A method for obtaining rice root tissue-specific proteome based on proximity labeling technology and its application

Abstract

The present invention discloses a method and application for obtaining rice root tissue-specific proteome based on proximity labeling technology. The present invention establishes and optimizes a rice root tissue-specific proximity labeling system, and successfully obtains a proteome specifically expressed in the pith of the root by constructing an OsPHO1pro-TurboID-eGFP material specifically expressed in the pith of the root. The present invention provides a useful proximity labeling technology for the study of rice root tissue-specific proteome.

Description

Technical Field

[0001] The invention belongs to the technical field of rice tissue-specific proteomics research, and specifically relates to a method for obtaining rice root tissue-specific proteomics based on proximity labeling technology and its application. Background Art

[0002] The root system is an important organ for rice to attach to the soil and exchange substances and signals, and is also the main part of rice to respond to adversity. Therefore, exploring the structure of the rice root system and its response mechanism to adversity can improve and enhance the nutrient absorption efficiency and stress resistance of rice, which is an important goal of crop improvement.

[0003] Protein is the basic unit for realizing life activities and plays a core role in different life processes. The mechanism of changes in rice root structure is also mainly regulated by proteins. Therefore, characterizing the proteome of rice roots will help to further explore its functions. The rice root system is composed of multiple tissues such as epidermis, cortex, endodermis, pith, root apical meristem and root cap. However, there is currently no good method to isolate and purify root tissue-specific cells, so it is also difficult to analyze the tissue-specific proteome of the root system.

[0004] As a new protein research technology, proximity labeling technology has been widely used in different biological fields. Its principle is to express proximity labeling enzymes in vivo to achieve biotinylation of neighboring proteins and molecules, and use streptavidin to enrich biotinylated proteins, and then combine mass spectrometry technology for identification and analysis.

[0005] The present invention constructs a rice root tissue-specific proximity marker system to study the root tissue-specific proteome. The invention does not require the separation of tissue-specific cells from rice root samples, overcomes the difficulty of separating tissue-specific cells from rice root samples, and also avoids problems such as inter-tissue contamination caused by the separation and purification steps. The invention provides a reference for the study of rice tissue-specific proteomes and is of great significance to rice improvement. Summary of the invention

[0006] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0007] As one aspect of the present invention, the present invention provides a method for obtaining rice root tissue-specific proteome based on proximity marker technology, which includes the construction of a rice root stele-specific expression vector and a stable genetic strain: extracting rice genomic DNA, amplifying the OsPHO1 promoter using the rice genomic DNA as a template, amplifying the TurbolD gene fragment using the TurbolD synthetic sequence as a template, codon-optimizing the TurbolD gene fragment, and using pBl101.3-eGFP as an initial vector to construct a pBl101.3-OsPHO1pro-TurbolD-eGFP vector; transforming the vector into Agrobacterium EHA105 by freeze-thaw method; and constructing a rice transgenic strain;

[0008] Establishment of proximity labeling experimental method: Add the roots of rice seedlings to biotin solution, incubate after vacuuming, wash, grind the biotin-treated roots of rice seedlings in liquid nitrogen, add the ground powder to protein extraction buffer, mix and incubate, ultrasonicate, add nuclease and incubate, and affinity purify the obtained extract to obtain rice root pistil tissue-specific proteome.

[0009] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the roots of rice seedlings are added to a biotin solution, the concentration of the biotin solution is 100-200 μM; the solvent of the biotin solution is water.

[0010] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the vacuuming is followed by incubation, the incubation time is 0.5 to 1 hour, and the incubation temperature is 30°C.

[0011] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the ultrasonic treatment is performed with ultrasonication for 30 seconds and ultrasonication off for 90 seconds as one cycle, and a total of 12 cycles are performed.

[0012] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the incubation temperature of adding nuclease is 4° C. and the incubation time is 2 h.

[0013] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity marker technology described in the present invention: the TurbolD gene fragment is codon optimized, and the optimized TurbolD gene fragment sequence is shown in SEQ ID NO:1.

[0014] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the OsPHO1 promoter is amplified using rice genomic DNA as a template, and the primer sequence is:

[0015] Upstream primer: 5′-GCCAAGCTTGCATGCCTGCAGGTCGACCGTCATCCGTATTTGAGTCGGTTT-3′

[0016] Downstream primer: 5′-TGGCACGGTGTTATCCTTCTGGATCTGGATCCTTCTCTCTCTCTCTCTCTG-3′.

[0017] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the TurbolD gene fragment is amplified using the TurbolD synthetic sequence as a template, and the primer sequence is:

[0018] Upstream primer: 5′-CGCGGATCCATGAAGGATAACACCGTGCCCACTC-3′

[0019] Downstream primer: 5′-cggggtaccacttctcagcagatctgagagagatttc-3′.

[0020] As a preferred embodiment of the method for obtaining rice root tissue-specific proteome based on proximity labeling technology described in the present invention: the mixing is followed by incubation, the incubation time is 10 to 20 minutes, and the incubation temperature is 4°C.

[0021] The beneficial effects of the present invention are as follows: First, the rice root system is composed of multiple tissues such as epidermis, cortex, endodermis, pith, root apical meristem and root cap. The structure and function of each tissue are unique and complex, and the separation and purification of each tissue is relatively difficult. The present invention obtains the rice root tissue-specific proteome without destroying the integrity of the root tissue, overcomes the problem of difficulty in purifying root tissue-specific cells, and avoids contamination during the purification process of tissue-specific cells. Second, a TrubolD vector specifically expressed in the root pith tissue is constructed and transferred into rice materials, and a stable genetic strain OsPHO1pro-TurbolD-eGFP is identified and obtained, and it is proved that the in vivo proximity labeling system will not affect the normal growth and development of rice. Third, the present invention determines the optimal biotin treatment conditions suitable for rice root materials, that is, optimizes the biotin treatment concentration, incubation temperature and time, and ATP concentration, and improves the affinity purification method of biotinylated proteins. The enriched proteins are identified by mass spectrometry technology, proving that the construction of the rice root tissue proximity labeling experimental system is successful.

[0022] The invention establishes and optimizes a rice root tissue-specific proximity marker system, and successfully obtains a proteome specifically expressed in the stele tissue by constructing an OsPHO1pro-TurbolD-eGFP material specifically expressed in the root stele. The invention provides a useful proximity marker technology for the study of rice root tissue-specific proteome. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0024] Figure 1 Optimal codon usage frequency of the original TurbolD sequence (left) and the optimized sequence (right).

[0025] Figure 2 GC content of the original TurbolD sequence (left) and the optimized sequence (right).

[0026] Figure 3 Schematic diagram of pBl101.3-OsPHO1pro-TurbolD-eGFP vector.

[0027] Figure 4 This is the predicted structure of the TurbolD-eGFP fusion protein.

[0028] Figure 5 This is the result of PCR identification of transgenic lines.

[0029] Figure 6 This is the result of Western Blot identification of transgenic lines.

[0030] Figure 7 This is the fluorescence observation result of OsPHO1pro-TurbolD-eGFP#14GFP.

[0031] Figure 8 Comparison of the growth status of OsPHO1pro-TurbolD-eGFP and Nip.

[0032] Fig. 9 Results for biotin treatment.

[0033] Fig.10 is the effect of ATP concentration on the labeling reaction.

[0034] Fig.11 The effect of different ultrasonic cycle numbers and nuclease incubation time on protein extraction efficiency.

[0035] Fig.12 is the affinity purification efficiency.

[0036] Fig.13 It is the base peak diagram of mass spectrum.

[0037] Fig.14 Venn diagram analysis between groups.

[0038] Fig.15 The water channel protein OsPIP1;2 is expressed in the central column.

[0039] Fig.16 For GO analysis. DETAILED DESCRIPTION

[0040] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0041] Example 1: Construction of a rice root stele-specific expression vector and a stable genetic strain

[0042] Plant materials: The wild-type rice variety used in this experiment was Oryza sativa L.ssp. japonicavar Nipponbare. Vector: pBl101.3-eGFP. Enzymes: high-fidelity enzyme KOD Plus Neo (Toyobo); restriction enzymes BamHl and Kpnl (Thermo Scientific); homologous recombinase (NEB); PCR Mi× (ABclonal). Bacterial strains: Escherichia coli DH5α, Agrobacterium tumefaciens EHA105 (laboratory storage).

[0043] Rice cultivation: Environmental parameters of the rice artificial climate chamber: Temperature: 30°C during the day and 22°C at night; Relative humidity: 60%; Photoperiod: 7:00-19:00 light; 19:00-7:00 the next day dark; Light intensity: 250-300 μmol / m -2 S -1 .

[0044] Seed dormancy breaking and germination: Soak dry rice seeds in an appropriate amount of 1% dilute nitric acid solution and place at room temperature for 16-18 hours to break the seeds' dormancy. Pour out the dilute nitric acid, rinse the seeds with pure water, and then soak them in an appropriate amount of pure water. Place them in a 37°C incubator and culture them in the dark for 2-3 days until the seeds turn white. During this period, change the water every 12 hours.

[0045] Extraction of rice genomic DNA.

[0046] Amplification of OsPHO7 promoter and TurbolD fragment (Branon et al., 2018):

[0047] The OsPHO1 promoter in the rice genome was amplified using DNA extracted by the Plant DNAZol method, and the TurbolD fragment was amplified using the TurbolD synthetic sequence as a template.

[0048] Primers were designed with reference to Primer 3, and the sequences are as follows (5′-3′):

[0049] OsPHO1pro-F:gccaagcttgcatgcctgcaggtcgaccgtcatccgtatttgagtcggtt

[0050] OsPHO1pro-R: tggcacggtgttatccttcatggatcccttcttcttcttcttcttcctcgttg

[0051] TurbolD-F:cgcggatccatgaaggataacaccgtgccactc

[0052] TurbolD-R: cggggtaccacttctcagcagatctgagagagatttc

[0053] PCR amplification system:

[0054]

[0055]

[0056] Agarose gel electrophoresis and recovery (Novozyme Product Purification Kit DC301-01).

[0057] pBI101.3-TurbolD-eGFP vector construction:

[0058] The pBI101.3-eGFP vector and TurbolD fragment were digested with enzymes respectively.

[0059] Enzyme digestion system:

[0060] Reagents Volume 20 μl 10x FastDigest Green Buffer 2μl pBl101.3-eGFP plasmid / TurbolD fragment 0.5-1 μg each BamHI / Kpnl 0.2μl each <![CDATA[ddH 2 The]]> Add to 20 μl

[0061] Recovery of enzyme digestion products.

[0062] Connection system:

[0063] Reagents Volume 10 μl 10x Ligase Buffer 1μl TurbolD fragment 0.3pmol pBI101.3-eGFP vector 0.03pmol T4 DNA ligase 1μl <![CDATA[ddH 2 The]]> Add to 10 μl

[0064] Incubate at 16°C overnight.

[0065] Transformation of E. coli DH5α:

[0066] coli DH5α competent cells stored at -80°C were placed on ice to thaw, 5 μl of the ligation product was added and gently pipetted to mix, the cells were allowed to stand on ice for 30 min, heat-shocked at 42°C for 90 s, quickly allowed to stand on ice for 2 min, 500 μl of antibiotic-free LB liquid culture medium was added, and the cells were cultured at 37°C on a shaker for 1 h at 150 rpm, and centrifuged at 4000 rpm for 1 min. 50-100 μl of the resuspended bacterial solution was spread on a solid culture medium containing kanamycin resistance by the coating method, and the cells were cultured upside down in a 37°C incubator for 12-16 h.

[0067] Positive single colony verification:

[0068] Pick a single clone and dissolve it in 20 μl ddHO 2 O for colony PCR.

[0069] TurbolD-870F: agaggcatcgataagcaggg

[0070] eGFP-141R:gaacttcagggtcagcttgc

[0071] The PCR product was verified by agarose gel electrophoresis, and the positive monoclonal colonies were selected for amplification and culture. The plasmids were extracted for restriction enzyme verification and sequencing identification, and then frozen at -80°C after adding 50% glycerol.

[0072] Construction of pBl101.3-OsPHO1pro-TurbolD-eGFP vector:

[0073] The constructed pBI101.3-TurbolD-eGFP vector was linearized by restriction digestion, and then the target vector was constructed by homologous recombination.

[0074] Reaction system:

[0075]

[0076] React at 50℃ for 30min.

[0077] The ligation product was transformed into competent E. coli DH5α, single clone colonies were picked for PCR, restriction enzyme verification and sequencing, and the strains were preserved.

[0078] Freeze-thaw method to transform Agrobacterium EHA105: Thaw the competent Agrobacterium EHA105 stored at -80℃ on ice, add 1μl of plasmid and gently blow to mix, let it stand on ice for 30min, freeze in liquid nitrogen for 5min, transfer to a 37℃ water bath for 10min, take it out and let it stand on ice for 2min, add 500μl of antibiotic-free LB or YEP liquid culture medium, culture at 28℃ in a shaking incubator for 2h at 200rpm, draw 100μl of bacterial solution and spread it on a solid culture medium containing kanamycin and streptomycin double antibodies, culture upside down in a 28℃ incubator for 2 days, identify positive clones by colony PCR, and store the strain at -80℃.

[0079] Construction of transgenic rice lines:

[0080] Induction of callus tissue: Take mature seeds and dehull them manually or mechanically, select plump, smooth and sterile seeds, put them into a 50ml sterilized centrifuge tube, disinfect them with 70% alcohol for 2 minutes, add 30ml 30% sodium hypochlorite solution, soak for 30 minutes, wash them with sterilized water 4-5 times, and finally soak them for 30 minutes. Spread the disinfected seeds on sterilized filter paper and dry them, and place the seeds into the induction culture medium with sterilized tweezers, about 12 seeds per dish, seal the culture dish with a breathable adhesive tape, and culture them at 28℃ for 3 weeks.

[0081] Subculture: Pick out light yellow callus tissue with good growth, dense and spherical shape and place it into subculture medium, and culture it at 28℃ for 7-10 days.

[0082] Agrobacterium activation and co-cultivation: Take about 50μl of the preserved Agrobacterium culture and add it to 20ml YEP culture medium. Cultivate it at 28℃ and 250rpm for 12-24h. The transformation efficiency is highest when the OD600 of the culture is about 0.6. Centrifuge the culture at 4℃ and 4000rmp for 10min, discard the supernatant, add 40ml AAM infection culture, mix it on a horizontal shaker for 40min to make a suspension, and activate Agrobacterium. Pick about 100 pale yellow callus tissues with good growth and uniform size, put them into the Agrobacterium suspension, and incubate them on a horizontal shaker for 10min. Place the callus tissue on sterilized filter paper and drain it for 30-40min, then transfer it to the co-culture medium covered with a layer of filter paper and culture it in the dark at 28℃ for 2.5-3 days.

[0083] Selection culture: Take out the co-cultured callus and place it in a sterile 50ml centrifuge tube, add 40ml sterile water to wash 5-6 times, add 40μl Carb mother solution for the last wash, wash on a horizontal shaker for 30min, take out the callus and place it on sterile filter paper to drain for 1.5h, transfer to the first round of selection medium, about 30 per dish, and culture at 28℃ for 14 days. Transfer the callus after the first round of selection to the second round of selection medium, about 12 per dish, and culture at 28℃ for 14 days.

[0084] Differentiation: Transfer the callus after the first round of selection to the differentiation medium, put 4 strains in one pot, and wait for the callus to differentiate into seedlings in a constant temperature culture room at 28℃ for about 35 days. Take out the seedlings from the differentiation tank, harden them in the greenhouse for about 3 days, and culture them in rice nutrient solution for 1-2 weeks. Use PCR and Western Blot to verify the positive seedlings.

[0085] Experimental results:

[0086] TurbolD codon optimization:

[0087] In order to better express TurbolD in rice, the TurbolD sequence needs to be codon optimized.

[0088] Figure 1 The optimal codon usage frequency of the TurbolD original sequence (left) and the optimized sequence (right), the horizontal axis is the codon usage frequency grouping, and the vertical axis is the percentage of codons. The codon usage frequency of the optimized sequence in rice increased. The codon adaptation index (CAl) is used to evaluate the results of codon optimization. The closer the CAI value is to 1, the higher the expression of the exogenous gene in the host cell. For highly expressed genes, CAI greater than 0.8 is considered to be easy to express in the host cell. The optimized CAI value is 0.81. Figure 2 The GC content of the original TurbolD sequence (left) and the optimized sequence (right). The horizontal axis is the codon distribution position, and the vertical axis is the GC content. The GC content in the sequence will also affect the expression efficiency of the exogenous gene in the host cell. The average GC content of the optimized sequence is reduced from 57.13% to 49.81%, and the optimized sequence is easier to express in the host cell.

[0089] The optimized TurbolD sequence is (SEQ ID NO: 1):

[0090] atgaaggataacaccgtgccactcaagttgatcgctctccttgccaacggagagttccactctggtgaacagttgggagaaacactcggcatgtctagagccgctatcaataagcatatccagacattgagggattggggtgtcgatgtgttcactgtccctggaaagggctactctctcccagagccaattccgctcttgaacgctaagcagattcttggtcagctcgatggtggatcagttgctgtcctcccagttgtggattcaaccaaccagtacctcttggatagaattggagagcttaagtcaggcgatgcttgcatcgctgagtatcagcaagctggaagaggttcaaggggaagaaagtggttttctcctttcggtgccaatctctacttgtctatgttctggagactcaagagaggcccagccgctattggccttggtccagttatcggcattgtgatggctgaggccttgaggaagctcggtgctgataaggtcagggttaagtggcctaacgatctttacctccaagataggaagcttgctggaattctcgtggagcttgctggtatcacaggcgatgccgctcaaatcgtgatcggagctggtatcaatgtcgctatgagaagggttgaggaatcagtggttaaccagggttggatcacccttcaggaggctggaattaacctcgatagaaatactcttgctgccacactcattagggaactcagagccgctttggagctctttgaacaagagggtcttgctccgtatctccctagatgggagaagctcgataacttcattaacagacctgtgaagcttattatcggagataaggagatcttcggcatctctagaggcatcgataagcagggtgctcttttgctcgagcaggatggtgttatcaagccatggatgggaggtgaaatctctctcagatctgctgagaag

[0091] pBl101.3-OsPHO1pro-TurbolD-eGFP vector map: After two rounds of ligation reaction and sequencing verification, an in vivo proximity marker expression vector was constructed with pBl101.3 vector as the backbone, a sequence of about 2500 bp upstream of the OsPHO1 gene as the promoter, and fusion expression of TurbolD-eGFP protein. The sequence is as follows Figure 3 As shown, Figure 3 In, Kan: kanamycin resistance gene, G418: geneticin resistance gene.

[0092] The sequence of the TurboID-eGFP fusion protein was uploaded to the Robetta website for structure prediction, and the predicted structure was annotated using PyMOL software. Figure 4 As shown, the left side is TurbolD protein, where the black part is the N-terminus, the yellow part is the biotin binding domain, and the red part is the ATP binding domain. These two domains constitute the reaction center, promoting the synthesis of biotin-5′-AMP. The right side is the fusion-expressed eGFP, which does not affect the biotin labeling activity of TurboID protein due to steric hindrance.

[0093] Verification of transgenic T0 positive strains:

[0094] Agarose gel electrophoresis results: Figure 5 The results of PCR identification of transgenic lines. N represents the wild-type Nipponbare Nip, which is used as a negative control. The numbers above the strips represent different T0 transgenic lines (the same below). The target fragment obtained by amplification with OsPHO1pro-616F and TurbolD-R primers is about 1600 bp in size. Figure 5 As shown, the PCR results proved that 14 out of 23 transgenic T0 seedlings were transgenic positive rice seedlings that had integrated the vector.

[0095] Western Blot results: The positive strains with clear bands in the above electrophoresis results were subjected to Western Blot experiments again to verify the expression of TurbolD-eGFP fusion protein. The results are as follows: Figure 6 shown. Figure 6This is the result of Western Blot identification of transgenic lines. IB: GFP represents lmmunoblottin, that is, immunoblotting was performed with Anti-GFP as the primary antibody. The arrow indicates the position of the band of TurbolD-eGFP fusion protein. Ponceau is Ponceau red staining as a control. The size of TurbolD-eGFP fusion protein predicted by SnapGene software is about 62.6kDa. First, TurbolD-eGFP fusion protein can be detected in most of the transgenic lines tested; secondly, when the sample loading amount is relatively consistent, the band of line 14 is brighter, indicating that the expression level of its fusion protein is higher.

[0096] GFP fluorescence observation results: Take the root of strain 14 in the above results and observe GFP fluorescence using a laser confocal microscope (LSM710nlo). The emission wavelength of GFP is around 510nm and appears blue-green in λ mode. Figure 7 As shown in the figure, the stele of the rice young root is blue-green, which is a true signal, while the cortex is a turquoise false signal. The fluorescence results show that TurbolD-eGFP is specifically expressed in the stele tissue of the rice young root. This result is also consistent with the expression site of the OsPHO 7 gene, indicating that the constructed OsPHO1 promoter-driven TrubolD-eGFP can be specifically expressed in the root stele tissue and has no subcellular localization specificity. Figure 7 The results of GFP fluorescence observation of OsPHO1pro-TurbolD-eGFP#14 include GFP fluorescence (left), Bright (middle), and Merge (right). The arrow indicates the median column.

[0097] Growth phenotype of transgenic lines: To further confirm whether exogenous TurbolD affects the normal growth of rice, we conducted phenotypic observations on transgenic rice. Figure 8 The results showed that after 20 days of normal culture, the growth status of Nip and OsPHO1pro-TurbolD-eGFP#14 was similar. Compared with wild-type Nip, the root length and plant height of transgenic rice were not significantly different, and the leaf shape and root structure were normal. This shows that the adjacent marker system introduced in vivo does not affect the normal growth and development of rice. Figure 8 Comparison of the growth status of OsPHO1pro-TurbolD-eGFP and Nip, A: growth phenotype, B: quantitative comparison of plant height and root length (20 plants in a group, no significant difference).

[0098] In summary, after multiple identifications, OsPHO1pro-TurbolD-eGFP#14 is a transgenic positive strain with good growth and development, no phenotypic difference from Nip, and can be bred in large quantities for subsequent experiments.

[0099] Example 2: Establishment of proximity labeling experimental method

[0100] Take the roots of rice seedlings of about 20 days old, wash them with pure water, wipe them dry with paper towels, cut them into small sections of about 1 cm and put them into 50 ml centrifuge tubes, add 40 ml of biotin reaction solution with a concentration of 100 μM or 200 μM, then put them into a vacuum pump, vacuum at 12 psi for 10 minutes, transfer them to a constant temperature shaker at 30°C and 120 rpm, incubate for 0.5 h or 1 h, pour out the reaction solution after completion, add ice-cold pure water to wash away the excess reaction solution and terminate the reaction, wipe them dry with paper towels, wrap them with tin foil, and grind them in liquid nitrogen. The ground powder is used for affinity purification experiments. The ground powder was added to 2 ml of protein extraction buffer, mixed with a pipette, and then transferred to a 2 ml centrifuge tube. Incubated for 10 min at 4 °C, the homogenate was divided into 1.5 ml tubes dedicated to ultrasound, 300 μl per tube, and the ultrasound switch parameters were set to 30s On / 90s Off (purchased from Diagenode, model Bioruptor Pico), 12 cycles, after the ultrasound, 0.5 μl of nuclease was added, and incubated at 4 °C for 2 h.

[0101] After that, affinity purification was performed according to the conventional method, specifically: centrifuge at 4°C, 15000rpm for 15min, transfer the supernatant to the pretreated Zaba desalting centrifuge column, take out 50μl of supernatant, mark it as Extract, mark the precipitate as Pellet, use a pipette to slowly add ≤2.5ml of supernatant to the center of the compacted resin, add about 200μl of equilibrium buffer to the compacted layer, put the column in a new 15ml centrifuge tube, centrifuge at 4°C, 1000rpm for 2min to collect the desalted sample, take out 50μl of sample, mark it as After Zaba, add 30μl of pretreated Anti-GFPBeads (ABCIonal) to the desalted sample, and add a certain volume of PMSF and Complete Proteasome Inhibitor tablets to make the final concentration of 1×, and put the sample and Anti-GFP Incubate the centrifuge tube containing beads on the Rotor for 2 hours at 4°C, place the centrifuge tube on a magnetic rack, allow Anti-GFP beads to be completely adsorbed, then take out 50 μl of supernatant and mark it as After GFP, add the remaining supernatant to the centrifuge tube containing Streptavidin beads (Dynabeads MyOne Streptavidin Avidin C1), and add a certain volume of PMSF and Complete Proteasome lnhibitor tablets to make the final concentration 1×, incubate the centrifuge tube on the Rotor overnight (12h-16h), 4°C, place the centrifuge tube on a magnetic rack, allow Str beads to be completely adsorbed, then take out 50 μl of supernatant and mark it as Supern., discard the excess supernatant, and wash Streptavidin (Str) beads with Wash Buffer in the following order: pre-cooled extraction buffer, 2 times; pre-cooled 1M KCl, 1 time; pre-cooled 1mM Na 2 CO 3 , 1 time; 2M Urea at room temperature, 1 time; pre-cooled equilibration buffer, 2 times. Then, Str Beads were stored at -80°C. Beads were eluted by TCA precipitation.

[0102] Fig. 9 The results of biotin treatment, * indicates natural biotinylated protein, and the arrow indicates TurboID-eGFP self-biotinylation. SA and GFP indicate immunoblotting with streptavidin and Anti-GFP as primary antibodies, respectively, and Ponceau is Ponceau red staining, which serves as a loading control (the same below). Fig. 9As shown in the Western Blot results, OsPHO1pro-TurbolD-eGFP transgenic materials are more sensitive to biotin treatment than wild-type Nip materials. Under biotin treatment, the biotin signal of the entire lane of the OsPHO1pro-TurbolD-eGFP transgenic material became stronger, but the wild-type Nip did not show a similar phenomenon. Due to the presence of endogenous biotin and biotinidase in rice, biotinylated proteins can be detected without exogenous biotin application. In addition, under the same biotin concentration treatment, the longer the incubation time, the more biotinylated proteins, indicating that the stronger the proximity labeling reaction, the strongest proximity labeling reaction was achieved when 100μM biotin was incubated for 1h, which was the optimal treatment condition.

[0103] Furthermore, ATP with concentrations of 0, 0.25 mM, 0.5 mM, 1 mM, 2.5 mM, and 5 mM was added to the biotin reaction solution, and other conditions were the same as above, and then a Western Blot experiment was performed. Fig.10 The effect of ATP concentration on the labeling reaction, * indicates biotinylated protein. +- indicates the presence or absence of biotin treatment, Fig.10 As shown in the figure, in the wild-type Nip, whether biotin treatment or exogenous ATP was applied had no obvious effect on the biotinylation of the protein; however, in the OsPHO1pro-TurbolD-eGFP transgenic line, the proximity labeling intensity increased with the increase of ATP concentration and reached saturation when the ATP concentration was 1mM. Therefore, adding 1mM ATP solution to the biotin reaction solution can be used as a suitable treatment condition.

[0104] In order to obtain as much biotinylated protein as possible in the supernatant, we further treated the crude extract of rice root tissue using ultrasound technology and used nuclease to digest the DNA and RNA in the cells. To this end, we optimized the number of ultrasound interruption cycles and the incubation time of nuclease, and determined the appropriate conditions based on the Western Blot results. Fig.11 To investigate the effects of different ultrasonic cycle numbers and nuclease incubation time on protein extraction efficiency, we tried 6, 9, and 12 ultrasonic interruption cycle numbers, as well as 1h and 2h nuclease incubation time. The optimal ultrasonic cycle number and nuclease incubation time were determined by comparing the protein content in Extract and Pellet. Compared with the results of 1h incubation, the Histone content in the protein extract was higher after 2h incubation, indicating that more proteins bound to nucleic acids were extracted; and when the ultrasonic cycle number was 12, more biotinylated proteins in the cytoplasm were extracted. Therefore, 12 ultrasonic cycles and 2h nuclease incubation were the optimal conditions.

[0105] Example 3: Proximity tag affinity purification mass spectrometry results

[0106] Plant materials: japonica rice Nipponbare (Oryza sativa L.ssp.japonicavarNipponbare); transgenic material OsPHO1pro-TurbolD-eGFP#14 with Nipponbare as background.

[0107] Fig.12 The right picture is the result of strong exposure of the left picture. Fig.12 The results showed that, first, the comparison between Pellet and Extract showed that the content of biotinylated proteins in the precipitate was relatively low, and most of the proteins were dissolved in the extraction buffer. Comparison of the supernatant (Supern.) of incubation with streptavidin magnetic beads and the magnetic bead protein eluate (Eluate) showed that the biotinylated proteins were basically enriched and eluted by Str Beads. The above results show that biotinylated proteins can be well extracted and enriched, and the affinity purification experimental system was successfully established.

[0108] Mass spectrometry identification results: To further verify whether TurbolD driven by a tissue-specific promoter can identify tissue-specific proteomes, we performed mass spectrometry analysis on affinity-purified proteins. We selected two samples, the biotin-treated wild-type Nip sample (Nip biotin) and the OsPHO1pro-TurbolD-eGFP sample (OsPHO1pro-TurbolD-eGFP biotin), for mass spectrometry identification. The base peaks obtained by mass spectrometry are as follows Fig.13 As shown, the maximum intensity values ​​of the two samples are 8.40E9 and 8.92E9, respectively, both of which are within the normal response range, and the 9th power of E indicates that the sample concentration is good; the lack of tailing in the mass spectrum peak indicates that the sample enzymatic hydrolysis is normal; the presence of multiple peaks and strong signals indicates that the sample is highly complex. Fig.13 The base peak of mass spectrometry, Nip biotin treatment (upper), OsPHO1pro-TurbolD-eGFP biotin treatment (lower). The horizontal axis is the sample elution time, the label on each cluster peak is the corresponding accurate retention time, and the vertical axis is the corresponding relative intensity value.

[0109] Analysis of mass spectrometry results: The number of peptides and proteins in the mass spectrometry results are shown in Table 1.

[0110] Table 1 Number of peptides and proteins in mass spectrometry results

[0111] Sample name Number of peptides Protein quantity Nip biotin treatment 3326 1038 OsPHO1pro-TurbolD-eGFP biotin treatment 3409 1003

[0112] Fig.14This is a Venn diagram analysis between groups. Fig.14 As shown in the figure, most of the protein components identified between OsPHO1pro-TurbolD-eGFP biotin and Nipblotin samples were different, with only about 20% of the same proteins. This result shows that the rice materials with the column-specific proximity marker system are specifically enriched with different proteins compared with the control, indicating that our tissue-specific proximity marker system can identify tissue-specific proteins.

[0113] Table 2 Some protein peptides localized in the middle column that are only enriched in the middle column of OsPHO1pro-TurbolD-eGFP biotin

[0114] Protein name Total number of peptides Unique peptide number OsTUBB4 17 15 OsTUBB7 16 14 OsROMT9 6 6 OsPIP2;2 2 2 OsTIP1;1 2 1 OsVLN3 2 2

[0115] Table 3 Some column-localized protein peptides that are more enriched in the column of OsPHO1pro-TurbolD-eGFP biotin

[0116]

[0117]

[0118] Subsequently, we found proteins known to be expressed in the stele among the proteins enriched in the strains of the OsPHO1pro-TurbolD-eGFP biotin stele-specific expression proximity marker system. Fig.15 The water channel protein OsPIP1;2 expressed in the central column, such as Fig.15 As shown in the results of the single-cell sequencing database (PlantscRNAdb, Chen et al., 2021), the water channel protein OsPIP1;2 is highly expressed in the pith tissue of rice roots. Similarly, many pith-specific proteins were captured (Table 2), such as the water channel protein OsTIP1;1, the microtubule protein OsTUBB4 / 7, the flavonoid methyltransferase OsROMT9, and the calcium-dependent binding protein OsVLN3. In addition, compared with Nip biotin, some pith-expressed proteins were more enriched in the OsPHO1pro-TurbolD-eGFP biotin material (Table 3), such as sucrose synthase SUS1 / 2, fructokinase OsFRK2, and cinnamate oxygenase OsC4HL. This result proves that our method can identify tissue-specific proteins.

[0119] We further performed GO analysis on the proteins identified by mass spectrometry of the two samples. Fig.16The results showed that there were only 325 proteins enriched with GO annotations in the Nipbiotin sample, accounting for 31.2% of the total proteins. This result indicates that the proteins identified in the Nip biotin sample are random and non-specifically enriched, and the enriched related biological pathways have no obvious specificity. However, in contrast to the Nip biotin control sample, most of the 770 specific proteins in the OsPHO1pro-TurbolD-eGFP biotin sample have GO annotations. The GO results show that these enriched proteins are involved in various molecular functions, biological pathways, and subcellular localization. Fig.16 GO analysis, proteins enriched after Nlp biotin treatment (upper), OsPHO1pro-TurbolD-eGFP biotin treatment (lower). MF: Molecular Function; BP: Biological Process; CC: Cell Component. Fig.16 The results showed that the proteins specifically enriched in the OsPHO1pro-TurbolD-eGFPbiotin sample were involved in molecular functions such as protein folding chaperones, translation factor activity, purine nucleotide binding activity, and RNA unwinding activity; involved in biological processes such as translation, ATP metabolism, ribosome assembly, organic nitrogen compound biosynthesis, and Golgi-mediated vesicle transport; and involved in the localization of different subcellular components such as cytoplasm, ribosomes, microtubules, vacuoles, membraneless organelles, and plasmodesmata. This result shows that most of the enriched proteins have specific functions or biological pathways, suggesting that the enrichment is highly specific; and the GO annotation types obtained are also diverse, indicating that the proximity tagging system can enrich more proteins with different functions in rice.

[0120] The results of comprehensive mass spectrometry peak maps, comparison with published single-cell sequencing results and GO analysis showed that the pillar-specific proximity labeling system constructed in this experiment can indeed capture proteins specifically expressed in the pillar and can be used for the analysis of tissue-specific proteomes.

[0121] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for obtaining rice root tissue-specific proteome based on proximity labeling technology, characterized in that: include, The invention relates to the construction of a rice root stele-specific expression vector and a stable genetic strain: extracting rice genomic DNA, amplifying the OsPHO1 promoter using the rice genomic DNA as a template, amplifying the TurboID gene fragment using the TurboID synthetic sequence as a template, codon-optimizing the TurboID gene fragment, and constructing the pBI101.3-OsPHO1pro-TurboID-eGFP vector using pBl101.3-eGFP as an initial vector; transforming the vector into Agrobacterium EHA105 by freeze-thaw method and constructing a rice transgenic strain; Obtaining rice root tissue-specific proteome through proximity labeling: adding the roots of rice seedlings to a biotin solution, incubating after vacuuming, washing, grinding the biotin-treated roots of rice seedlings in liquid nitrogen, adding the ground powder to a protein extraction buffer, mixing and incubating, ultrasonic treatment, adding nuclease and incubating, and affinity purification of the obtained extract to obtain the rice root pistil tissue-specific proteome.

2. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1, characterized in that: The roots of the rice seedlings are added into a biotin solution, the concentration of the biotin solution is 100-200 μM; the solvent of the biotin solution is water.

3. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The vacuum is then followed by incubation, the incubation time being 0.5 to 1 hour and the incubation temperature being 30°C.

4. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The ultrasonic treatment was performed with 30 seconds of ultrasonic treatment and 90 seconds of ultrasonic treatment as one cycle, and 12 cycles were performed in total.

5. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The nuclease was added for incubation at a temperature of 4° C. and a time of 2 hours.

6. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The TurboID gene fragment is codon optimized, and the sequence of the optimized TurboID gene fragment is shown in SEQ ID NO:

1.

7. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The OsPHO7 promoter was amplified using rice genomic DNA as a template, and the primer sequence was: Upstream primer: 5′-GCCAAGCTTGCATGCCTGCAGGTCGACCGTCATCCGTATTTGAGTCGGTTT-3′ Downstream primer: 5′-TGGCACGGTGTTATCCTTCTGGATCTGGATCCTTCTCTCTCTCTCTCTCTG-3′.

8. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The TurboID gene fragment is amplified using the TurboID synthetic sequence as a template, and the primer sequence is: Upstream primer: 5′-CGCGGATCCATGAAGGATAACACCGTGCCCACTC-3′ Downstream primer: 5′-cggggtaccacttctcagcagatctgagagagatttc-3′.

9. The method for obtaining rice root tissue-specific proteome based on proximity labeling technology according to claim 1 or 2, characterized in that: The mixture is mixed and then incubated for 10 to 20 minutes at a temperature of 4°C.

10. Use of the method according to claim 1 in obtaining rice root tissue-specific proteome.

Images