Application of reagents for downregulating TINAGL1 gene in the preparation of tumor radiosensitizers

Abstract

The present invention provides a method for improving the radiosensitivity of glioblastoma cells and use of a reagent for downregulating TINAGL1 expression or inhibiting its function in preparing a tumor radiosensitizer. The expression of TINAGL1 gene in glioblastoma cells is downregulated by a gene knockout reagent or an interfering RNA, or the function of TINAGL1 protein is inhibited by an inhibitor, thereby improving the radiosensitivity of glioblastoma.

Description

Technical Field

[0001] The invention relates to application of a reagent for down-regulating TINAGL1 gene in preparing a tumor radiosensitizer, and belongs to the technical field of tumor radiosensitivity. Background Art

[0002] Glioblastoma is the most common, highly invasive and malignant primary brain tumor, characterized by high heterogeneity and low patient survival rate. Its main treatments include surgery, chemotherapy and radiotherapy, but these conventional treatments have limited effect on improving the prognosis of glioblastoma patients. The average survival time of patients is only about 14 months, and most patients relapse within two years. The 5-year survival rate of adult patients is less than 10%.

[0003] Radiotherapy is a traditional treatment method that uses high-dose radiation to kill tumor cells. It can induce single-strand or double-strand breaks in DNA, inhibit cell proliferation and cause most cell death. However, some cells can escape cell death and become overactive, which leads to radioresistance. Although certain progress has been made in the field of radiation oncology in recent years and some radiosensitizers are being developed, radioresistance remains a huge obstacle to the treatment of glioblastoma patients. Glioblastoma patients generally show radioresistance, which is one of the main reasons for their poor prognosis and high mortality rate. Therefore, revealing the mechanism of radioresistance and finding key targets to improve radiosensitivity have always been challenges that need to be solved urgently.

[0004] Tubular interstitial nephritis antigenlike 1 (TINAGL1) is a matrix cell protein; it was first discovered in tubulointerstitial nephritis tissue and is associated with tubular inflammation. It was later found that TINAGL1 also plays different roles in different tumor types. Studies have shown that TINAGL1 is considered a key factor in improving the prognosis of some patients with triple-negative breast cancer, and its low expression is a sign of poor prognosis in breast cancer. To date, there has been no research on the function of TINAGL1 in human glioblastoma, nor has there been any report on its role in the radiosensitivity of human glioblastoma. Summary of the invention

[0005] The present invention provides the use of a reagent for downregulating the TINAGL1 gene in the preparation of a tumor radiosensitizer, which can effectively solve the above problems.

[0006] The present invention is achieved in that:

[0007] A method for improving the radiosensitivity of glioblastoma cells, downregulating the expression of TINAGL1 gene, thereby improving the radiosensitivity. The method can be used for potential use in treating tumors, and can also be used for purposes other than treating tumors.

[0008] As a further improvement, the down-regulation of TINAGL1 gene expression is to use a gene knockout reagent, interfering RNA to down-regulate the expression of TINAGL1 gene in glioblastoma cells or to add a TINAGL1 protein inhibitor.

[0009] As a further improvement, the gene knockout is to design an sgRNA sequence for the TINAGL1 gene transcript, and knock out the TINAGL1 gene of glioblastoma cells through the CRISPR-Cas9 system.

[0010] As a further improvement, the sgRNA sequence is shown as SEQ ID NO.5-SEQ ID NO.8.

[0011] As a further improvement, the glioblastoma cells are human glioblastoma cells.

[0012] Use of an agent for downregulating TINAGL1 expression or inhibiting its function in the preparation of a glioblastoma radiosensitizer.

[0013] As a further improvement, the reagent for downregulating TINAGL1 expression or inhibiting its function is a TINAGL1 gene knockout reagent, an interfering RNA of the TINAGL1 gene, or a TINAGL1 protein inhibitor, but is not limited thereto, as long as it can downregulate TINAGL1 gene expression or downregulate the corresponding protein function. Among them, the TINAGL1 gene knockout reagent downregulates TINAGL1 gene expression to zero expression; the interfering RNA of the TINAGL1 gene partially downregulates TINAGL1 gene expression; the TINAGL1 protein inhibitor is a small molecule or neutralizing antibody that can inhibit the function of TINAGL1 protein.

[0014] As a further improvement, the gene knockout reagent includes an sgRNA sequence, whose sequence is shown in SEQ ID NO.5-SEQ ID NO.8.

[0015] A sgRNA sequence, whose sequence is shown in SEQ ID NO.5-SEQ ID NO.8.

[0016] The beneficial effects of the present invention are:

[0017] The reagent for downregulating TINAGL1 expression or inhibiting its function of the present invention can effectively improve the radiosensitivity of glioblastoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 This is a graph showing changes in TINAGL1 mRNA expression in human glioblastoma U251 cells after treatment with different doses of X-rays.

[0020] Figure 2 This is a graph showing changes in TINAGL1 protein expression levels in human glioblastoma U251 cells after treatment with 4Gy X-rays.

[0021] Figure 3 This is a schematic diagram of the structure of the pLVR-sgRNA-CMV-Cas9-GFP gene knockout vector. Among them, 5'-LTR: 5' long terminal repeat sequence; U6: promoter; Esp3I: restriction site; sgRNA: sgRNA insertion site; CMV: promoter; Cas9: Cas9 gene; SV40: SV40 nuclear localization sequence; GFP: green fluorescent protein gene; IRES: internal ribosome entry site; Neo: neomycin resistance gene; WPRE: hepatitis virus post-transcriptional regulatory element; 3'-LTR: 3' long terminal repeat sequence; Amp: ampicillin resistance gene; pUC Ori: replication origin.

[0022] Figure 4 This is the electrophoresis identification diagram of the PCR results of the positive clones constructed by the TINAGL1 gene knockout vector.

[0023] Figure 5 This is a diagram showing the efficiency of TINAGL1 gene knockout identified by Western blot after TINAGL1 gene knockout in human glioblastoma cells U251.

[0024] Figure 6 This figure shows the effect of TINAGL1 gene knockout on the clone-forming ability of human glioblastoma cells U251 under X-ray irradiation.

[0025] Figure 7 This is a graph showing changes in γ-H2AX expression identified by Western blot.

[0026] Figure 8 This is a graph showing changes in γ-H2AX levels identified by immunofluorescence.

[0027] Fig. 9 This figure shows the effect of TINAGL1 gene knockout on apoptosis of human glioblastoma U251 cells under X-ray irradiation. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention provided in the drawings is not intended to limit the scope of the invention claimed for protection, but merely represents the selected embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0029] The main reagents used in the examples of the present invention are shown in Table 1 below:

[0030] Table 1

[0031]

[0032]

[0033]

[0034] Example 1 Screening of differentially expressed genes TINAGL1 (GeneID: 64129) in human glioblastoma cells U251 after X-ray treatment

[0035] 1. Detection of changes in TINAGL1 mRNA expression in human glioblastoma U251 cells after treatment with different doses of X-rays:

[0036] The cells were inoculated into 6-well plates. When the cells were in the logarithmic growth phase, the cells were irradiated with 6MV X-rays at a dose rate of 0.5 Gy / min using a Varian Clinac 600C linear accelerator from the United States. The irradiation doses were 0, 2, 4, 6, and 8 Gy, respectively. Total RNA was extracted using the Trizol method 6 hours later. The extraction steps were as follows:

[0037] 1) Remove the culture medium from the cells, wash twice with PBS, add 1 mL of Trizol, and let stand at room temperature for 5 min;

[0038] 2) Add 0.2 mL of chloroform, mix manually for about 15 seconds, and let stand at room temperature for 2-3 minutes;

[0039] 3) Centrifuge at 12000g for 15 min at 4°C;

[0040] 4) Carefully aspirate the supernatant with a pipette tip and transfer it to a 1.5 mL RNase-free centrifuge tube;

[0041] 5) Add 0.7 mL of isopropanol, mix well, and let stand at room temperature for 10 min;

[0042] 6) Centrifuge at 10,000 g for 10 min at 4°C;

[0043] 7) Discard the supernatant, add 1.0 mL of 75% ethanol (prepared with Nuclease-Free Water), and mix well;

[0044] 8) Centrifuge at 7000 g for 5 min at 4 °C;

[0045] 9) Discard the supernatant, dry at room temperature for about 5 minutes, then dissolve in 30 μL of Nuclease-Free Water to obtain total cellular RNA, and store at -80°C for later use.

[0046] The above total RNA was reverse transcribed into cDNA as follows:

[0047] Add a certain volume of total RNA (2 μg) to a PCR tube, preheat at 70°C in a PCR instrument for 5 min, and then quickly transfer to ice. Add each component as shown in Table 2 to a total volume of 20 μL. Mix well, centrifuge, and place in a PCR instrument for amplification. The amplification program is 25°C for 5 min, 42°C for 60 min, 72°C for 15 min, and 4°C+∞.

[0048] Table 2

[0049]

[0050] The obtained cDNA was diluted 5 times and then subjected to Real-time PCR detection. The primer sequences used to detect the target gene TINAGL1 and the internal reference β-Actin were:

[0051] TINAGL1-F:5′-ATGGGACCCACTCAGTCAAGA-3′ (SEQ ID NO.1);

[0052] TINAGL1-R:5′-GTTGGCCGCAGTCCAGTATTT-3′ (SEQ ID NO.2);

[0053] β-Actin-F: 5′-AGAGCTACGAGCTGCCTGAC-3′ (SEQ ID NO. 3);

[0054] β-Actin-R: 5′-AGCACTGTGTTGGCGTACAG-3′ (SEQ ID NO. 4);

[0055] The real-time PCR reaction system is shown in Table 3. The amplification program is: 95°C for 5 min (Hold Stage); 95°C for 30 s, 60°C for 30 s, 40 cycles (PCR Stage); 95°C for 15 s, 60°C for 1 min, +0.15°C / s, 95°C for 1 s (Melt Curve Stage).

[0056] Table 3

[0057]

[0058] Real-time PCR results were analyzed using 2 –ΔΔCt The relative expression of mRNA was calculated by the method. The melting curves of each group showed a single peak. The results of three independent replicates were statistically analyzed using GraphPad Prism 5 software. The results are shown in Figure 1 It can be seen that the expression of TINAGL1 mRNA in human glioblastoma U251 cells was upregulated after being irradiated with different doses of X-rays, and the differences were statistically significant compared with the non-irradiated group (*P<0.05, **P<0.01, ***P<0.001).

[0059] Changes in TINAGL1 protein expression levels in human glioblastoma U251 cells after 2.4Gy X-ray treatment

[0060] Depend on Figure 1 The results show that TINAGL1 mRNA reaches a high level after 4Gy X-ray treatment, so human glioblastoma cells U251 were irradiated with this dose, and protein was extracted 24 hours later (the same below), the method is as follows:

[0061] 1) Take appropriate RIPA cell lysis buffer and add PMSF with a final concentration of 1 mM and 1× protease inhibitor cocktail a few minutes before use;

[0062] 2) Remove the cell culture medium, wash once with PBS, and add 100 μL of the above lysis solution to each well of the 6-well plate;

[0063] 3) After standing at room temperature for 5 min to allow cells to fully lyse, centrifuge at 12,000 g for 3 min, take the supernatant, and quantify each group of proteins using the BCA method according to the product instructions;

[0064] 4) Add loading buffer to a final concentration of 1×, boil in water for 10 min, and store at -80°C until use.

[0065] Western blot (the same below) was used to detect the changes in TINAGL1 protein expression levels as follows:

[0066] 1) After the protein is quantified by the BCA method, an equal amount is loaded on the SDS-PAGE gel, and the voltage is adjusted to 100V. The electrophoresis is performed for about 20 minutes so that the samples are compressed on the same horizontal line when entering the separation gel. The voltage is then increased to 150V until the bromophenol blue dye reaches the end of the gel and the electrophoresis is stopped;

[0067] 2) The protein was transferred onto a 0.22 μm pore size NC membrane using the S-TRANS rapid transfer kit;

[0068] Block with 5% skim milk powder (prepared with Tris-HCl buffer, i.e., TBST) at room temperature for 1 h; wash the membrane three times with TBST, 5 min each time;

[0069] 3) Anti-TINAGL1 and Anti-GAPDH primary antibodies were diluted with 1% BSA, incubated at 4°C overnight, and then washed with TBST 3 times, 5 min each time;

[0070] 4) Dilute the secondary antibody with 1% BSA, incubate at room temperature for 1 hour, wash the membrane three times with TBST, 10 minutes each time, add BeyoECL Moon (ultra-sensitive ECL substrate), and image using a Bio-Rad chemiluminescence exposure instrument.

[0071] The results of three independent replicates were analyzed by grayscale analysis using Image J software and statistical analysis was performed using GraphPad Prism 5 software. Figure 2 Compared with the control group, the TINAGL1 protein level of U251 cells increased significantly after 4Gy X-ray irradiation, and the difference was statistically significant (**P<0.01). In summary, after X-ray irradiation, both TINAGL1 mRNA and protein levels showed an upward trend, which may be related to the radiosensitivity of human glioblastoma U251 cells.

[0072] Example 2 Knockout of TINAGL1 gene (Gene ID: 64129) in human glioblastoma cells U251

[0073] 1. Design sgRNA

[0074] Design of sgRNA sequence targeting the second exon of TINAGL1:

[0075] Target 1: GGCAGCACAGGTCCTGCTCC (SEQ ID NO. 5);

[0076] Target 2: GACTGTGCCCTGCCCTACCT

[0077] Add ATCCg to the 5' end of the sgRNA to obtain a forward oligonucleotide sequence; according to the principle of base complementary pairing, obtain the complementary chain of the sgRNA, add AAAC to the 5' end of the complementary chain to obtain a reverse oligonucleotide sequence, and add c to the 3' end;

[0078] The synthesis information of sgRNA sequence targeting TINAGL1 gene is shown in Table 4:

[0079] Table 4

[0080] sequence 5' Target 3' sgRNA-F-1 ATCC GGCAGCACAGGTCCTGCTCC SEQ ID NO.5 sgRNA-R-1 aaac GGAGCAGGACCTGTGCTGCC c SEQ ID NO.6 sgRNA-F-2 ATCC GACTGTGCCCTGCCCTACCT SEQ ID NO.7 sgRNA-R-2 aaac AGGTAGGGCAGGGCACAGTC c SEQ ID NO.8

[0081] 2. Construction of gene knockout vector

[0082] 1) Dilute the above-mentioned paired oligo DNA single-stranded dry powder to 10 μM with Nuclease-Free Water, take 20 μL of each and mix well, denature at 90°C for 10 min, and anneal at room temperature. After annealing, a small double-stranded DNA fragment with a sticky end containing the Esp3I restriction site is formed;

[0083] 2) pLVR-sgRNA-CMV-Cas9-GFP gene knockout vector (see Figure 3 ) has an Esp3I restriction site, and the restriction endonuclease Esp3I is used for restriction digestion reaction. The system is as follows: Esp3I enzyme 1μL, 10× buffer 2μL, plasmid DNA 1μL, DTT (10mM) 1μL, add Nuclease-Free Water to a total volume of 20μL, and digest at 37℃ overnight. After digestion, the linearized pLVR-sgRNA-CMV-Cas9-GFP gene knockout vector large fragment is obtained, which is connected with the small and medium fragment double-stranded DNA in 1) and connected at 16℃ overnight. The connection system is shown in Table 5:

[0084] Table 5

[0085]

[0086] 3) Transform the vector into DH5α competent cells

[0087] Take 50 μL of E. coli competent cells and melt them on ice; add the above overnight ligation product, ice bath for 30 minutes, heat shock at 42°C for 90 seconds, put it back on ice immediately, and ice bath for another 2 minutes; add 400 μL LB culture medium, shake and culture in a constant temperature shaker at 180 rpm and 37°C for 60 minutes; take the above bacterial liquid and apply it on the LB solid culture medium containing Amp (100 μg / mL), wait for the liquid culture medium to be completely absorbed, and invert and culture at 37°C overnight.

[0088] 4) PCR identification of positive clones

[0089] The monoclonal colony was picked up with a pipette tip and placed in 1 mL of LB medium containing Amp, and cultured in a shaker at 180 rpm and 37°C for about 6 h, followed by PCR identification. The upstream primer was the positive sequence of the above sgRNA sequence, i.e., sgRNA-F-1 (ATCCGGGCAGCACAGGTCCTGCTCC) (SEQ ID NO.5) or sgRNA-F-2 (ATCCGGACTGTGCCCTGCCCTACCT) (SEQ ID NO.7), and the downstream primer used the plasmid universal consensus sequence (5'-CAAAACGCGACGAAGCGCTAC-3') (SEQ ID NO.9). The PCR amplification system is shown in Table 6:

[0090] Table 6

[0091]

[0092] The PCR program is: 95℃5min; 95℃30s, 60℃30s, 72℃45s, 35 cycles; 72℃7min; 12℃20min. Take 5μL of the amplified product for agarose gel electrophoresis analysis, the agarose concentration is 2%, the electrophoresis conditions are 150V, 20min, and the positive clone can show a 167bp amplification band. The results are shown in Figure 4 , the red arrows are the positive clones in the initial screening. The positive bacteria in the initial screening were sequenced to ensure the accuracy of the sequence.

[0093] 5) Positive bacteria amplification and plasmid extraction

[0094] According to the above identification results, the positive bacteria were added to LB medium containing Amp at a volume ratio of 1:100 for expansion culture, and cultured overnight in a constant temperature shaker at 180rpm and 37℃. Take 10-15mL of overnight cultured bacterial solution, extract plasmid DNA according to the instructions of the endotoxin-free plasmid mini-preparation kit, and quantify it.

[0095] 2. Knockout and verification of TINAGL1 gene in human glioblastoma U251 cells

[0096] 1) Cell transfection

[0097] One day in advance, appropriate amount of cells were seeded in 6-well plates, and the cell density reached about 70% on the next day; 1.5μg pLVR-sgRNA-1-CMV-Cas9-GFP plasmid DNA and 1.5μg pLVR-sgRNA-2-CMV-Cas9-GFP plasmid DNA were added to 150μL serum-free DMEM for dilution, mixed thoroughly, and prepared into nucleic acid diluent; 9μL TGfect transfection reagent was added to the above mixture, mixed thoroughly to make transfection reagent + DNA mixture, and after standing at room temperature for 5min, the transfection complex was added to the cells containing 2mL complete culture medium, and gently shaken to mix; after culturing in a 37℃, 5% CO2 incubator for 24h, the transfection mixture was discarded, and after 48h, a final concentration of 800μg / mL Neomycin was added for screening; after about 1 week, most of the cells were found to be dead, and 100μg / mL Continue to culture the cells with Neomycin, and after the cells recover, digest them with trypsin and resuspend them. After counting, use the infinite dilution method to inoculate the cells into a 96-well plate. After about 7 days, screen the wells that only grow a single clone and mark them; after the cells are fully grown, digest them and transfer them to a 24-well plate; after the 24-well plate is fully grown, digest them and transfer them to a 6-well plate.

[0098] 2) Western blot identification of TINAGL1 expression

[0099] After the cells in the 6-well plate are fully grown, 1 / 3 of the cells are digested and centrifuged, and the cells are added to the cell lysis buffer to extract the protein, and Western blot (the same method as before) is performed to identify the efficiency of TINAGL1 gene knockout. The results are as follows: Figure 5 The wild-type human glioblastoma cell U251 is abbreviated as WT, and the TINAGL1 gene knockout U251 cell clone is abbreviated as KO. It can be seen that the expression of TINAGL1 protein was not detected in the KO1 and KO2 group cells, and both were used for subsequent gene function studies.

[0100] Example 3 Effect of TINAGL1 gene knockout on the radiosensitivity of human glioblastoma U251 cells

[0101] Based on the results in Example 1, it was speculated that the expression of the TINAGL1 gene was related to the radiosensitivity of human glioblastoma cells U251, and the following technical scheme was designed for verification.

[0102] 1. Effect of TINAGL1 gene knockout on the clonal formation ability of human glioblastoma U251 cells under X-ray irradiation

[0103] The clone formation experiment can be used to evaluate the sensitivity of tumor cells to stimuli such as drugs and radiation. Wild-type human glioblastoma cells U251 (WT) and TINAGL1 gene knockout U251 (KO1 and KO2) in the logarithmic growth phase were taken, digested, centrifuged, resuspended and counted, 250 cells were inoculated in each well of a 12-well plate and 1 mL of complete culture medium was added. After the cells adhered to the wall, they were irradiated with 0, 2, 4, and 6 Gy X-rays. After about 2 weeks, obvious cell clones were visible. The culture medium was discarded and the cells were gently washed twice with PBS. Then they were fixed with 100% methanol for 15 minutes, washed once with PBS, and 0.1% crystal violet was added to immerse the cells. After 10 minutes, the crystal violet was aspirated and washed with deionized water until the wells were transparent. The Elispot system was used for imaging. Clones with more than 50 cells were defined as effective clones. The clone formation rate was calculated according to this standard, where the clone formation rate = (number of clones in the X-ray treatment group / number of clones in the control group) × 100%. The results are shown in Figure 2. Figure 6 It can be seen that the clone formation rate of each group of cells gradually decreased after being treated with different doses of X-ray irradiation, and it was dose-dependent; when the dose was 2Gy or 4Gy, the clone formation rate of TINAGL1 gene knockout group KO1 and KO2 group cells was significantly lower than that of wild-type WT group (*P<0.05).

[0104] 2. Effect of TINAGL1 gene knockout on DNA damage in human glioblastoma U251 cells under X-ray irradiation

[0105] γ-H2AX is closely related to double-strand DNA breaks. Under the action of various external physical and chemical stimulation factors (such as chemotherapy drugs, radiation, etc.), the double-strand DNA of the cell breaks, and γ-H2AX can be rapidly enriched in the double-strand break area. Therefore, its level can reflect the degree of DNA damage and is often used to analyze and predict the sensitivity of cells to radiation killing.

[0106] 1) Western blot analysis of changes in γ-H2AX expression

[0107] Cells in the logarithmic growth phase were irradiated with 4 Gy X-rays, and proteins were extracted 6 hours later. Western blot was used to identify the changes in γ-H2AX levels in the WT, KO1, and KO2 groups (the method was the same as above). Figure 7 After 4 Gy irradiation, the γ-H2AX levels in the TINAGL1 gene knockout groups KO1 and KO2 were significantly higher than those in the wild type WT (**P<0.01, ***P<0.001), indicating that gene knockout promoted DNA double-strand breaks.

[0108] 2) Immunofluorescence analysis of changes in γ-H2AX levels

[0109] Take the cells in the logarithmic growth phase and inoculate them in a small dish dedicated to confocal microscope. When the cells grow to 70-80% density, 4Gy X-ray irradiation is used. After 6 hours, the culture medium is aspirated, 1mL 4% paraformaldehyde is added to fix for 10 minutes, the fixative is aspirated, TBST working solution is added and placed on a shaker, and washed 3 times for 5 minutes each time; normal goat serum blocking solution is added to block for 30 minutes and shake gently; the blocking solution is removed, Anti-γ-H2AX rabbit antibody is diluted 1:100 with antibody diluent, and incubated in a 4℃ wet box overnight; the primary antibody is aspirated, TBST working solution is added and placed on a shaker to wash 3 times, 5 minutes each time; AF594-labeled fluorescent secondary antibody is added and incubated in the dark for 60 minutes; TBST is washed 3 times, 5 minutes each time; DAPI staining solution is added and incubated in the dark for 5 minutes, DAPI staining solution is discarded, and TBST is added to wash 3 times, 5 minutes each time; 1 drop of anti-fluorescence quencher is added to each small dish, and laser confocal microscope imaging is performed in time. The results are as follows Figure 8 It can be seen that after 4 Gy irradiation, the average fluorescence intensity of γ-H2AX in TINAGL1 gene knockout group KO1 and KO2 cells was significantly higher than that in wild type WT (*P<0.05, **P<0.01), further proving that gene knockout promoted DNA double-strand breaks.

[0110] 3) Effect of TINAGL1 gene knockout on apoptosis of human glioblastoma U251 cells under X-ray irradiation

[0111] Cells in logarithmic growth phase were seeded into 6-well plates. When the cells grew to a density of 70-80%, they were irradiated with 4Gy X-rays. After 48 hours, the cells were digested with EDTA-free trypsin, centrifuged, and washed once with PBS. The cells were then washed twice with BioLegend cell staining buffer, centrifuged, and resuspended with 100μL Annexin V Binding Buffer. 5μL APC Annexin V solution was added, followed by 5μL 7-AAD dye solution, and incubated at room temperature in the dark for 15 minutes. 400μL Binding Buffer was added to each tube and flow cytometry analysis was performed immediately. The results are shown in Figure 2. Fig. 9 After 4 Gy irradiation, the apoptosis rates of cells in the TINAGL1 gene knockout KO1 and KO2 groups were significantly higher than those in the wild type WT (*P<0.05, *P<0.05).

[0112] In summary, after X-ray irradiation, TINAGL1 gene knockout can reduce the cloning rate of human glioblastoma U251 cells, promote DNA double-strand breaks and promote cell apoptosis, that is, TINAGL1 gene knockout can increase the radiosensitivity of human glioblastoma U251 cells. This gene may be a potential molecular target for reducing radiation resistance and improving the efficacy of radiotherapy in glioblastoma patients.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for improving the radiosensitivity of glioblastoma cells in vitro, characterized in that: right TINAGL1 Gene knockout is performed to inhibit its function, thereby improving radiosensitivity; the gene knockout is directed against TINAGL1 The gene transcript is used to design sgRNA nucleotides, and the TINAGL1 gene of the glioblastoma cells is knocked out by the CRISPR-Cas9 system; the sense sequence of the sgRNA nucleotide is GGCAGCACAGGTCCTGCTCC or GACTGTGCCCTGCCCTACCT.

2. A TINAGL1 The use of a gene knockout agent in the preparation of a glioblastoma radiosensitizer is characterized in that: The gene knockout reagent includes sgRNA nucleotides, and the sense sequence of the sgRNA nucleotides is GGCAGCACAGGTCCTGCTCC or GACTGTGCCCTGCCCTACCT.

3. A targeted knockout TINAGL1 The sgRNA nucleotide of a gene is characterized in that The sense sequence of the sgRNA nucleotide is GGCAGCACAGGTCCTGCTCC or GACTGTGCCCTGCCCTACCT.

4. A TINAGL1 A gene knockout reagent, characterized in that Comprising the sgRNA nucleotide of claim 3.

Images