Glycosyl phosphatidylinositol-anchored protein gene taCOBL-A12, expression vector and application thereof
By cloning the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 from wheat and constructing an overexpression vector, and introducing it into Arabidopsis thaliana, the problem of wheat growth defects under high temperature stress was solved, the heat resistance of the plants was significantly improved, and genetic resources for wheat breeding were provided.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CROP INST SICHUAN PROVINCE ACAD OF AGRI SCI
- Filing Date
- 2023-07-27
- Publication Date
- 2026-05-22
AI Technical Summary
Wheat exhibits severe growth defects under high-temperature stress, and existing technologies struggle to effectively improve its heat resistance, thus impacting yield and production stability.
The glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 was cloned from wheat, and the overexpression vector pBI121 was constructed and introduced into Arabidopsis thaliana. Homozygous T3 generation single plants were obtained by Agrobacterium inflorescence infection method, which enhanced the plant's tolerance to high temperature.
Overexpression of TaCOBL-A12 significantly improved the high-temperature tolerance of Arabidopsis thaliana, providing an important gene resource for molecular breeding of wheat stress resistance and enhancing the high-temperature tolerance of wheat.
Smart Images

Figure CN117210471B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and molecular breeding technology, specifically involving the glycosylphosphatidylinositol-anchored protein (COBRA-Like) gene TaCOBL-A12 and its expression vector and applications. Background Technology
[0002] Wheat (Triticum asetivum L.) is one of my country's most important food crops, and its yield directly affects the national economy and people's livelihood. Therefore, ensuring high and stable wheat yields is the primary goal of wheat breeding. Originating in the Fertile Crescent region of West Asia, wheat is a typical cool-climate crop with poor adaptability to high temperatures. In recent years, with the intensification of global warming due to the greenhouse effect, high-temperature stress during the wheat growing season has gradually become a major threat to stable global wheat production. High temperatures during the wheat growing season can lead to varying degrees of growth defects. High temperatures during the seedling stage cause excessive vegetative growth, weak growth, and poor organ development; high temperatures during the heading and booting stages can reduce pollen viability, shorten the flowering period, and weaken fertilization; high temperatures during the grain-filling stage directly affect the degree of grain filling, leading to a shortened grain-filling period and shriveled grains. Yield losses due to temperatures exceeding the optimal growth temperature for wheat are significant; for every 1°C increase in average temperature, global wheat production will decrease by 6%. Therefore, using genetic engineering to discover genes that respond to high-temperature stress, studying their molecular mechanisms of high-temperature stress tolerance, and cultivating new heat-resistant germplasm are key to solving the harm caused by high-temperature stress.
[0003] Plant heat tolerance is a complex biological trait, involving a wide variety of regulatory genes and their respective physiological and biochemical processes. Heat shock proteins (HSPs) were among the first proteins discovered to participate in plant responses to heat stress. When plants are subjected to heat stress, proteins begin to unfold. Heat shock proteins can bind to these proteins, preventing denaturation and depolymerization, maintaining their biological activity, and mitigating the damage caused by heat stress to cells. Besides heat shock proteins, heat shock transcription factors (HSFs), dehydration-responsive element-binding proteins (DREBs), and multiprotein-bridging factor 1c (MBF1c) also participate in heat stress responses. A large number of heat shock proteins and heat shock transcription factors have been identified in Arabidopsis thaliana, and their expression has been shown to enhance tolerance to heat stress.
[0004] Heat tolerance in wheat exhibits complex genetic characteristics and is significantly influenced by environmental factors. Researchers have identified multiple quantitative trait loci (QTLs) related to heat tolerance on various wheat chromosomes, but cloning and identifying the genes behind these QTLs is extremely difficult. However, reverse genetics methods, utilizing comparative genomics, transcriptomics, proteomics, and epigenetics, have been used to identify genes, miRNAs, long non-coding RNAs, and proteins that respond to heat stress. Functional analysis has elucidated the crucial roles of candidate genes in wheat's resistance to heat stress. For example, wheat TaHsfs obtained through whole-genome identification have obvious cycle and tissue-specific expression patterns. Experiments have shown that TaHsfA2-10 can improve the basic heat tolerance and acquired heat tolerance of transgenic Arabidopsis seedlings (Reference: Guo XL, Yuan SN, Zhang HN, Zhang YY, Zhang YJ, Wang GY, Li YQ, Li GL (2020) Heat-response patterns of the heat shock transcription factor family in advanced development stages of wheat (Triticumaestivum L.) and thermotolerance-regulation by TaHsfA2-10. BMC Plant Biol20(1):364.). Twenty-one DREB genes were identified in wheat using reverse genetics, and overexpression of TaDREB3-AI in Arabidopsis enhanced resistance to heat stress (Reference: Niu X, Luo T, Zhao H, Su Y, Ji W, Li H (2020) Identification of wheat DREB genes and functional characterization of TaDREB3 in response to abiotic stresses. Gene 740:144514.). Summary of the Invention
[0005] This invention cloned a glycosylphosphatidylinositol (GPI) anchoring protein gene, TaCOBL-A12, from common wheat and found that its expression was upregulated after induction by high-temperature stress. Subsequently, an overexpression vector of the TaCOBL-A12 gene was constructed using the 35S promoter of cauliflower mosaic virus (CaMV) and transformed into Arabidopsis thaliana Col-0 using Agrobacterium inflorescence infection. T0 generation single plants were obtained, and homozygous T3 generation single plants were isolated and screened. The homozygous T3 generation single plants showed enhanced high-temperature tolerance. TaCOBL-A12 holds promise for use in genetic engineering breeding; its introduction into wheat varieties is expected to improve the high-temperature tolerance of wheat.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] The glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 has the following nucleotide sequence:
[0008]
[0009]
[0010] The cDNA sequence corresponding to the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 is shown below:
[0011]
[0012]
[0013] The amino acid sequence of the protein encoded by the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 is shown below:
[0014]
[0015] The present invention also provides an expression vector comprising the above-mentioned glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12.
[0016] The expression vector is pBI121. The expression vector is constructed by inserting the TaCOBL-A12 gene between the XbaI and SacI restriction sites of pBI121.
[0017] This invention also provides an application of the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 in the creation of heat-resistant plants or heat-resistant microorganisms.
[0018] Furthermore, the heat-resistant plant includes wheat.
[0019] The beneficial effects of this invention are as follows: This invention utilizes a combination of bioinformatics and molecular cloning techniques to clone a glycosylphosphatidylinositol-anchored protein gene, TaCOBL-A12, and its encoded protein, TaCOBL-A12, from wheat. This gene is then inserted into the expression vector pBI121, resulting in an overexpression vector. This overexpression vector is introduced into Arabidopsis thaliana, where high expression of TaCOBL-A12 significantly improves the plant's tolerance to high temperatures. The TaCOBL-A12 overexpression vector can be used for genetic engineering breeding, providing important genetic resources for molecular breeding of wheat stress resistance. Attached Figure Description
[0020] Figure 1 This is an agarose gel electrophoresis image of TaCOBL-A12 cloned from cDNA.
[0021] Figure 2 This is an agarose gel electrophoresis image of TaCOBL-A12 amplified from the cloning vector.
[0022] Figure 3 Agarose gel electrophoresis image of the linearized expression vector pBI121 after enzyme digestion.
[0023] Figure 4 This study aimed to verify the relative expression level of the TaCOBL-A12 gene and the heat tolerance of homozygous Arabidopsis thaliana transformants. Detailed Implementation
[0024] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings, but the scope of protection of the present invention is not limited to the following description. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0025] Example 1: Cloning the coding region sequence of the TaCOBL-A12 gene in Chinese spring seedlings induced by high temperature.
[0026] The wheat cultivar "Chinese Spring" (publicly known material, reference: International Wheat Genome Sequencing Consortium (IWGSC) (2018) Science 361,661) is a wheat reference genome sequencing cultivar. This experiment cloned a glycosylphosphatidylinositol anchoring protein gene (TaCOBL-A12) from the wheat cultivar "Chinese Spring". The specific procedure is as follows:
[0027] 1) Search for wheat COBLs genes. First, the amino acid sequence of the reported glycosylphosphatidylinositol anchoring protein TaBr1 (reference: Deng Q, Kong Z, Wu X, Ma S, Yuan Y, Jia H, Ma Z (2019) Cloning of a COBL gene determining brittleness in diploid wheat using a MapRseq approach. Plant Science 285:141–150.) was aligned online with the wheat genome database (WheatOmics 1.0, http: / / 202.194.139.32 / blast / blast.html) to obtain 40 TaCOBLs in wheat. After high-temperature induction, the relative expression of TaCOBLs was detected, and the induced gene TaCOBL-A12 was obtained.
[0028] 2) cDNA acquisition from Chinese spring wheat after high-temperature induction. Chinese spring wheat seedlings grown for 7 days at 25℃ / 20℃ with 14h / 10h light / dark conditions were transferred to a 42℃ incubator. Whole plant samples were collected after 0.5h and 2h, rapidly frozen in liquid nitrogen, and stored at -70℃ for RNA extraction. Total RNA was extracted using TRIzol (SIGMA, MO, USA) according to the reagent instructions, and reverse transcription was performed using the RevertAid™ Master Mix kit (Invitrogen, CA, USA) according to the instructions to obtain cDNA templates.
[0029] 3) The coding region fragment of TaCOBL-A12 was obtained by RT-PCR amplification. Primers for amplifying TaCOBL-A12 were designed based on the gene sequence of TaCOBL-A12 in IWGSC RefSeq v1.1 (gene ID: TraesCS6A02G379800) as follows:
[0030] P1: ATGGCGGCGCTTTCTGGC (as shown in SEQ ID NO.4)
[0031] P2: TCAGACATAGTAGGCCAGCAGG (as shown in SEQ ID NO. 5)
[0032] Using cDNA from *Cyclocarya paliurus* seedlings induced by high temperature for 0.5 h and 2 h as templates, the full-length coding region of TaCOBL-A12 in *Cyclocarya paliurus* was cloned by RT-PCR. The specific amplification process was as follows: 2 μl cDNA template (50 ng / μl), 0.8 μl primers P1 and P2, 6 μl 2 mM dNTPs, 15 μl 2×PCR Buffer for KOD FX Neo, 0.3 μl KOD FX Neo (TOYOBO, Japan), and water to a final volume of 30 μl. PCR amplification conditions: 94℃ pre-denaturation for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 1 min 30 s, 36 cycles; extension at 68℃ for 5 min. PCR products were electrophoresed on a 1.5% agarose gel at 100V for 20 min, and the size and specificity of the amplified bands were detected (see attached). Figure 1 A 1344bp specific amplified band was recovered (Tiangen, China).
[0033] 4) Cloning and sequencing of the TaCOBL-A12 gene. The amplified and recovered specific band was cloned into the pEASY-BluntZero vector (TransGen, China) and transformed into DH5α competent cells. Single clones containing the target gene TaCOBL-A12 were selected for sequencing using primers P1 and P2 for amplifying TaCOBL-A12. The sequencing results yielded a 1344 bp coding region sequence of TaCOBL-A12.
[0034] Example 2: Amplification of the TaCOBL-A12 insert fragment for constructing the pBI121:TaCOBL-A12 vector
[0035] Primers were designed based on the coding region sequence of the TaCOBL-A12 gene as follows:
[0036] P3: CACGGGGGACTCTAGAATGGCGGCGCTTTCTGGC (as shown in SEQ ID NO. 6)
[0037] P4: GATCGGGGAAATTCGAGCTTCCAGACATAGTAGGCCAGCAGG (as shown in SEQ ID NO. 7).
[0038] The 5' ends of P3 and P4 are fitted with 15-20 bp sequences complementary to the ends of the linearized vector (underlined sequences), facilitating the insertion of the amplified fragment into the expression vector pBI121 via recombinase. The specific amplification is as follows: The full-length 1344 bp coding region of TaCOBL-A12 is amplified using a diluted pEASY-Blunt Zero vector plasmid containing TaCOBL-A12 as a template. Amplification program: 2 μl plasmid template (20 ng / μl), 0.8 μl primers P3 and P4, 6 μl 2 mM dNTPs, 15 μl 2×PCR Buffer for KOD FX Neo, 0.3 μl KOD FX Neo (TOYOBO, Japan), and water to a final volume of 30 μl. PCR amplification conditions: 94℃ pre-denaturation for 2 min; 98℃ for 10 s, 60℃ for 30 s, 68℃ for 1 min 30 s, 36 cycles; extension at 68℃ for 5 min. PCR products were electrophoresed on a 1.5% agarose gel at 100V for 20 min. The size and specificity of the amplified bands were then detected. (See attached image) Figure 2 ), recovering specific amplified bands (Tiangen, China).
[0039] Example 3: Construction of pBI121: TaCOBL-A12 vector
[0040] The pBI121 vector was linearized by digestion with restriction endonucleases XbaI and SacI. The digestion products were subjected to 1% agarose gel electrophoresis at 100V for 30 min to detect the digested fragments (see attached image). Figure 3 The digested product of pBI121 was recovered (Tiangen, China). The recovered product of TaCOBL-A12 was combined with the linearized pBI121 vector fragment and processed using recombinase. The ligation reaction was performed using SnapAssembly Master Mix (TAKARA, Japan) as follows: 1 μl of recovered TaCOBL-A12 product (47.5 ng / μl), 1 μl of linearized pBI121 vector fragment digested with enzymes (45 ng / μl), 2 μl of 5×In-FusionSnap Assembly Master Mix, and water to a final volume of 10 μl. The ligation conditions were 50℃ for 15 min, followed by immediate placement on ice. 2.5 μl of the ligation product was transferred to DH5α competent cells and plated on LB agar plates containing 100 mg / L kanamycin resistance. Single clones were selected. After single-clone culture, the bacterial culture was used as a template for PCR screening using primers P3 and P4. Clones containing the insert fragment were sequenced to verify the insert sequence, yielding the recombinant vector pBI121:TaCOBL-A12 with a completely correct insert fragment.
[0041] Example 4: Preparation and Transformation of Agrobacterium GV3101 Competent Cells
[0042] A single Agrobacterium colony was picked from the plate and inoculated into 2 ml of LB broth (containing 25 mg / L rifampicin) and cultured overnight at 28°C with shaking at 220 rpm. The 2 ml overnight culture was transferred to 200 ml of LB broth containing the same antibiotic and cultured under the same conditions until OD600 = 0.5–0.7. The culture was then transferred to a 50 ml sterile centrifuge tube and centrifuged at 4°C, 4000 rpm for 10 min, discarding the supernatant. The cells were washed three times with pre-chilled 10% sterile glycerol, resuspended in 2 ml of pre-chilled 10% sterile glycerol, aliquoted, and flash-frozen in liquid nitrogen at -70°C for later use. Competent Agrobacterium cells were then removed and freeze-thawed on ice. 2 μl of the pBI121:TaCOBL-A12 expression vector plasmid (total 100 ng) was added to 100 μl of competent cells and mixed thoroughly. A mixture of Agrobacterium cells and plasmids was transferred to a pre-chilled electroporation cuvette (1 mm) and electroporated at 2000 V using a BioRad (USA) apparatus. The cuvette was then removed, and 500 μl of pre-chilled LB medium (containing 25 mg / L rifampin) was added and mixed thoroughly. The bacterial culture was then transferred to a 1.5 ml centrifuge tube and incubated at 28°C with shaking at 200 rpm for 5 h. The cells were collected by centrifugation at 4000 rpm for 3 min and plated onto LB agar plates containing 25 mg / L rifampin and 100 mg / L kanamycin. The plates were incubated upside down at 28°C for 1-2 days. Positive clones were detected by PCR, facilitating Arabidopsis genetic transformation.
[0043] Example 5: Transformation of Arabidopsis thaliana with TaCOBL-A12
[0044] The Arabidopsis plants were thoroughly watered the day before infection, and the siliques that had formed pods were removed. Positive Agrobacterium strains were selected and cultured overnight in LB liquid medium (containing 25 mg / L rifampin and 100 mg / L kanamycin). The overnight culture was inoculated 1:100 into 200 ml of the same antibiotic medium and incubated at 28°C and 220 rpm until the OD600 reached 1.8-2.0. A fresh infection solution was prepared: 1 / 2 MS, 5.0% sucrose, 0.02% Silwet L-77 (Solepro, China), pH 5.7. Agrobacterium cells were collected at 4000 rpm for 15 min and resuspended in the infection solution until the OD600 reached 0.8. The upper part of the Arabidopsis tissue was immersed in the infection solution for about 1 minute, with gentle agitation. The tissue was covered with plastic wrap to maintain humidity and kept in the dark overnight. One day later, remove the plastic wrap and transfer the Arabidopsis thaliana to a normal growth incubator until the seeds mature and all seeds are harvested.
[0045] Example 6: Screening of transgenic plants and acquisition of homozygotes
[0046] After transformation, the harvested T0 generation seeds were sterilized and sown on MS medium containing 50 mg / L kanamycin. Vernalization was performed at 4°C for 3 days, followed by normal light incubation. One week later, seedlings selected for kanamycin selection could be distinguished. Because the expression vector contained a kanamycin resistance site, the resistant seedlings of the transformants grew normally, while the non-transformants showed no resistance and exhibited chlorotic whitening. Resistant T1 generation seedlings were transplanted, and T1 generation seeds were harvested. These T1 generation seeds were sown on MS medium containing kanamycin for further selection. The segregation ratio of the T2 generation plants was used to determine whether it was a single-site insertion. T2 generation transgenic plants with single-site insertion were selected and transplanted. T2 generation seeds were harvested from each plant and sown on MS medium containing kanamycin for further screening of homozygotes. Those that did not segregate were considered homozygous.
[0047] Example 7: Detection of TaCOBL-A12 gene expression in transgenic Arabidopsis homozygotes
[0048] Wild-type Arabidopsis thaliana Col-0 and transgenic homozygous seeds were sterilized and spread atop MS medium. After 14 days of illumination, whole plants were sampled, rapidly frozen in liquid nitrogen, and stored at -70°C for RNA extraction. Total RNA was extracted using TRIzol (SIGMA, MO, USA) according to the reagent manufacturer's instructions, and reverse transcription was performed using the RevertAid™ Master Mix kit (Invitrogen, CA, USA) according to the manufacturer's instructions to obtain cDNA templates. Real-time quantitative PCR primers were designed based on the TaCOBL-A12 cDNA sequence as follows:
[0049] P5: TACTTCAACGGCGACAACTG (as shown in SEQ ID NO. 8)
[0050] P6: TGTGGAACCGAATGAACAGA (as shown in SEQ ID NO. 9)
[0051] The relative expression of the TaCOBL-A12 gene was detected using the Arabidopsis thaliana ACTIN gene as an internal reference. The specific amplification procedure for quantitative real-time PCR was as follows: 2 μl cDNA template (20 ng / μl), 0.5 μl primer P5 and 0.5 μl primer P6, 10 μl 2×SYBR Green Master Mix (Applied Biosystems, CA, USA), and water to a final volume of 20 μl. Quant Studio was used for amplification. TM 6. The Flex Real-time PCR system (Applied Biosystems, CA, USA) was used for real-time quantitative PCR amplification according to the reagent instructions. Two [units / items] were employed. -ΔΔCTThe relative expression level of the TaCOBL-A12 gene was calculated using the method shown in the attached document. Figure 4 As shown, the expression of the TaCOBL-A12 gene was detected in all transgenic homozygous Arabidopsis plants.
[0052] Example 8: Identification of heat resistance in transgenic plants
[0053] Using wild-type Arabidopsis thaliana Col-0 as a control, approximately 300 seeds from homozygous transgenic Arabidopsis thaliana obtained through transformation and screening were sterilized and treated in a 50°C water bath for 1 hour, with inversion and mixing every 20 minutes. The treated seeds were then sown on MS medium and cultured under normal light for 14 days. Germination rate was then recorded, and plants that successfully developed two cotyledons were considered surviving. The experiment was conducted in at least three biological replicates, and a t-test was used for significance analysis. Figure 4 As shown, the survival rate of wild-type Arabidopsis thaliana Col-0 was 25.60%, the survival rate of homozygous overexpression line OE1 was 39.52%, the survival rate of homozygous overexpression line OE2 was 28.21%, and the survival rate of homozygous overexpression line OE3 was 35.60%. The survival rate of transgenic homozygotes after heat treatment was 2.61% to 13.92% higher than that of wild-type Arabidopsis thaliana Col-0, with an average increase of 8.84%, and was positively correlated with the expression level of TaCOBL-A12 gene.
[0054] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.
Claims
1. The application of the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 in the creation of heat-resistant plants, characterized in that... The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the heat-resistant plant is wheat or Arabidopsis thaliana.
2. The application of the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 according to claim 1 in the creation of heat-resistant plants, characterized in that, The cDNA sequence corresponding to the glycosylphosphatidylinositol anchoring protein gene TaCOBL-A12 is shown in SEQ ID NO.2.