A MLO gene and its mutant gene and its application in improving barley powdery mildew resistance

Abstract

The present invention provides an MLO gene and its mutant gene and application in improving the powdery mildew resistance of barley, belonging to the field of bioengineering technology. The nucleotide sequence of the MLO gene is shown in SEQ ID NO.1 and SEQ ID NO.2. The MLO gene or its mutant gene can be used to construct barley with high powdery mildew resistance. The method of the present invention is simpler and more time-saving than natural, chemical and physical mutagenesis. The barley mutant plant obtained by the method of the present invention can be quickly applied to barley breeding, providing a basis for further breeding of barley with high resistance to powdery mildew.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to an MLO gene and a mutant gene thereof and applications in improving the resistance of barley to powdery mildew. Background Art

[0002] Transgenic technology has been applied in many plants, and the application of transgenic technology has led to rapid development of plant molecular biology. At the same time, with the completion of genome sequencing of humans and a variety of animals and plants, the research of life sciences has entered a post-genomic era with the purpose of revealing gene functions. Genome editing technology is undoubtedly the most important research tool and means in this era. Site-specific editing of crop genomes can accelerate the transformation of traditional empirical breeding to targeted, efficient precision breeding. The Crispr / Cas9 system is the latest method of genome editing technology. Compared with zinc finger nuclease technology (ZFN) and transcription activator-like effector nuclease technology (TALENs), Crispr / Cas9 is simple to operate and highly efficient. It has been widely used in genome editing of a variety of organisms such as humans, animals and plants. The combination of transgenic technology and gene editing technology can be used to cultivate disease-resistant, stress-resistant, high-quality and high-yield crop varieties.

[0003] Barley is the world's fourth largest cereal crop, with strong environmental adaptability and a wide range of planting. Barley powdery mildew is one of the main diseases of barley, mostly occurring in temperate humid and semi-humid areas, generally causing more than 20% yield loss, and up to 30% in severe cases. In the research and development of barley breeding in my country, there are few powdery mildew resistant source materials. The mutation of the MLO gene can make barley produce broad-spectrum resistance to powdery mildew, which can effectively inhibit the widespread spread of pathogens in farmland. At present, naturally mutated MLO gene materials have been widely used in spring barley breeding, but there are few reports in winter barley. Summary of the invention

[0004] The purpose of the present invention is to provide an MLO gene and a mutant gene thereof and use thereof in improving the powdery mildew resistance of barley, so as to provide a basis for further breeding of barley with high resistance to powdery mildew.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an MLO gene, the nucleotide sequence of the gene is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0007] The present invention provides a mutant gene of the MLO gene, and the nucleotide sequence of the mutant gene is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0008] The present invention provides application of the MLO gene or the mutant gene in improving the resistance to powdery mildew of barley.

[0009] The present invention provides a method for constructing high powdery mildew resistance barley using the MLO gene or the mutant gene, characterized in that it comprises the following steps:

[0010] (1) inserting the MLO gene shown in SEQ ID NO.1 and SEQ ID NO.2 into a vector containing a gene editor to obtain a recombinant vector;

[0011] (2) Transforming the recombinant vector obtained in step (1) into Agrobacterium;

[0012] (3) Using the Agrobacterium obtained in step (2) to transform barley microspore callus to obtain mutant plants.

[0013] Preferably, the gene editor comprises a CRISPR / Cas9 gene editor.

[0014] Preferably, the vector comprises pBUE411 vector.

[0015] The invention provides a recombinant vector for constructing high powdery mildew resistance barley, comprising the MLO gene.

[0016] The present invention also provides a primer designed according to the MLO gene, and the nucleotide sequence of the primer is shown in SEQ ID NO.5 and SEQ ID NO.6.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention provides an MLO gene and a mutant gene thereof. The MLO gene or the mutant gene thereof can be used to construct barley with high powdery mildew resistance. The method of the present invention is simpler and more time-saving than natural, chemical and physical mutagenesis. The barley mutant plants obtained by the method of the present invention can be quickly applied to barley breeding, providing a basis for further breeding of barley with high powdery mildew resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0020] Figure 1The results of the test using the PAT / bar rapid test paper in Example 1, wherein the red arrow indicates a positive band, '+' indicates a positive plant, and '-' indicates a negative plant;

[0021] Figure 2 The identification results of the mutant plants in Example 1;

[0022] Figure 3 The identification results of the mutant plants in Example 1, wherein the red frame indicates the mutation site;

[0023] Figure 4 This is the identification result of the powdery mildew resistance of the plants in Example 1. DETAILED DESCRIPTION

[0024] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0025] Example 1

[0026] The first 19 bp sequences of all PAM (XXG) regions on the CDS sequence of MLO (HORVU4Hr1G082710.2) were selected and these sequences were blasted in the barley genome database. It was finally found that the two genes had high specificity, and the nucleotide sequences of these two genes are shown in SEQ ID NO.1 (CGGACAAAAAAGGGGTGC) and SEQ ID NO.2 (TGCTCGTGTCCGTCCTC A). The above two genes were inserted into the pBUE411 vector containing the CRISPR / Cas9 gene editor (the promoter is TaU3p, and the vector is provided by China Agricultural University) to obtain a recombinant vector. The obtained recombinant vector was transferred into Agrobacterium C58C1 for subsequent genetic transformation.

[0027] Agrobacterium was used to transform barley 'Hua 22' microspore callus, and the transformation method was carried out according to CN 202111268013.3. The specific transformation method is:

[0028] 1. Extraction and cultivation of barley microspores

[0029] The barley material 'Hua 22' was planted in an artificial climate chamber, and the plant culture conditions were: temperature 18°C ​​at night, 20°C during the day; humidity 65%; 12 hours of light, 12 hours of darkness.

[0030] Select barley ears whose middle florets and microspores are in the early to middle stages of mononuclear development, cut off the leaves, retain about 1.5 cm from the base of the two upper leaves, wrap the young ears with clean wet gauze, put them in a fresh-keeping bag to keep them moist, mark the date and quantity of collection, etc., and put them in a 4°C refrigerator for 2 weeks of low-temperature pretreatment.

[0031] Microspores were isolated from the flower buds of the low temperature treated material. The isolation of microspores was carried out according to the method of Lu Ruiju et al. (Effects of colchicine on the survival and seedling formation of microspores in vitro culture of barley, Acta Physiologica Sinica, 2001, 27(2): 135-140).

[0032] Inoculate the flower buds of 4 ears in each test tube, add 12 mL of extract containing: mannitol 60 g / L, CaCl2 1.1 g / L, MES 0.976 g / L and colchicine 20 mg / L, pH 5.8, and use a high-speed disperser for ultra-speed rotary cutting.

[0033] The rotary cut suspension was filtered through a 300-mesh screen, and the filtrate was centrifuged at 700 rpm for 5 min, repeated 3 times, and the microspores were collected. The collected microspores were pretreated with the above-mentioned extract at 25°C in the dark for 2 days and then purified and cultured.

[0034] Before culture, the microspores were washed once with induction medium and the density was adjusted to 1.0×10 5 / mL, 1.5mL of microspore suspension was inoculated into a culture dish (30×15mm), sealed with Parafilm, and cultured in the dark at 25°C, wherein the induction medium used N6 medium as the basic medium, with double the iron salt, 90g / L maltose, 0.5mg / L KT, 1.0mg / L 2,4-D, and 0.976g / L MES, and the pH was 5.8.

[0035] After culturing for 20 days, the calli were transferred to solid induction medium for subculture.

[0036] The solid induction medium uses N6 medium as the basic medium, doubles the iron salt, is added with 90 g / L maltose, 0.5 mg / L KT, 1.0 mg / L 2,4-D, 0.976 g / L MES, and 3 g / L plant gel, with a pH of 5.8.

[0037] 2. Agrobacterium infection of barley microspore callus

[0038] When the callus tissue grows to 4 mm, Agrobacterium transformation is carried out, and Agrobacterium is propagated to OD600 = 0.6-0.8 using YEB medium, wherein the YEB medium contains 5 g / L beef extract, 1 g / L yeast extract, 5 g / L peptone, 5 g / L sucrose and 0.5 g / L MgSO4·H2O, pH 7.0.

[0039] The agrobacterium after propagation was centrifuged at 3000rpm for 5min, the supernatant was removed, and the process was repeated three times. Agrobacterium was diluted to OD 600 = 0.6-0.8 using microspore induction medium, and about 200 'Hua 22' microspore calli were inoculated into 40mL Agrobacterium for infection, wherein the induction medium used N6 medium as the basic medium, doubled the iron salt, added maltose 90g / L, KT0.5mg / L, 2,4-D 1.0mg / L, MES 0.976g / L, pH 5.8.

[0040] During infection, callus tissues of different groups were treated with 50 kPa negative pressure for 1 min each time for 3 times, and infection was continued for 30 min on a shaking table at 100 rpm.

[0041] The callus tissue was then placed on three layers of filter paper to absorb the bacterial liquid, and then transferred to a co-culture medium for 3 days for GUS staining. The co-culture medium used N6 medium as the basic medium with double the iron salt, and was supplemented with 90 g / L maltose, 0.5 mg / L KT, 1.0 mg / L 2,4-D, 0.976 g / L MES, 100 mg / L acetosyringone and 800 mg / L L-cysteine, with a pH of 5.8.

[0042] 3. Screening of transformed callus

[0043] After the infection is completed, the callus tissue is transferred to the screening medium and the callus tissue is screened using bialaphos. The screening lasts for 21 days to screen out the positive callus tissue.

[0044] Among them, the screening culture medium uses N6 culture medium as the basic culture medium, doubles the iron salt, and adds maltose 90g / L, KT0.5mg / L, 2,4-D 1.0mg / L, MES 0.976g / L, bialaphos 5mg / L, Timentin 400mg / L, and plant gel 3g / L, with a pH of 5.8.

[0045] 4. Differentiation and seedling culture

[0046] The selected positive callus tissue was transferred to the differentiation medium for differentiation culture, and when the differentiated buds grew to 3 cm, they were transferred to the seedling medium for seedling culture. Among them, the differentiation medium used 2 / 3MS as the basic medium, added maltose 30g / L, 6-BA0.5 mg / L, KT 1.5mg / L, NAA 0.05mg / L, agar 5.5g / L, Timentin 200mg / L, bialaphos 2mg / L, plant gel 3.5g / L, pH 5.8; the seedling medium used 1 / 2MS as the basic medium, added sucrose 30g / L, NAA0.05mg / L, paclobutrazol 4.0mg / L, agar 5.5g / L, Timentin 400mg / L, bialaphos 5mg / L, plant gel 3g / L, pH 5.8.

[0047] Finally, 19 regenerated plants were obtained. The leaves of the regenerated plants were ground into pulp and tested using PAT / bar rapid test paper (Shanghai Youlong). The test results are as follows: Figure 1 As shown, the results showed that 17 regenerated plants were positive plants.

[0048] Identification of mutant plants: The genomic DNA of the 17 regenerated plants obtained above and the wild type 'Hua 22' was extracted using the CTAB method, and the MLO gene sequence containing the target site was cloned using primers designed from the MLO genes shown in SEQ ID NO.1 and SEQ ID NO.2. The nucleotide sequences of the primers are shown in SEQ ID NO.5 (CAGACACACAGCAGCGTAC) and SEQ ID NO.6 (GACGATGAGGAGCAGGGATA). The cloning results are shown in Figure 2 and Figure 3 As shown, from Figure 2 It can be seen that the MLO gene in barley plant No. 8 was successfully edited and it was a mutant plant; Figure 3 It can be seen that a G base is inserted in the nucleotide sequence of the MLO gene as shown in SEQ ID NO.1, and four bases GTCC are missing in the nucleotide sequence as shown in SEQ ID NO.2. Thus, a mutant gene of the MLO gene was obtained, and the nucleotide sequence of the mutant gene is shown in SEQ ID NO.3 (CGGACAAAAAAGGGGGTGC) and SEQ ID NO.4 (TGCTCGTGTCCTCA).

[0049] Identification of the resistance of plants to powdery mildew: Leaves from 19 regenerated plants with consistent growth and wild-type 'Hua 22' barley plants were cut and neatly placed on a sterilized 1.5% agar medium. Fresh powdery mildew spores (the strains were mixed from barley fields in Shanghai) were inoculated by the shaking method. The leaves were observed for disease conditions 7 days after inoculation. Figure 4 As shown. Figure 4 It can be seen that the mutant plants are highly resistant to powdery mildew.

[0050] It can be seen from the above embodiments that the present invention provides an MLO gene and its mutant gene and the application in improving the powdery mildew resistance of barley. The MLO gene or its mutant gene can be used to construct barley with high powdery mildew resistance. The method of the present invention is simpler and more time-saving than natural, chemical and physical mutagenesis. The barley mutant plants obtained according to the method of the present invention can be quickly applied to barley breeding, providing a basis for the further breeding of barley with high resistance to powdery mildew.

[0051] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A MLO The use of a mutant gene of a gene in improving the resistance of barley to powdery mildew is characterized in that: The nucleotide sequences of the mutant genes are shown in SEQ ID NO.3 and SEQ ID NO.

4.

2. A method for constructing barley with high powdery mildew resistance, characterized in that: The steps include: (1) The SEQ ID NO.1 and SEQ ID NO.2 are shown in MLO The gene is inserted into a vector containing a gene editor to obtain a recombinant vector; (2) Transforming the recombinant vector obtained in step (1) into Agrobacterium; (3) Infecting and transforming barley microspore callus tissue with the Agrobacterium obtained in step (2), performing differentiation culture and seedling culture to obtain mutant plants; the mutant plants contain MLO A mutant gene of a gene, wherein the nucleotide sequence of the mutant gene is shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. The method according to claim 2, characterized in that The gene editor includes a CRISPR / Cas9 gene editor.

4. The method according to claim 2, characterized in that The vector includes pBUE411 vector.

Images