Membranous nephropathy PLA2R antigen epitope peptide and its application

Abstract

The present invention relates to the technical field of immunoassay, and discloses a membranous nephropathy PLA2R antigen epitope, an identification method and application, and a kit. The antigen epitope is selected from at least one of Ricin, CTLD1, CTLD4, CTLD5, CTLD6, CTLD7, and CTLD8. The membranous nephropathy PLA2R antigen epitope can bind to self-reactive B cells, present to T helper cells through major histocompatibility complex (MHC) class II receptors, and stimulated T cells release cytokines to feed back to B cells, stimulate the division and differentiation of plasma cells, and produce antibodies and memory B cells, which constitute the physiological target of the immune response of membranous nephropathy. The membranous nephropathy PLA2R antigen epitope identification method provided by the present invention can be used to perform high-sensitivity and specificity detection of the PLA2R antigen epitope, which is of great value for the diagnosis and prognosis of membranous nephropathy.

Description

Technical Field

[0001] The present invention relates to the technical field of immunoassay, and in particular to a membranous nephropathy PLA2R antigen epitope, an identification method and application, and a kit. Background Art

[0002] Membranous nephropathy (MN) is the most common cause of nephrotic syndrome in adults. In my country, the incidence of MN has increased year by year and has become the second primary glomerular disease after IgA nephropathy. PLA2R is the main autoantigen of MN. The extracellular region includes 10 different 7-17kDa domains, namely the cysteine-rich domain (CysR), the connexin type II domain (FNII) and 8 different c-type lectin domains (CTLD1-8).

[0003] Domestic and foreign studies have shown that 57-82% of primary MN have circulating PLA2R antibodies, and the sensitivity and specificity of serum PLA2R antibodies in diagnosing MN are 69% and 99%, respectively. PLA2R antibody titers are significantly correlated with the severity of the patient's condition and are biomarkers for monitoring treatment efficacy and disease immune activity.

[0004] In addition to the prognostic significance of PLA2R antibody titers, PLA2R epitopes have also attracted much attention in recent years. Synthesizing PLA2R proteins with different structural domains and then performing Western blot or ELISA is the main method for identifying PLA2R antigen epitopes.

[0005] However, the above methods are limited to the complete domain level. Different domain fragments are artificially constructed and designed. The conformation or accessibility of each potential epitope may change due to differences in construction design, expression system, protein stability, denaturation conditions, and the way the protein binds to the substrate, and the conclusions drawn are also controversial.

[0006] Yeast surface display technology is a genetic engineering technology that uses genetic engineering to display exogenous peptides or proteins in the form of fusion proteins on the surface of yeast, and is usually used for library screening. The biggest advantage of this technology is that it achieves the unity of genotype and phenotype. The displayed polypeptides or proteins on the surface of microorganisms have relatively independent spatial structures and biological activities, and can be functionally screened; while the DNA encoding polypeptides or proteins is inside the microorganism, it can be sequenced to determine the gene sequence of the polypeptides or proteins screened.

[0007] Therefore, it is of great significance to develop an identification method that can accurately screen PLA2R antigen epitopes. Summary of the invention

[0008] The purpose of the present invention is to overcome the defects of low accuracy and insufficient comprehensiveness in the identification method of PLA2R antigen epitope of membranous nephropathy in the prior art.

[0009] In order to achieve the above object, the present invention provides a membranous nephropathy PLA2R antigen epitope in a first aspect, wherein the antigen epitope is selected from at least one of Ricin, CTLD1, CTLD4, CTLD5, CTLD6, CTLD7 and CTLD8;

[0010] The amino acid sequence of Ricin is shown in SEQ ID NO.1;

[0011] The amino acid sequence of the CTLD1 is shown in SEQ ID NO.2;

[0012] The amino acid sequence of CTLD4 is shown in SEQ ID NO.3;

[0013] The amino acid sequence of CTLD5 is shown in SEQ ID NO.4;

[0014] The amino acid sequence of CTLD6 is shown in SEQ ID NO.5;

[0015] The amino acid sequence of CTLD7 is shown in SEQ ID NO.6;

[0016] The amino acid sequence of CTLD8 is shown in SEQ ID NO.7.

[0017] The second aspect of the present invention provides a method for identifying the membranous nephropathy PLA2R antigen epitope described in the first aspect, the method comprising:

[0018] (1) Construction of a yeast display library containing random fragments of PLA2R antigen;

[0019] (2) mixing and incubating the yeast display library with the serum sample I to obtain a complex I, and sequentially performing fluorescent staining I and flow cytometry sorting I on the complex I to obtain positive yeast cells with a positive rate of not less than 20%;

[0020] (3) Extracting yeast plasmid II from the positive yeast cells, transforming the yeast plasmid II into competent DH5α cells II, and then performing monoclonal sequencing, transforming into yeast, and comparing the monoclonal yeast that is verified to be positive with the full-length PLA2R gene.

[0021] The third aspect of the present invention provides use of the membranous nephropathy PLA2R antigen epitope described in the first aspect in the preparation of a membranous nephropathy diagnostic reagent.

[0022] The fourth aspect of the present invention provides a kit, which contains a reagent for detecting the membranous nephropathy PLA2R antigen epitope described in the first aspect.

[0023] The PLA2R antigen epitope of membranous nephropathy can bind to self-reactive B cells and present to T helper cells through major histocompatibility complex (MHC) class II receptors. Stimulated T cells release cytokines to feed back to B cells, stimulate the division and differentiation of plasma cells, and produce antibodies and memory B cells, which constitute the physiological target of the immune response of membranous nephropathy. The method for identifying the PLA2R antigen epitope of membranous nephropathy provided by the present invention can detect the PLA2R antigen epitope with high sensitivity and specificity, which is of great value for the diagnosis and prognosis of membranous nephropathy.

[0024] In particular, the inventors used yeast surface display technology to identify new PLA2R antigen epitopes (CTLD4, CTLD5 and CTLD6) that have never been reported before for membranous nephropathy, which have independent prognostic value for patients with membranous nephropathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a process flow chart of epitope screening of PLA2R yeast library provided by the present invention;

[0026] Figure 2 It is a sequence alignment diagram of exemplary samples P33 and P735 in flow cytometry sorting based on PLA2R antigen yeast library provided by the present invention;

[0027] Figure 3 It is the amino acid frequency distribution diagram of the exemplary samples P33 and P735 in the flow cytometry sorting based on the PLA2R antigen yeast library provided by the present invention;

[0028] Figure 4 This is a negative result diagram of flow cytometry analysis based on the PLA2R antigen yeast library provided by the present invention;

[0029] Figure 5 This is a positive result diagram of flow cytometry analysis based on the PLA2R antigen yeast library provided by the present invention;

[0030] Figure 6 The present invention provides a distribution diagram of antigen epitope types based on circulating anti-PLA2R antibodies in multiple membranous nephropathy patients;

[0031] Figure 7 The present invention provides a relationship diagram between the number of antigen epitopes of circulating anti-PLA2R antibodies and baseline urine protein in multiple membranous nephropathy patients;

[0032] Figure 8The present invention provides a relationship diagram between the number of antigen epitopes of circulating anti-PLA2R antibodies and the remission rate based on multiple cases of membranous nephropathy patients. DETAILED DESCRIPTION

[0033] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0034] In the present invention, "antigenic epitope", also known as antigenic determinant, refers to a specific structural site of an antigen molecule that is recognized by specific effector molecules or T lymphocytes and B lymphocytes in an immune response, thereby inducing cellular immunity and humoral immunity and producing an immune effect. For example, the PLA2R antigenic epitope in the present invention exists in PLA2R and can bind to an anti-PLA2R antibody.

[0035] As mentioned above, the first aspect of the present invention provides a membranous nephropathy PLA2R antigen epitope, which is selected from at least one of Ricin, CTLD1, CTLD4, CTLD5, CTLD6, CTLD7 and CTLD8;

[0036] The amino acid sequence of Ricin is shown in SEQ ID NO.1;

[0037] The amino acid sequence of the CTLD1 is shown in SEQ ID NO.2;

[0038] The amino acid sequence of CTLD4 is shown in SEQ ID NO.3;

[0039] The amino acid sequence of CTLD5 is shown in SEQ ID NO.4;

[0040] The amino acid sequence of CTLD6 is shown in SEQ ID NO.5;

[0041] The amino acid sequence of CTLD7 is shown in SEQ ID NO.6;

[0042] The amino acid sequence of CTLD8 is shown in SEQ ID NO.7.

[0043] According to a particularly preferred embodiment of the present invention, the antigenic epitope is selected from at least one of CTLD4, CTLD5, and CTLD6.

[0044] As mentioned above, the second aspect of the present invention provides a method for identifying the membranous nephropathy PLA2R antigen epitope of the first aspect, the method comprising:

[0045] (1) Construction of a yeast display library containing random fragments of PLA2R antigen;

[0046] (2) mixing and incubating the yeast display library with the serum sample I to obtain a complex I, and sequentially performing fluorescent staining I and flow cytometry sorting I on the complex I to obtain positive yeast cells with a positive rate of not less than 20%;

[0047] (3) Extracting yeast plasmid II from the positive yeast cells, transforming the yeast plasmid II into competent DH5α cells II, and then performing monoclonal sequencing, transforming into yeast, and comparing the monoclonal yeast that is verified to be positive with the full-length PLA2R gene.

[0048] Preferably, in step (1), the operation method for constructing the yeast display library containing random fragments of PLA2R antigen comprises:

[0049] a. performing a ligation reaction between the PLA2R antigen random fragment and the yeast vector, and transforming the product obtained by the ligation reaction into competent cells I for culture, thereby obtaining yeast plasmid I;

[0050] b. Transforming the yeast plasmid I into yeast competent cells to induce expression, so as to obtain the yeast display library containing random fragments of PLA2R antigen.

[0051] Preferably, in step a, the yeast vector is the yeast display vector pCTCON2 after being digested with Xcm I.

[0052] Preferably, in step a, the mass ratio of the PLA2R antigen random fragment to the yeast vector is 2-4:1.

[0053] The present invention has no particular limitation on the method for obtaining the random fragments of the PLA2R antigen, and the random fragments can be obtained by methods known in the art. For example, the present invention sequentially amplifies the full-length PLA2R gene by PCR, fragments DNA, recombines the random fragments, and adds an A-tail to the random fragments.

[0054] Preferably, in step b, the competent yeast cells are EBY100 competent yeast cells.

[0055] Preferably, in step (2), 1-3 mL of the yeast display library is mixed with 40-50 uL of serum sample I for incubation I, and the yeast content is (1-3)×10 7 indivual.

[0056] Preferably, in step (2), the conditions of the mixed incubation I at least include: a temperature of -10°C to 0°C and a time of 30-60 min.

[0057] According to a particularly preferred embodiment of the present invention, the competent cell I and the competent cell II are both Escherichia coli competent DH5α.

[0058] Preferably, in step (3), the method further comprises: mixing and incubating the monoclonal yeast with a serum sample II to obtain a complex II, and sequentially performing fluorescent staining II and flow cytometry sorting II on the complex II.

[0059] The methods and conditions of the fluorescent staining I and II in the present invention can be selected conventionally in the art, and those skilled in the art can adjust the methods and conditions of the fluorescent staining according to actual conditions, which will not be repeated here. Preferably, the fluorescent staining I and the fluorescent staining II are both performed under the dilution conditions of the secondary antibody of PE-antihuman IgG4.

[0060] The methods and conditions of flow sorting I and flow sorting II in the present invention can be selected conventionally in the art. Those skilled in the art can adjust the methods and conditions of fluorescent staining according to actual conditions, which will not be described in detail here.

[0061] Preferably, the flow sorting I and the flow sorting II are both performed using a flow cytometer.

[0062] As mentioned above, the third aspect of the present invention provides the use of the membranous nephropathy PLA2R antigen epitope described in the first aspect in the preparation of a membranous nephropathy diagnostic reagent.

[0063] According to a particularly preferred embodiment of the present invention, the membranous nephropathy is idiopathic membranous nephropathy.

[0064] As mentioned above, the fourth aspect of the present invention provides a kit, which contains a reagent for detecting the membranous nephropathy PLA2R antigen epitope described in the first aspect.

[0065] The present invention will be described in detail below through examples.

[0066] In the following examples, unless otherwise specified, all products used were purchased from chemical or biological reagent suppliers known in the industry, and all methods used were commonly used methods in the art.

[0067] In the following examples, unless otherwise specified, the serum samples are all serum from patients with membranous nephropathy.

[0068] Escherichia coli competent DH5α: Catalog number 9027, purchased from Takara;

[0069] PE-antihuman IgG4 secondary antibody: Catalog number 9190-09, purchased from Southern Biotech.

[0070] In the following examples, unless otherwise specified, the genes used and synthesized were all commissioned to be synthesized by GeneWeizhi, and the sequencing was all commissioned to be performed by GeneWeizhi.

[0071] Example 1

[0072] like Figure 1 As shown, this example is used to illustrate the method of constructing a yeast display library containing random fragments of PLA2R antigen in the present invention. The specific steps are as follows:

[0073] (1) PCR amplification of the full-length PLA2R gene

[0074] The full-length PLA2R gene (synthesized by GENEWIZ) was recombined into the pcDNA3.4 vector (preserved by Zhang Linqi's laboratory) and transformed into the competent Escherichia coli DH5α. A large number of plasmids containing the full-length PLA2R gene were obtained by plasmid extraction. Then, the PCR reaction system was prepared in a PCR tube as shown in Table 1 and amplified by PCR amplification technology to obtain the full-length PLA2R DNA.

[0075] Among them, the upstream primer was GGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCCCAGGGGATAGGGTGGGAGGGTGTGGCGGCGGCGCT, and the downstream primer was GAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTCGGATCCCCAGGGGATAGGGTGGGCTGTGACTTGGTCCTTTTTC;

[0076] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 5 min, followed by 35 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 5 s, and extension at 68°C for 10 s, and then maintaining at 68°C for 5 min.

[0077] Table 1

[0078]

[0079] (2) DNA fragmentation enzyme random digestion of PLA2R full length

[0080] According to Table 2, 40 µL of enzyme digestion system was prepared to digest the full length of PLA2R to obtain random fragments with a length of 50-100 bp.

[0081] The enzyme digestion reaction conditions are: 100 min at 37°C.

[0082] Table 2

[0083]

[0084] (3) Random fragment recombination

[0085] The random fragments obtained above were purified using a DNA recovery kit and used as templates to perform PCR according to the volume shown in Table 3.

[0086] PCR reaction conditions: pre-denaturation at 94°C for 5 min, followed by denaturation at 98°C for 10 s, annealing at 60°C for 5 s and extension at 68°C for 5 s×4 cycles + 10 s×4 cycles + 15 s×4 + 20 s×4 cycles, which can recombinate random fragments into long fragments with a length of approximately 100 bp-750 bp.

[0087] Table 3

[0088]

[0089] (4) Random fragment with A tail

[0090] According to the reaction system shown in Table 4, the ends of the recombinant DNA fragments obtained above were added with A tails.

[0091] The reaction conditions were: 72°C for 20 minutes and then ice bath for 4 minutes.

[0092] Table 4

[0093]

[0094] (5) Xcm Ⅰ digested yeast vector

[0095] The yeast vector (pCTCON2, donated by Drs. K. Dane Wittrup and Annie Gai's laboratory) was digested with enzymes according to the enzyme digestion system shown in Table 5, and the reaction conditions were 37°C overnight.

[0096] Table 5

[0097]

[0098] (6) TA ligation reaction

[0099] The recombinant DNA fragment with the A tail was subjected to TA ligation reaction with the yeast vector pCTCON2 cut with Xcm I. The ligation reaction system was as shown in Table 6, and the ligation reaction condition was 16° C. overnight.

[0100] Table 6

[0101]

[0102] (7) Yeast transformation

[0103] The ligation reaction product obtained above was electroporated (2 mm electroporation cup, voltage 2500 V) into the competent E. coli DH5α and plated for culture. The estimated bacterial library capacity was (2-3) × 10 6 The yeast plasmid I was obtained, and colonies were randomly selected for sequencing to determine the fragment size and distribution in the library. Then, the yeast plasmid I obtained above was transformed into EBY100 yeast competent cells (preserved by Zhang Linqi's laboratory) according to the transformation system in Table 7. The yeast library capacity was estimated to be (1-1.5)×10 7 , induced expression to obtain a yeast display library containing random fragments of PLA2R antigen.

[0104] The induction expression process is as follows: the monoclonal yeast is resuspended in SGCAA medium, diluted to an absorbance value of 0.5-1 at a wavelength of 600 nm, and induced in a shaker at 20° C. and 250 rpm for 36 hours.

[0105] Table 7

[0106]

[0107] Example 2

[0108] This example is used to illustrate the method of obtaining the distribution of anti-PLA2R antigen epitopes in patients with membranous nephropathy by flow sorting in the present invention, comprising:

[0109] The yeast display library after induction expression was about 10 5 Add the sample to the EP tube, add 20ul of serum sample and incubate on ice for 1h, then wash twice with PBS and add 50ul of PE-antihuman IgG4 secondary antibody (1:200 dilution), incubate on ice for 45min, wash 3 times and sort using flow cytometer (model BD FACSAriaⅡ).

[0110] The positive yeast population obtained after sorting is expanded and induced to express again (refer to the expansion and induction process in Example 1). After repeating sorting for 3 rounds, yeast plasmid II is extracted from the positive yeast cells obtained by sorting. The yeast plasmid II is transformed into Escherichia coli competent DH5α according to the method of step (1) in Example 1, and then monoclonal sequencing is performed. The plasmids with representative sequences in the sequencing results (several plasmids of different lengths for each domain (including but not limited to the longest sequence, the shortest sequence and the sequence where the amino acid frequency graph peak is located)) are selected and transformed into yeast to obtain monoclonal yeast. The monoclonal yeast verified as positive is compared with the full-length PLA2R gene. The anti-PLA2R antigen epitope map of patients with membranous nephropathy is obtained, such as Figure 2 and Figure 3 shown.

[0111] from Figure 2 and Figure 3 It can be seen that there are differences in the epitope maps of different patients. Ricin and CTLD7 are relatively dominant epitopes. In addition, new epitopes of CTLD4, CTLD5, and CTLD6 that have not been reported before were identified.

[0112] The amino acid sequence of the membranous nephropathy PLA2R antigen epitope newly identified by the yeast display library method in the present invention is shown in Table 8.

[0113] Table 8

[0114]

[0115] Example 3

[0116] The identification method provided by the present invention was used to identify the antigen epitope maps of circulating anti-PLA2R antibodies in 389 patients with newly diagnosed, relapsed, and refractory membranous nephropathy. The specific method is as follows:

[0117] The Ricin yeast solution, CTLD1 yeast solution, CTLD4 yeast solution, CTLD5 yeast solution, CTLD6 yeast solution, CTLD7 yeast solution, and CTLD8 yeast solution were centrifuged at 8000 rpm for 1 min, and the supernatant was discarded to obtain the monoclonal yeast of each antigen epitope, and the cells were resuspended in SGCAA medium and diluted to an absorbance value of 0.5-1 at a wavelength of 600 nm, and induced in a shaker at 20° C. and 250 rpm for 36 hours to obtain the induced Ricin yeast solution, CTLD1 yeast solution, CTLD4 yeast solution, CTLD5 yeast solution, CTLD6 yeast solution, CTLD7 yeast solution, and CTLD8 yeast solution, respectively;

[0118] The induced Ricin yeast solution, CTLD1 yeast solution, CTLD4 yeast solution, CTLD5 yeast solution, CTLD6 yeast solution, CTLD7 yeast solution, and CTLD8 yeast solution were added to a 96-well plate, and the required number was about 10 8 , centrifuge at 8000 rpm for 1 min, and discard the supernatant;

[0119] Then add 10 ml of 0.01 M PBS solution, pipette up and down to resuspend the yeast cells, centrifuge at 8000 rpm for 1 min, and discard the supernatant; add 10 ml of 0.01 M PBS solution again, pipette up and down to resuspend the yeast cells, add to a conical-bottom 96-well plate, add 100 ul to each well, centrifuge at 8000 rpm for 1 min, and discard the supernatant; add 20 ul of serum to each well, mix with the yeast precipitate by pipetting, and place on ice for 1 hour.

[0120] After the ice bath, centrifuge at 8000 rpm for 1 min and discard the supernatant. Use a spray gun to add 200ul / well PBS solution to resuspend the yeast, centrifuge at 8000 rpm for 1 min and discard the supernatant. Repeat this step once.

[0121] Then dilute the secondary antibody of PE-antihuman IgG4 with PBS solution at a ratio of 1:200, transfer to the sample tank, add 50ul / well to resuspend the yeast with a dispenser, keep it away from light and put it in an ice bath for 45min, centrifuge it at 8000rpm for 1min, discard the supernatant, add 200ul of PBS to each well, wash the yeast cells 3 times, resuspend the yeast with 200ul of PBS solution, and place the resuspended yeast in a flow cytometer (model BD LSRFortessa SORP) for batch flow analysis. For specific analysis results, see Figure 4-Figure 5 .

[0122] in, Figure 4 , respectively, are negative results of flow analysis based on PLA2R antigen yeast library of the present invention, Figure 5 This is a diagram showing the positive results of flow cytometry analysis based on the PLA2R antigen yeast library of the present invention.

[0123] from Figure 4 and Figure 5 It can be seen that monoclonal yeast flow cytometry can well identify whether a specific antigen epitope exists in patients with membranous nephropathy. Therefore, by performing flow cytometry analysis on the above 7 representative yeasts respectively, the epitope distribution of patients can be obtained.

[0124] By performing batch flow cytometry analysis on the sera of the aforementioned 389 patients with PLA2R-related membranous nephropathy, the distribution of each epitope in this population can be obtained, see Table 9.

[0125] Table 9

[0126]

[0127] As can be seen from the above table, Ricin, as the main epitope, can be recognized by all patient sera; 53.3% of patients have the CTLD1 epitope, 53.8% of patients have the CTLD7 epitope, and CTLD5 is also relatively common, appearing in 44.5% of patients; CTLD6, CTLD8 and CTLD4 are weak epitopes, with positive rates of 8.5%, 8.2% and 6.9% respectively.

[0128] The present invention also exemplarily integrates the serum of all membranous nephropathy patients with the flow cytometry analysis results of Ricin, CTLD1, CTLD7, CTLD8, CTLD4, CTLD5, and CTLD6 yeast monoclonals to obtain the epitope distribution map of the patients, as shown in Table 10 and Figure 6 .

[0129] Table 10

[0130]

[0131] from Figure 6 As can be seen from Table 10, there are up to 30 different epitope distribution forms, among which the common map types are Ricin (accounting for 17.7%), Ricin+CTLD1 (accounting for 12.9%), Ricin+CTLD7 (accounting for 6.9%), Ricin+CTLD5 (accounting for 9.5%), Ricin+CTLD1+CTLD7 (accounting for 12.3%), Ricin+CTLD5+CTLD7 (accounting for 10.3%), and Ricin+CTLD1+CTLD5+CTLD7 (accounting for 10.8%).

[0132] The present invention also exemplarily provides a relationship diagram of the number of antigenic epitopes of circulating anti-PLA2R antibodies and baseline urine protein based on multiple cases of membranous nephropathy patients provided by the present invention, and a relationship diagram of the number of antigenic epitopes of circulating anti-PLA2R antibodies and remission rate based on multiple cases of membranous nephropathy patients, respectively. Figure 7 and Figure 8 .

[0133] from Figure 7 and Figure 8 It can be seen that the more antigen epitopes there are, the lower the baseline urine protein is and the lower the remission rate is. In other words, the number of epitopes is negatively correlated with both baseline urine protein and remission rate.

[0134] In summary, the identification method provided by the present invention can obtain a more accurate number and distribution of PLA2R antigen epitope maps of patients with membranous nephropathy; and for the presence of multiple epitopes (epitope expansion), the clinic should consider strengthening the intensity of immunosuppressive treatment.

[0135] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A membranous nephropathy PLA2R antigen epitope peptide, characterized in that: The antigen epitope peptide is selected from at least one of CTLD4, CTLD5, and CTLD6; The amino acid sequence of CTLD4 is shown in SEQ ID NO.3; The amino acid sequence of CTLD5 is shown in SEQ ID NO.4; The amino acid sequence of CTLD6 is shown in SEQ ID NO.

5.

2. Application of membranous nephropathy PLA2R antigen epitope peptide in the preparation of membranous nephropathy diagnostic reagent; characterized in that, The antigen epitope peptide is selected from at least one of CTLD4, CTLD5, and CTLD6; The amino acid sequence of CTLD4 is shown in SEQ ID NO.3; The amino acid sequence of CTLD5 is shown in SEQ ID NO.4; The amino acid sequence of CTLD6 is shown in SEQ ID NO.

5.

3. The use according to claim 2, wherein: The membranous nephropathy is idiopathic membranous nephropathy.

Images