Expression cassette, strain for fermentative production of l-lysine and application thereof

By enhancing the expression of biotin synthase in Corynebacterium glutamicum, optimizing cell metabolism, and constructing genetically engineered strains, the problem of low L-lysine production efficiency in existing technologies has been solved, and efficient fermentation production of L-lysine in straw hydrolysate has been achieved.

CN116411008BActive Publication Date: 2026-06-16CATHAY BIOTECH INC +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CATHAY BIOTECH INC
Filing Date
2021-12-31
Publication Date
2026-06-16

AI Technical Summary

Technical Problem

Existing technologies lack genetically engineered strains that produce high yields of L-lysine, especially addressing the issue of low fermentation efficiency under straw hydrolysate conditions.

Method used

By enhancing the expression of biotin synthase in Corynebacterium glutamicum and utilizing an expression cassette containing the biotin synthase encoding gene, cell metabolism was optimized, glucose utilization efficiency was improved, and a genetically engineered strain was constructed.

Benefits of technology

The genetically engineered strain significantly improved the yield and production intensity of L-lysine under glucose or straw hydrolysate conditions. The L-lysine yield of the genetically engineered strain in straw hydrolysate was increased by 15.54% and the production intensity was increased by 30.72% compared with the original strain.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application discloses an expression cassette for fermentative production of L-lysine, a strain and application thereof. The expression cassette comprises a promoter and a biotin synthetase gene of Corynebacterium glutamicum. The application also discloses nucleic acid comprising the expression cassette, a recombinant expression vector containing the nucleic acid, a genetically engineered bacterium containing the nucleic acid or the recombinant expression vector and application thereof. The application also discloses a preparation method of the genetically engineered bacterium and a method for preparing L-lysine by fermenting the genetically engineered bacterium. The application provides a method for enhancing expression of biotin synthetase, effectively regulates cell metabolism, improves glucose utilization efficiency, and further improves the yield of L-lysine, and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an expression cassette, strain, and application for the fermentation production of L-lysine. Background Technology

[0002] Lysine, also known as 2,6-diaminohexanoic acid, is a basic amino acid. Lysine plays important nutritional and physiological roles and is widely used in the pharmaceutical, food, and feed industries. It can also be used as a precursor in the synthesis of nylon polymer materials. The main production methods for lysine include protein hydrolysis, chemical synthesis, and fermentation. Among these, microbial fermentation is the most widely used method for industrial production of lysine due to its low production cost, high production intensity, high specificity, and minimal environmental pollution.

[0003] Prokaryotic microorganisms used for lysine production mainly include Corynebacterium, Brevibacterium, Nocardia, Pseudomonas, Escherichia, and Bacillus. Corynebacterium glutamicum is the most important and safest strain for amino acid fermentation, and improving its ability to oversynthesize various amino acids through metabolic modification has been a research hotspot. For example, overexpressing genes related to the lysine synthesis pathway and feedback inhibition desensitization, strengthening the energy supply pathway starting from glucose metabolism, and optimizing lysine transport proteins on the cell membrane have all effectively improved lysine productivity.

[0004] Besides continuously strengthening the metabolic pathway for lysine production, fermentation methods that open up alternative pathways to non-lysine metabolism are also worth exploring in depth. Biotin is one of the B vitamins, also known as vitamin H, vitamin B7, or coenzyme R. Biotin is a coenzyme for various carboxylases and participates in the metabolism of fatty acids and carbohydrates, protein synthesis, and the metabolism of vitamin B12, folic acid, and pantothenic acid. Biotin synthase plays an important role in the biotin synthesis pathway. Currently, there are no reports on the production of L-lysine by Corynebacterium glutamicum from the perspective of regulating biotin synthase. Summary of the Invention

[0005] To address the deficiency in existing technologies regarding the lack of a high-yield L-lysine-producing genetically engineered bacterium, this invention provides an expression cassette that enhances lysine production in *Corynebacterium glutamicum* and a genetically engineered bacterium capable of efficiently producing lysine. This invention improves cell metabolism by enhancing the expression of biotin synthase in *Corynebacterium glutamicum*, thereby increasing the fermentation efficiency of *Corynebacterium glutamicum* under glucose or straw hydrolysate conditions, ultimately achieving a higher L-lysine yield.

[0006] This invention discloses an engineered strain of *Corynebacterium glutamicum* that produces lysine and its applications. The engineered strain includes an expression cassette containing a biotin synthase-encoding gene. The starting strain of the engineered strain is *Corynebacterium glutamicum*, and the engineered strain enhances biotin synthase. This method improves the strain's glucose utilization efficiency, thereby increasing L-lysine production. Furthermore, when using straw hydrolysate, the lysine yield and production intensity of the engineered strain of this invention are superior to those of the starting strain.

[0007] The expression of biotin synthase from Corynebacterium glutamicum can be enhanced using any method known in the art. For example, the expression level of this gene can be increased by introducing additional components or changing the promoter. To solve the above-mentioned technical problems, one of the technical solutions provided by the present invention is: an expression cassette, wherein the expression cassette contains a promoter and the biotin synthase gene of Corynebacterium glutamicum.

[0008] The expression cassette as described in one of the technical solutions, wherein the amino acid sequence of the biotin synthase is as shown in SEQ ID NO:2, or differs from SEQ ID NO:2 at amino acid positions 115 and / or 288.

[0009] In a preferred embodiment of the present invention, there are amino acid differences of V115G and / or G288A compared to SEQ ID NO:2.

[0010] The expression cassette as described in one of the technical solutions encodes the biotin synthase gene with a nucleotide sequence as shown in SEQ ID NO:1 or SEQ ID NO:17; and / or, the promoter is Peftu, whose nucleotide sequence is shown in SEQ ID NO:3.

[0011] To solve the above-mentioned technical problems, the second technical solution provided by the present invention is: an isolated nucleic acid, wherein the nucleic acid comprises an expression cassette as described in the first technical solution.

[0012] To solve the above-mentioned technical problems, the third technical solution provided by the present invention is: a recombinant vector, wherein the recombinant vector includes an expression cassette as described in the first technical solution, or includes nucleic acid as described in the second technical solution.

[0013] In a preferred embodiment of the present invention, the backbone plasmid of the recombinant vector is pK18mob.

[0014] To solve the above-mentioned technical problems, the fourth technical solution provided by the present invention is: a genetically engineered bacterium, wherein the genetically engineered bacterium is transformed with an expression cassette as described in the first technical solution, or a nucleic acid as described in the second technical solution, or a recombinant vector as described in the third technical solution.

[0015] The starting strain of the genetically engineered bacteria described in this invention is *Corynebacterium glutamicum*. Although the starting strain in the embodiments of this invention is *Corynebacterium glutamicum* CathS141, which is resistant to straw hydrolysate, it can be seen from Example 4 that when the culture medium is a prepared glucose medium, the genetically engineered bacteria of this invention also produce L-lysine better than the starting strain. That is, resistance to the inhibitory toxicity of straw hydrolysate is not a necessary condition for the starting strain. Therefore, the starting strain of this invention can be *Corynebacterium glutamicum* CathS141 or *Corynebacterium glutamicum* B253, but is not limited to these embodiments. The accession number of *Corynebacterium glutamicum* CathS141 is CCTCC NO: M20211495. *C. glutamicum* B253 was purchased from the Shanghai Institute of Industrial Microbiology.

[0016] As described in technical solution four, when the expression cassette as described in technical solution one, the nucleic acid as described in technical solution two, or the recombinant vector as described in technical solution three is introduced into the starting bacterium, the expression cassette is integrated into the genome of the starting bacterium through homologous recombination, or exists in the starting bacterium in a non-integrated form.

[0017] In a preferred embodiment of the present invention, when the genetically engineered bacteria includes the expression cassette, the expression cassette is integrated into the genome of the originating bacteria.

[0018] As described in technical solution four, the genetically engineered bacteria preferably do not express lactate dehydrogenase (LDH), for example, its LDH gene is knocked out.

[0019] In a preferred embodiment of the present invention, when the expression cassette as described in one technical solution, the nucleic acid as described in another technical solution, or the recombinant vector as described in a third technical solution is introduced into the starting bacteria, the expression cassette is integrated into the ldh gene site on its genome.

[0020] To solve the above-mentioned technical problems, the fifth technical solution provided by the present invention is: a method for preparing L-lysine, the method comprising fermenting the genetically engineered bacteria as described in the fourth technical solution in a fermentation medium.

[0021] The fermentation conditions described in this invention can be conventional in the art. For example, the fermentation medium is a medium containing not less than 25 g / L of glucose, and / or the fermentation conditions are: temperature of 28-32℃, aeration rate of 1.0-1.7 vvm, pH of 6.8-7.2, and / or, stirring is performed during fermentation at a speed of 400-800 rpm.

[0022] In a preferred embodiment of the present invention, the fermentation medium contains 80-150 g / L of glucose, the fermentation temperature is 30°C, the pH is 7.0, the aeration rate is 1.4 vvm, and the stirring speed is 600 rpm.

[0023] The fermentation medium described in this invention can be conventional in the art. The fermentation medium described in this invention is preferably a medium containing glucose, such as straw hydrolysate. The straw hydrolysate is formed by the degradation of large molecular carbohydrates such as cellulose, hemicellulose and lignin in crop straw into small molecular carbohydrates such as glucose after enzymatic hydrolysis and saccharification.

[0024] In accordance with conventional practice, ammonium sulfate, methionine, and threonine are generally added to the hydrolysate. In a preferred embodiment of the present invention, 15–25 g / L of ammonium sulfate, 2–8 g / L of methionine, and 2–8 g / L of threonine are added to the hydrolysate.

[0025] Furthermore, in accordance with conventional practice in the art, the crop straw can generally undergo pretreatment before enzymatic hydrolysis to prepare hydrolysate, including processes such as sieving, impurity removal, acid pretreatment, and / or detoxification. Pretreatment can improve the saccharification efficiency of crop straw. The detoxification treatment can reduce the content of toxic inhibitors such as acetic acid, furfural, 5-hydroxybenzaldehyde, furfural, hydroxymethylfurfural, 4-hydroxybenzaldehyde, and levulinic acid.

[0026] To solve the above-mentioned technical problems, the sixth technical solution provided by the present invention is: a method for preparing genetically engineered bacteria as described in the third technical solution, comprising the following steps (in no particular order):

[0027] (1) The expression cassette as described in one of the technical solutions, the nucleic acid as described in the second of the technical solutions, or the recombinant vector as described in the third of the technical solutions is introduced into the starting bacteria;

[0028] (2) Knock out the ldh gene to obtain the genetically engineered bacteria.

[0029] In a preferred embodiment of the present invention, the expression cassette as described in technical solution three, the nucleic acid as described in technical solution two, or the recombinant vector as described in technical solution three are first introduced into the starting bacteria, and the ldh gene is knocked out at the same time to obtain the genetically engineered bacteria.

[0030] To solve the above-mentioned technical problems, the seventh technical solution provided by the present invention is: the application of the expression cassette as described in the first technical solution, the nucleic acid as described in the second technical solution, the recombinant vector as described in the third technical solution, or the genetically engineered bacteria as described in the fourth technical solution in the preparation of L-lysine.

[0031] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0032] The reagents and raw materials used in this invention are all commercially available.

[0033] The positive and progressive effects of this invention are as follows:

[0034] The method for enhancing biotin synthase expression provided by this invention effectively regulates cell metabolism, improves glucose utilization efficiency, and thus increases L-lysine production. When using straw hydrolysate, the L-lysine production of the genetically engineered bacteria of this invention is significantly higher than that of the original bacteria. The genetically engineered bacteria provided by this invention can effectively utilize agricultural waste such as straw for fermentation and has good application prospects.

[0035] Information on the preservation of biological materials

[0036] The Corynebacterium glutamicum strain CathS141 of this invention was deposited on November 29, 2021, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, 430072, China, with accession number CCTCC NO: M20211495. The culture name is CathS141, and the taxonomic name is *Corynebacterium glutamicum* CathS141. Detailed Implementation

[0037] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0038] I. Strains used in this invention

[0039] Escherichia coli DH5α was used for the construction of expression plasmids and knockout plasmids.

[0040] Corynebacterium glutamicum CathS141 is a strain used for the production of lysine. In this experiment, CathS141 was mainly used as the starting strain.

[0041] II. Reagents and Culture Media

[0042] Cellulase CTec 2.0, used for hydrolyzing cellulose and hemicellulose in lignocellulose, was purchased from Novozymes (China) Co., Ltd., Beijing, China. The filter paper activity of cellulase was measured to be 203.2 FPU / mL, and the cellobiase activity was 4900.0 CBU / mL, according to the NREL LAP-006 guideline. The protein concentration was measured to be 87.3 mg / mL according to the Bradford method. Restriction endonucleases, used to cut plasmids or gene fragments to generate sticky ends, were purchased from Thermo Scientific (Wilmington, DE, USA). DNA polymerase was used to amplify gene fragments, and DNA ligase was used to ligate the digested gene fragments and plasmid vectors; both enzymes were purchased from Takara (Otsu, Japan). A seamless cloning kit was used to ligate gene fragments containing homologous fragments and plasmid vectors; this kit was purchased from Nanjin Biotechnology Co., Ltd., China. Plasmid extraction kits, PCR product purification and recovery kits, and gel extraction kits were purchased from Shanghai Jierui Biotechnology Co., Ltd., China. Other reagents were purchased from local suppliers.

[0043] The culture medium used to culture Escherichia coli was Luria-Bertani (LB) medium, with the following components: 10.0 g / L sodium chloride, 10.0 g / L peptone, and 5.0 g / L yeast extract.

[0044] The specific components of the culture medium used to cultivate Corynebacterium glutamicum are as follows: 1) Seed medium: 25 g / L glucose, 1.5 g / L potassium dihydrogen phosphate, 2.5 g / L urea, 0.6 g / L magnesium sulfate, and 25 g / L corn steep liquor. 2) Fermentation medium: 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, and 20 g / L corn steep liquor, with glucose added as a carbon source as needed.

[0045] Example 1: Obtaining the starting strain Corynebacterium glutamicum

[0046] Soil samples were collected from Wusu, Xinjiang. Each 1g of soil sample was added to 10mL of sterile water, vigorously mixed for 1 minute, and then allowed to settle for a period of time. The original samples were then diluted to 10 mL. -3 10 -4 10 -5 Spread the culture onto LB agar plates containing 100 mg / L nystatin and incubate at 30°C. After repeated streak isolation cultures, purified single colonies were obtained.

[0047] A strain capable of producing L-lysine was obtained through isolation and purification. The strain's cell characteristics and physiological and biochemical properties were determined according to the *Handbook of Systematic Identification of Common Bacteria*. The strain exhibited the following morphological characteristics: moist, round colonies with smooth surfaces, regular edges, and a light yellow color. DNA was extracted from the strain using a bacterial genomic DNA extraction kit. Using this DNA as a template, PCR amplification was performed using universal bacterial primers 27F and 1492R, and 16S rDNA was used. The 16S rDNA sequence was obtained and compared with the GenBank database, identifying the strain as *Corynebacterium glutamicum*.

[0048] Wheat straw was pretreated with acid, detoxified, and enzymatically hydrolyzed to obtain wheat straw hydrolysate. Using the *Corynebacterium glutamicum* strain isolated and purified above as the starting strain, stable strains capable of normal growth and lysine production were obtained through multiple individual and combined mutagenesis using ultraviolet light, nitrosoguanidine, 5-fluorouracil, and ARTP. This strain was named CathS141 and is currently deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China 430072, China, accession number CCTCC NO: M 20211495, deposited on November 29, 2021.

[0049] Example 2: Construction of the Peftu_cgl0072 expression box

[0050] An integrative plasmid of the biotin synthase cgl0072 gene was constructed as follows: Using the genome of C. glutamicum as a template, the Peftu promoter (as shown in SEQ ID NO:3) was amplified by PCR using primers Peftu-F (as shown in SEQ ID NO:4) and Peftu-R (as shown in SEQ ID NO:5); using the genome of C. glutamicum as a template, the cgl0072 fragment (as shown in SEQ ID NO:1) was amplified by PCR using primers cgl0072-F (as shown in SEQ ID NO:6) and cgl0072-R (as shown in SEQ ID NO:7); using Peftu and cgl0072 as templates, the Peftu_cgl0072 fusion fragment (as shown in SEQ ID NO:8) was obtained by overlapping extension PCR using primers Peftu-F and cgl0072-R.

[0051] SEQ ID NO.1 (cgl0072 nucleotide sequence)

[0052]

[0053] SEQ ID NO.2 (cgl0072 amino acid sequence)

[0054] MTIPGTILDTARTQVLEQGIGLNQQQLMEVLTLPEEQIPDLMELAHQVRLKWCGEEIEVEGIISLKTGGCPEDCHFCSQSGLFESPVRSVWLDIPNLVEAAKQTAKTGATEFCIVAAVKGPDERLMTQLEEAVLAIHSEVEIEVAASIGTLNKEQVDRLAAAGVHRYNHNLETARSYFPEVVTTHTWEERRETLRLVAEAGMEVCSGGILGMGETLEQRAEFAVQLAELDPHEVPMNFLDPRPGTPFADRELMDSRDALRSIGAFRLAMPHTMLRFAGGRELTLGDKGSEQALLGGINAMIVGNYLTTLGRPMEDDLDMMDRLQLPIKVLNKVI

[0055] SEQ ID NO.3 (Peftu)

[0056] cgaaaagcaatttgcttttcgacgccccaccccgcgcgttttagcgtgtcagtaggcgcgtagggtaagtggggtagcggcttgttagatatcttgaaatcggctttcaacagcattgatttcgatgtatttagctggccgttaccctgcgaatgtccacagggtagctggtagtttgaaaatcaacgccgttgcccttaggattcagtaactggcacattttgtaatgcgctagatctgtgtgctcagtcttccaggctgcttatcacagtgaaagcaaaaccaattcgtggctgcgaaagtcgtagccaccacgaagtccaggaggacataca

[0057] Peftu-F: gaaatcaggaagtgggatcgaaacgaaaagcaatttgcttttcgacg SEQ ID NO:4

[0058] Peftu-R: tgtatgtcctcctggacttcgtg SEQ ID NO:5

[0059] cgl0072-F:cacgaagtccaggaggacatacaatgaccatccccggcacca SEQ ID NO:6

[0060] cgl0072-R:gcgtcgccaactaggcgccaaagatttagatgaccttattaaggactttgatgg SEQID NO:7

[0061] SEQ ID NO.8(Peftu_cgl0072)

[0062]

[0063] Example 3: Integration of the Peftu_cgl0072 expression cassette into the genome

[0064] Using the genome of *C. glutamicum* as a template, the ldh-up fragment (as shown in SEQ ID NO: 9) was amplified by PCR using primers ldh-up-F (as shown in SEQ ID NO: 9) and ldh-up-R (as shown in SEQ ID NO: 10) (as shown in SEQ ID NO: 11). Using the genome of *C. glutamicum* as a template, the ldh-down fragment (as shown in SEQ ID NO: 12) was amplified by PCR using primers ldh-down-F (as shown in SEQ ID NO: 13) and ldh-down-R (as shown in SEQ ID NO: 13) (as shown in SEQ ID NO: 11). (As shown in NO:14); Using the ldh-up fragment, Peftu_cgl0072, and ldh-down fragment as templates, the Δldh::cgl0072 fusion fragment was obtained by overlap extension PCR using ldh-up-F and ldh-down-R primers. This fragment was then treated with EcoRI and HindIII restriction enzymes, and subsequently inserted into the pK18mob plasmid (available for purchase at http: / / www.biovector.net / product / 1089.html) using T4 ligase, resulting in the pK18-Δldh::cgl0072 plasmid. During this process, successfully ligated plasmids can be screened using seed culture plates containing kanamycin resistance.

[0065] ldh-up-F:tcccccgggggaacaccatgcgattaaggtgc SEQ ID NO:9

[0066] ldh-up-R:caaattgcttttcgtttcgatcccacttcctgatttccctaac SEQ ID NO:10

[0067] SEQ ID NO.11(ldh-up)

[0068] ggaacaccatgcgattaaggtgcgctgcttgaattgcagaattatgcaagatgcgccgcaacaaaacgcgatcggccaaggtcaaagtggtcaatgtaatgaccgaaaccgctgcgatgaaactaatccacggcggtaaaaacctctcaattaggagcttgacctcattaatgctgtgctgggttaattcgccggtgatcagcagcgcgccgtaccccaaggtgccgacactaatgcccgcgatcgtctccttcggtccaaaattcttctgcccaatcagccggatttgggtgcgatgcctgatcaatcccacaaccgtggtggtcaacgtgatggcaccagttgcgatgtgggtggcgttgtaaattttcctggatacccgccggttggttctggggaggatcgagtggattcccgtcgctgacgcatgccccaccgcttgtaaaacagccaggttagcagccgtaacccaccacggtttcggcaacaatgacggcgagagagcccaccacattgcgatttccgctccgataaagccagcgcccatatttgcagggaggattcgcctgcggtttggcgacattcggatccccggaaccagctctgcaatcacctgcgcgccgagggaagcgaggtgggtggcaggttttagtgcgggtttaagcgttgccaggcgagtggtgagcagagacgctagtctggggagcgaaaccatattgagtcatcttggcagagcatgcacaattctgcagggcatagattggttttgctcgatttacaatgtgattttttcaacaaaaataacacatggtctgaccacattttcggacataatcgggcataattaaaggtgtaacaaaggaatccgggcacaagctcttgctgattttctgagctgctttgtgggttgtccggttagggaaatcaggaagtgggatcgaaa

[0069] ldh-down-F:caaggactccattaacggttaaatctttggcgcctagttggc SEQ ID NO:12

[0070] ldh-down-R:gtaagcttgtctgggacgttgatgacgctg SEQ ID NO:13

[0071] SEQ ID NO.14(ldh-down)

[0072] atctttggcgcctagttggcgacgcaagtgtttcattggaacacttgcgctgccaactttttggtttacgggcaaaatgaaactgttggatggaatttaaagtgtttgtagcttaaggagctcaaatgaatgagtttgaccaggacattctccaggagatcaagactgaactcgacgagttaattctagaacttgatgaggtgacacaaactcacagcgaggccatcgggcaggtctccccaacccattacgttggtgcccgcaacctcatgcattacgcgcatcttcgcaccaaagacctccgtggcctgcagcaacgcctctcctctgtgggagctacccgcttgactaccaccgaaccagcagtgcaggcccgcctcaaggccgcccgcaatgttatcggagctttcgcaggtgaaggcccactttatccaccctcagatgtcgtcgatgccttcgaagatgccgatgagattctcgacgagcacgccgaaattctccttggcgaacccctaccggatactccatcctgcatcatggtcaccctgcccaccgaagccgccaccgacattgaacttgtccgtggcttcgccaaaagcggcatgaatctagctcgcatcaactgtgcacacgacgatgaaaccgtctggaagcagatgatcgacaacgtccacaccgttgcagaagaagttggccgggaaatccgcgtcagcatggaccttgccggaccaaaagtacgcaccggcgaaatcgccccaggcgcagaagtaggtcgcgcacgagtaacccgcgacgaaaccggaaaagtactgacgcccgcaaaactgtggatcaccgcccacggctccgaaccagtcccagcccccgaaagcctgcccggtcgccccgctctgccgattgaagtcaccccagaatggttcgacaaactagaaatcggcagcgtcatcaacgtcccagac

[0073] Next, the integration plasmid pK18-Δldh::cgl0072 was transformed into C. glutamicum by electroporation. Then, the strain that underwent correct homologous recombination was screened by PCR verification to obtain recombinant Corynebacterium glutamicum, named cg0072.

[0074] Example 4: Production of L-Lysine by Fermentation Using Genetically Engineered Strains

[0075] The genetically engineered strain and the parental strain *Corynebacterium glutamicum*, CathS141, were inoculated into seed culture medium for two rounds of activation, and then transferred to fermentation medium. The fermentation medium consisted of 1 g / L potassium dihydrogen phosphate, 3 g / L urea, 0.6 g / L magnesium sulfate, 20 g / L corn steep liquor, and 80 g / L glucose as a carbon source. Fermentation was carried out in 250 mL shake flasks at 30°C and 200 rpm. NMR analysis showed that the genetically engineered strain cg0072 produced 22.70 g / L of L-lysine, which was 14.08% higher than the control strain (P<0.05). This indicates that enhancing biotin synthase improved the L-lysine conversion efficiency of *Corynebacterium glutamicum*.

[0076] Example 5: Construction of a gene-engineered strain library of gene cgl0072 mutant

[0077] The cgl0072 gene was subjected to error-prone PCR according to the method and steps in patent CN110343675A. Then, a cgl0072 mutant plasmid library was constructed according to Example 2. A cgl0072 genetically engineered mutant library was constructed according to Example 3. The mutant library was evaluated according to Example 4, and a mutant strain with a lysine yield of 23.96 g / L was obtained, named cg0072-m86.

[0078] Using the cg0072-m86 mutant strain gene as a template, PCR amplification was performed using primers seq0072-F (as shown in SEQ ID NO:15) and seq0072-R (as shown in SEQ ID NO:16), followed by sequencing analysis of the amplified fragment. Analysis revealed two amino acid mutations, V115G and G288A, in the cg0072-m86 mutant. Therefore, it is speculated that these two mutations are important factors in further increasing the yield of cg0072-m86.

[0079] seq0072-F:atgaccatccccggcaccatc SEQ ID NO:15

[0080] seq0072-R:ttagatgaccttattaaggactttgatgg SEQ ID NO:16

[0081] SEQ ID NO.17 (cgl0072 mutant nucleotide sequence)

[0082]

[0083] Example 6: Fermentation of genetically engineered bacteria cg0072-m86 in lignocellulose hydrolysate

[0084] Wheat straw was crushed and then sieved through a 10 mm diameter sieve. The sieved straw was then washed to remove impurities such as mud, stones, and metal. After drying to constant weight in a 105℃ oven, it was stored in sealed plastic bags for later use. Following acid pretreatment, biological detoxification, and enzymatic saccharification, a wheat straw hydrolysate containing 95.4 g / L glucose was obtained. 20 g / L ammonium sulfate and 5 g / L methionine and threonine were added to the hydrolysate. The modified genetically engineered strain cg0072-m86 and the original strain CathS141 were cultured in the wheat straw hydrolysate for comparative fermentation. The fermentation temperature was 30℃, the pH was controlled at 7.0 with ammonia, the aeration rate was 1.4 vvm, and the fermentation speed was 600 rpm. Fermentation was terminated when glucose was exhausted.

[0085] The results showed that when wheat straw hydrolysate was used as the culture medium, there was a significant difference in lysine production between the two strains. The final lysine production of the genetically engineered strain was 15.54% higher than that of the control strain. Notably, the genetically engineered strain ended fermentation 9 hours earlier. Therefore, based on the difference in fermentation time, the production intensity (lysine production per unit time) of the genetically engineered strain cg0072-m86 was 30.72% higher than that of the control strain. When using *Corynebacterium glutamicum* B253 as the starting strain, and modifying it using the same method as strain cg0072-m86, a strain named B253-m86 was obtained. Verifying its fermentation effect under the same conditions, it was found that the final lysine production of B253-m86 was 15.51% higher than that of the control strain. Simultaneously, the genetically engineered strain B253-m86 also ended fermentation 9 hours earlier than strain B253. Therefore, the recombinant strain obtained in this invention has a high efficiency in lysine production in real material hydrolysate, and thus has good application prospects.

[0086] The above description of operational examples of the technical solution of the present invention is not intended to limit the application of the present invention. Any equivalent substitutions of operational conditions are within the protection scope of the present invention. SEQUENCE LISTING <110> Shanghai Kaisai Biotechnology Co., Ltd. CIBT USA <120> Expression cassettes, strains, and applications for the fermentation production of L-lysine. <130> P21018730C <160> 17 <170> PatentIn version 3.5 <210> 1 <211> 1005 <212> DNA <213> Corynebacterium glutamicum <400> 1 atgaccatcc ccggcaccat ccttgacacc gcccgcaccc aagttctgga acaggggaatt 60 ggccttaatc agcagcagtt gatggaggtt ctcaccttgc ctgaagagca aatcccagac 120 ttgatggaat tagcccacca ggttcggttg aagtggtgtg gggaagaaat cgaggtcgag 180 ggcattattt ccctcaaaac tggcggttgc cctgaagatt gtcatttctg ctcacagtct 240 gggttgtttg aatcgccggt gcgttcggtg tggctggata ttccgaatct ggttgaagcc 300 gctaaacaga ccgcaaaaac tggcgctacc gaattctgta tcgtcgccgc agtcaagggg 360 cctgatgaga ggctcatgac ccagctggag gaagcagtcc tcgcgattca ctctgaagtt 420 gaaattgaag tcgcagcatc gatcggaacg ttaaataagg aacaggtgga tcgcctcgct 480 gctgccggcg tgcaccgcta caaccataat ttggaaactg cgcgttccta tttccctgaa 540 gttgtcacca ctcatacatg ggaagagcgc cgcgaaactt tgcgcctggt ggcagaagct 600 ggaatggaag tctgttccgg cggaatctta ggaatgggcg aaactttaga gcagcgcgcc 660 gagtttgccg tgcagctggc ggagcttgat ccgcacgaag tccccatgaa cttccttgat 720 cctcgcccgg gcaccccatt tgccgatagg gaattgatgg acagccgtga cgctctgcgc 780 tctattggtg cgttccgcct tgcgatgcct cacaccatgc ttcgttttgc tggcggtcgc 840 gagctgactt tgggcgacaa gggttccgag caagccctcc tgggaggcat caatgcgatg 900 atcgtcggaa actacctgac tacgctcggc cgcccaatgg aagatgacct cgacatgatg 960 gatcgtctcc agctgcccat caaagtcctt aataaggtca tctaa 1005 <210> 2 <211> 334 <212> PRT <213> Corynebacterium glutamicum <400> 2 Met Thr Ile Pro Gly Thr Ile Leu Asp Thr Ala Arg Thr Gln Val Leu 1 5 10 15 Glu Gln Gly Ile Gly Leu Asn Gln Gln Gln Leu Met Glu Val Leu Thr 20 25 30 Leu Pro Glu Glu Gln Ile Pro Asp Leu Met Glu Leu Ala His Gln Val 35 40 45 Arg Leu Lys Trp Cys Gly Glu Glu Ile Glu Val Glu Gly Ile Ile Ser 50 55 60 Leu Lys Thr Gly Gly Cys Pro Glu Asp Cys His Phe Cys Ser Gln Ser 65 70 75 80 Gly Leu Phe Glu Ser Pro Val Arg Ser Val Trp Leu Asp Ile Pro Asn 85 90 95 Leu Val Glu Ala Ala Lys Gln Thr Ala Lys Thr Gly Ala Thr Glu Phe 100 105 110 Cys Ile Val Ala Ala Val Lys Gly Pro Asp Glu Arg Leu Met Thr Gln 115 120 125 Leu Glu Glu Ala Val Leu Ala Ile His Ser Glu Val Glu Ile Glu Val 130 135 140 Ala Ala Ser Ile Gly Thr Leu Asn Lys Glu Gln Val Asp Arg Leu Ala 145 150 155 160 Ala Ala Gly Val His Arg Tyr Asn His Asn Leu Glu Thr Ala Arg Ser 165 170 175 Tyr Phe Pro Glu Val Val Thr Thr His Thr Trp Glu Glu Arg Arg Glu 180 185 190 Thr Leu Arg Leu Val Ala Glu Ala Gly Met Glu Val Cys Ser Gly Gly 195 200 205 Ile Leu Gly Met Gly Glu Thr Leu Glu Gln Arg Ala Glu Phe Ala Val 210 215 220 Gln Leu Ala Glu Leu Asp Pro His Glu Val Pro Met Asn Phe Leu Asp 225 230 235 240 Pro Arg Pro Gly Thr Pro Phe Ala Asp Arg Glu Leu Met Asp Ser Arg 245 250 255 Asp Ala Leu Arg Ser Ile Gly Ala Phe Arg Leu Ala Met Pro His Thr 260 265 270 Met Leu Arg Phe Ala Gly Gly Arg Glu Leu Thr Leu Gly Asp Lys Gly 275 280 285 Ser Glu Gln Ala Leu Leu Gly Gly Ile Asn Ala Met Ile Val Gly Asn 290 295 300 Tyr Leu Thr Thr Leu Gly Arg Pro Met Glu Asp Asp Leu Asp Met Met 305 310 315 320 Asp Arg Leu Gln Leu Pro Ile Lys Val Leu Asn Lys Val Ile 325 330 <210> 3 <211> 335 <212> DNA <213> Corynebacterium glutamicum <400> 3 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtaggcgcg 60 tagggtaagt ggggtagcgg cttgttagat atcttgaaat cggctttcaa cagcattgat 120 ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 180 aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg 240 tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa 300 agtcgtagcc accacgaagt ccaggaggac ataca 335 <210> 4 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Peftu‑F <400> 4 gaaatcagga agtgggatcg aaacgaaaag caatttgctt ttcgacg 47 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Peftu‑R <400> 5 tgtatgtcct cctggacttc gtg 23 <210> 6 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> cgl0072‑F <400> 6 cacgaagtcc aggaggacat acaatgacca tccccggcac ca <210> 7 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> cgl0072‐R <400> 7 gcgtcgccaa ctaggcgcca aagatttag tgaccttatt aaggactttg atgg <210> 8 <211> 1340 <212> DNA <213> Artificial Sequence <220> <223> Peftu_cgl0072 <400> 8 cgaaaagcaa tttgcttttc gacgccccac cccgcgcgtt ttagcgtgtc agtagcgcg tagggtagt ggggtagcgg cttgttagat atcttgaat cggctttcaa cagcattgat ttcgatgtat ttagctggcc gttaccctgc gaatgtccac agggtagctg gtagtttgaa 240. aatcaacgcc gttgccctta ggattcagta actggcacat tttgtaatgc gctagatctg tgtgctcagt cttccaggct gcttatcaca gtgaaagcaa aaccaattcg tggctgcgaa agtcgtagcc accacgaagt ccaggaggac attack catccccggc accatccttg acaccgcccg cacccaagtt ctggaacagg gaattggcct taatcagcag cagttgatgg 420 aggttctcac cttgcctgaa gagcaaatcc cagacttgat ggaattagcc caccaggttc 480 ggttgaagtg gtgtggggaa gaaatcgagg tcgagggcat tatttccctc aaaactggcg 540 gttgccctga agattgtcat ttctgctcac agtctgggtt gtttgaatcg ccggtgcgtt 600 cggtgtggct ggatattccg aatctggttg aagccgctaa acagaccgca aaaactggcg 660 ctaccgaatt ctgtatcgtc gccgcagtca aggggcctga tgagaggctc atgacccagc 720 tggaggaagc agtcctcgcg attcactctg aagttgaaat tgaagtcgca gcatcgatcg 780 gaacgttaaa taaggaacag gtggatcgcc tcgctgctgc cggcgtgcac cgctacaacc 840 ataatttgga aactgcgcgt tcctatttcc ctgaagttgt caccactcat acatgggaag 900 agcgccgcga aactttgcgc ctggtggcag aagctggaat ggaagtctgt tccggcggaa 960 tcttaggaat gggcgaaact ttagagcagc gcgccgagtt tgccgtgcag ctggcggagc 1020 ttgatccgca cgaagtcccc atgaacttcc ttgatcctcg cccgggcacc ccatttgccg 1080 atagggaatt gatggacagc cgtgacgctc tgcgctctat tggtgcgttc cgccttgcga 1140 tgcctcacac catgcttcgt tttgctggcg gtcgcgagct gactttgggc gacaagggtt 1200 ccgagcaagc cctcctggga ggcatcaatg cgatgatcgt cggaaactac ctgactacgc 1260 tcggccgccc aatggaagat gacctcgaca tgatggatcg tctccagctg cccatcaaag 1320 tccttaataa ggtcatctaa 1340 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ldh‑up‑F <400> 9 tcccccgggg gaacaccatg cgattaaggt gc 32 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> ldh‑up‑R <400> 10 caaattgctt ttcgtttcga tcccacttcc tgatttccct aac 43 <210> 11 <211> 943 <212> DNA <213> Artificial Sequence <220> <223> ldh‑up <400> 11 ggaacaccat gcgattaagg tgcgctgctt gaattgcaga attatgcaag atgcgccgca 60 acaaaacgcg atcggccaag gtcaaagtgg tcaatgtaat gaccgaaacc gctgcgatga 120 aactaatcca cggcggtaaa aacctctcaa ttaggagctt gacctcatta atgctgtgct 180 gggttaattc gccggtgatc agcagcgcgc cgtaccccaa ggtgccgaca ctaatgcccg 240 cgatcgtctc cttcggtcca aaattcttct gcccaatcag ccggatttgg gtgcgatgcc 300 tgatcaatcc cacaaccgtg gtggtcaacg tgatggcacc agttgcgatg tgggtggcgt 360 tgtaaatttt cctggatacc cgccggttgg ttctggggag gatcgagtgg attcccgtcg 420 ctgacgcatg ccccaccgct tgtaaaacag ccaggttagc agccgtaacc caccacggtt 480 tcggcaacaa tgacggcgag agagcccacc acattgcgat ttccgctccg ataaagccag 540 cgcccatatt tgcagggagg attcgcctgc ggtttggcga cattcggatc cccggaacca 600 gctctgcaat cacctgcgcg ccgagggaag cgaggtgggt ggcaggtttt agtgcgggtt 660 taagcgttgc caggcgagtg gtgagcagag acgctagtct ggggagcgaa accatattga 720 gtcatcttgg cagagcatgc acaattctgc agggcataga ttggttttgc tcgatttaca 780 atgtgatttt ttcaacaaaa ataacacatg gtctgaccac attttcggac ataatcgggc 840 ataattaaag gtgtaacaaa ggaatccggg cacaagctct tgctgatttt ctgagctgct 900 ttgtgggttg tccggttagg gaaatcagga agtgggatcg aaa 943 <210> 12 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> ldh‑down‑F <400> 12 caaggactcc attaacggtt aaatctttgg cgcctagttg gc 42 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ldh‑down‑R <400> 13 gtaagcttgt ctgggacgtt gatgacgctg 30 <210> 14 <211> 959 <212> DNA <213> Artificial Sequence <220> <223> ldh‑down <400> 14 atctttggcg cctagttggc gacgcaagtg tttcattgga acacttgcgc tgccaacttt 60 ttggtttacg ggcaaaatga aactgttgga tggaatttaa agtgtttgta gcttaaggag 120 ctcaaatgaa tgagtttgac caggacattc tccaggagat caagactgaa ctcgacgagt 180 taattctaga acttgatgag gtgacacaaa ctcacagcga ggccatcggg caggtctccc 240 caacccatta cgttggtgcc cgcaacctca tgcattacgc gcatcttcgc accaaagacc 300 tccgtggcct gcagcaacgc ctctcctctg tgggagctac ccgcttgact accaccgaac 360 cagcagtgca ggcccgcctc aaggccgccc gcaatgttat cggagctttc gcaggtgaag 420 gcccacttta tccaccctca gatgtcgtcg atgccttcga agatgccgat gagattctcg 480 acgagcacgc cgaaattctc cttggcgaac ccctaccgga tactccatcc tgcatcatgg 540 tcaccctgcc caccgaagcc gccaccgaca ttgaacttgt ccgtggcttc gccaaaagcg 600 gcatgaatct agctcgcatc aactgtgcac acgacgatga aaccgtctgg aagcagatga 660 tcgacaacgt ccacaccgtt gcagaagaag ttggccggga aatccgcgtc agcatggacc 720 ttgccggacc aaaagtacgc accggcgaaa tcgccccagg cgcagaagta ggtcgcgcac 780 840. 840. aaaactgtgg atcaccgccc acggctccga accagtccca gcccccgaaa gcctgcccgg tcgccccgct ctgccgattg aagtcacccc agaatggttc gacaaactag aaatcggcag cgtcatcaac gtcccagac 959. <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> seq0072‐F <400> 15 atgaccatcc ccggcaccat c <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> seq0072‐R <400> 16 ttagatgacc ttattagga ctttgatgg <210> 17 <211> 1005 <212> DNA <213> Artificial Sequence <220> <223> cgl0072Enabled licensed license plate <400> 17 atgaccatcc ccggcaccat ccttgacacc gcccgcaccc aagttctgga acagggaatt ggccttaatc agcagcagtt gatggaggtt ctcaccttgc ctgaagagca aatcccagac ttgatggaat tagcccacca ggttcggttg aagtggtgtg gggaagaaat cgaggtcgag 180 ggcattattt ccctcaaaac tggcggttgc cctgaagatt gtcatttctg ctcacagtct 240 gggttgtttg aatcgccggt gcgttcggtg tggctggata ttccgaatct ggttgaagcc 300 gctaaacaga ccgcaaaaac tggcgctacc gaattctgta tcggcgccgc agtcaagggg 360 cctgatgaga ggctcatgac ccagctggag gaagcagtcc tcgcgattca ctctgaagtt 420 gaaattgaag tcgcagcatc gatcggaacg ttaaataagg aacaggtgga tcgcctcgct 480 gctgccggcg tgcaccgcta caaccataat ttggaaactg cgcgttccta tttccctgaa 540 gttgtcacca ctcatacatg ggaagagcgc cgcgaaactt tgcgcctggt ggcagaagct 600 ggaatggaag tctgttccgg cggaatctta ggaatgggcg aaactttaga gcagcgcgcc 660 gagtttgccg tgcagctggc ggagcttgat ccgcacgaag tccccatgaa cttccttgat 720 cctcgcccgg gcaccccatt tgccgatagg gaattgatgg acagccgtga cgctctgcgc 780 tctattggtg cgttccgcct tgcgatgcct cacaccatgc ttcgttttgc tggcggtcgc 840 gagctgactt tgggcgacaa ggcttccgag caagccctcc tgggaggcat caatgcgatg 900 atcgtcggaa actacctgac tacgctcggc cgcccaatgg aagatgacct cgacatgatg 960 gatcgtctcc agctgcccat caaagtcctt aataaggtca tctaa 1005

Claims

1. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria were transformed with an expression cassette or a recombinant expression vector containing the expression cassette; and the genetically engineered bacteria did not express lactate dehydrogenase. The expression cassette contains a promoter and a biotin synthase gene from Corynebacterium glutamicum, and the amino acid sequence of the biotin synthase differs from that of SEQ ID NO: 2 in the amino acid sequences V115G and G288A. Furthermore, the originating strain of the genetically engineered bacteria is Corynebacterium glutamicum (…). Corynebacterium glutamicum ).

2. The genetically engineered bacteria as described in claim 1, characterized in that, The originating bacteria are Corynebacterium glutamicum B253 or Corynebacterium glutamicum CathS141, wherein the accession number of Corynebacterium glutamicum CathS141 is CCTCC NO: M20211495.

3. The genetically engineered bacteria as described in claim 1, characterized in that, The nucleotide sequence encoding the biotin synthase gene is shown in SEQ ID NO: 17; and / or, the promoter is Peftu, whose nucleotide sequence is shown in SEQ ID NO:

3.

4. The genetically engineered bacteria as described in claim 1, characterized in that, The backbone plasmid of the recombinant expression vector is pK18mob.

5. The genetically engineered bacteria as described in claim 1, characterized in that, When the expression cassette or the recombinant expression vector is transferred into the starting bacterium, it is integrated into the genome of the genetically engineered bacterium through homologous recombination.

6. The genetically engineered bacteria as described in claim 1, characterized in that, The genes of the genetically engineered bacteria ldh It was knocked out.

7. The genetically engineered bacterium as described in claim 1, wherein the expression cassette or the recombinant expression vector is transferred into the starting bacterium, thereby integrating the expression cassette into its genome. ldh Gene loci, in which genes ldh The locus_tag is SB89_13725.

8. A method for preparing L-lysine, characterized in that, The method includes fermenting the genetically engineered bacteria as described in any one of claims 1 to 7 in a fermentation medium; The fermentation medium is a medium containing not less than 25 g / L glucose; and / or the fermentation conditions are: temperature 28-32℃, aeration rate of 1.0-1.7 vvm, pH of 6.8-7.2; and / or, stirring is performed during fermentation at a speed of 400-800 rpm.

9. The method as described in claim 8, characterized in that, The fermentation medium contains 80-150 g / L of glucose, the fermentation temperature is 30℃, the pH is 7.0, the aeration rate is 1.4 vvm, and the stirring speed is 600 rpm.

10. The method as described in claim 8, characterized in that, The fermentation medium is a lignocellulose hydrolysate.

11. The method as described in claim 10, characterized in that, The fermentation medium is straw hydrolysate, which is a hydrolysate formed by enzymatic hydrolysis and saccharification of crop straw.

12. The method as described in claim 11, characterized in that, Ammonium sulfate, methionine, and threonine are added to the hydrolysate.

13. The method as described in claim 12, characterized in that, Add 15-25 g / L ammonium sulfate, 2-8 g / L methionine, and 2-8 g / L threonine to the hydrolysate.

14. The method as described in claim 11, characterized in that, The crop straw is pretreated before being enzymatically hydrolyzed and saccharified to prepare hydrolysate. The pretreatment includes screening, impurity removal, acid pretreatment and / or detoxification treatment.

15. A method for preparing genetically engineered bacteria, characterized in that, The steps include the following, and the order of these steps is not important: 1) Introduce the expression cassette or a recombinant expression vector containing the expression cassette into the starting bacteria; the starting bacteria is *Corynebacterium glutamicum* (…). Corynebacterium glutamicum ); The expression cassette contains a promoter and a biotin synthase gene from Corynebacterium glutamicum, and the amino acid sequence of the biotin synthase differs from that of SEQ ID NO: 2 in that the amino acids V115G and G288A are different. 2) Knockout ldh Genes, thus obtaining the genetically engineered bacteria.

16. The preparation method according to claim 15, characterized in that, The nucleotide sequence encoding the biotin synthase gene is shown in SEQ ID NO: 17; and / or, the promoter is Peftu, whose nucleotide sequence is shown in SEQ ID NO:

3.

17. The preparation method according to claim 15, characterized in that, The backbone plasmid of the recombinant expression vector is pK18mob.

18. The preparation method according to claim 15, characterized in that, The expression cassette or the recombinant expression vector is introduced into the starting bacteria, and the bacteria are simultaneously knocked out. ldh Genes, thus obtaining the genetically engineered bacteria.

19. The use of the genetically engineered bacteria as described in any one of claims 1 to 7 in the preparation of L-lysine.