min each time. min; add the band to PBST diluted with 4% skim milk powder and the fluorescent secondary antibody goat-anti rabbit IgG H&L conjugated with Alexa Fluor 790, and incubate on a shaker at room temperature in the dark for 1 h; wash the band three times with PBST on a shaker in the dark, and then scan the nitrocellulose membrane with an Odyssey CLx Image Studio imaging system.

[0139] Experimental results are as follows Fish As shown, after stimulation with the monoclonal antibody CD28, the total protein levels of the AKT, S6, and 4EBP1 pathways in the mTOR pathway remained unchanged, but the phosphorylation level was significantly upregulated, indicating that the monoclonal antibody... Application of monoclonal antibody CD28 in simulating secondary signal to activate fish T cells: It can simulate the activation of a second signal in vitro. Figure 8 T lymphocytes.

[0140]

[0141] Healthy fish leukocytes were isolated from Percoll cells. The cells were resuspended in an appropriate amount of PBS, and 2 mL of loading buffer (PBS containing 0.5% FBS) was added. The mixture was centrifuged at 2500 rpm for 5 min at 4 °C, and the supernatant was discarded. CFSE (1:2000, final concentration 10 μM) was diluted in L15 medium, and 500 μL of CFSE was added to each tube to resuspend the cells. The tubes were incubated on a shaker at room temperature in the dark for 10 min. 14 mL of L15 medium was added to a 15 mL centrifuge tube and mixed. The tubes were centrifuged at 2500 rpm for 5 min at 4 °C, and the supernatant was discarded. The cells were resuspended in 2 mL of DMEM (10% FBS and 1% antibiotics). 10 μL of DMEM was added to each well of a 24-well cell plate. 6 Labeled cells were replenished to 1 ml with DMEM (10% FBS and 1% anti-CD28) medium. For single-signal stimulation, 1 μg / mL anti-CD3ε was added to each well, and for dual-signal stimulation, 1 μg / mL anti-CD3ε and 1 μg / mL anti-CD28 were added to each well. The control wells received no stimulation. Cells were incubated at 37 °C in a 5% CO2 incubator for 48 h. 100 μL of the above leukocyte suspension was added to each well of a 96-well plate, and the cells were centrifuged at 2500 rpm for 3 min. The supernatant was discarded, and 100 μL of the purified antibody (1:10000) described in Example 2 was added to each well as the primary antibody. Cells were incubated on ice for 30 min. After centrifugation at 2500 rpm for 3 min, the supernatant was discarded, and the cells were resuspended in 200 μL of FACS Buffer (PBS, 2% FBS). Cells were centrifuged at 2500 rpm for 3 min, and the washing was repeated once. After discarding the supernatant, Alexa Fluor647 (1:2000) fluorescent secondary antibody was added, and cells were incubated on ice in the dark for 30 h. Centrifuge at 2500 rpm for 3 min, discard the supernatant, add 200 μL FACS Buffer (PBS, 2% FBS) to resuspend the cells, centrifuge at 2500 rpm for 3 min, repeat the washing once; discard the supernatant, add 200 μL FACS Buffer (7-AAD to PBS ratio of 1:400) to each well to resuspend the cells, and perform flow cytometry detection.

[0142] Experimental results are as follows ​ As shown, stimulation with the first signal of anti-CD3ε alone did not induce T cell proliferation. Only stimulation with anti-fish CD3ε monoclonal antibody (anti-CD3ε) in combination with anti-fish CD28 monoclonal antibody (i.e., monoclonal antibody CD28, also known as anti-CD28) could induce significant proliferation of fish T cells. This indicates that after the first signal provided by anti-CD3ε, monoclonal antibody CD28 can effectively provide the second signal stimulation and promote the proliferation of fish T cells.

[0143] Similarly, the above-mentioned indirect immunofluorescence identification, semi-quantitative identification, and CD28... + The applications of T cell population tissue distribution detection, T cell population changes after Edwardsiella piscicida infection, application of simulating a second signal to activate fish T cells, and application of simulating a second signal in combination with a first signal to induce fish T cell proliferation, wherein the fish include bony fish, preferably tilapia, and particularly preferably Nile tilapia (Oreochromis niloticus).

[0144] In summary, this invention is the first to employ a lentiviral method to insert a fragment of the CD28 gene from fish (such as Nile tilapia and other bony fish) into a mouse homologous MEF cell line, enabling the cell line to express the CD28 protein on its cell surface. This protein largely replicates the native CD28 protein from fish (such as Nile tilapia and other bony fish), maintaining strong immunogenicity. A screening system combining semi-quantitative, flow cytometry, and indirect immunofluorescence methods was established, successfully preparing a monoclonal antibody against fish CD28 while fully ensuring all the specificity of the monoclonal antibody. This provides a powerful tool for in vitro simulation of the second signal to explore the CD28-mediated adaptive immune response mechanism of fish T cells, and lays the foundation for research on fish disease prevention and control, vaccine development, and the evolution of adaptive immunity in bony fish.

[0145] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A hybridoma cell line 1B6A2 secreting a monoclonal antibody against the surface membrane protein CD28 of fish T lymphocytes. Hybridoma cell line 1B6A2 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: C202291 and deposit date of May 5, 2022.

2. A monoclonal antibody against the fish T lymphocyte surface membrane protein CD28 secreted by the hybridoma cell line 1B6A2 as described in claim 1.

3. A method for preparing a monoclonal antibody as described in claim 2, characterized in that, Includes the following steps: Mice were taken and injected intraperitoneally with sterile paraffin oil; The hybridoma cell line 1B6A2 described in claim 1 was resuspended and then injected intraperitoneally into mice. The mice were euthanized, ascites fluid was collected, centrifuged, and aliquoted for storage. The ascites fluid was purified to obtain the monoclonal antibody against the fish T lymphocyte surface membrane protein CD28.

Citation Information

Patent Citations

  • Preparation method and application of monoclonal antibody against CD3ε protein on the surface membrane of tilapia T lymphocytes

    CN112501130B

  • Hybridoma cell strain secreting anti-tilapia interleukin-2 monoclonal antibody and application thereof

    CN118530946A