Channa feed, preparation method, feeding method and application

Abstract

The present application relates to the field of snakehead aquaculture technology, and specifically to snakehead feed, preparation method, feeding method and application. The snakehead feed is based on conventional basic feed, and a small amount of four amino acids are added to obtain a special snakehead feed. The snakehead feed, feeding method and application can not only promote the growth of fish, but also obtain a higher feed utilization rate, and can also reduce feed costs.

Description

Technical Field

[0001] The present application relates to the technical field of snakehead aquaculture, and in particular to snakehead feed, a preparation method, a feeding method and an application thereof. Background Art

[0002] Channa maculata is an important indigenous fish species in my country. It has a high meat yield, delicious taste, delicate meat, balanced nutrition, and medicinal value of removing blood stasis, promoting new blood, promoting muscle growth and replenishing blood, and nourishing and conditioning. It can be used as a daily nourishing and conditioning and dietary therapy material after surgery or trauma, with an annual output of more than 500,000 tons. Channa is a typical ferocious carnivorous fish with a high demand for feed protein, with a feed protein level of more than 43%. With the development of the breeding industry, it is of great strategic significance to optimize feed formula, reduce breeding costs, improve production efficiency, and develop low-pollution functional feeds that replace fish meal.

[0003] Proteins have many important nutritional and biological functions. In addition to providing amino acids for endogenous protein synthesis, they are also involved in regulating animal feed intake, lipid and glucose metabolism, and the secretion of digestive enzymes and hormones to maintain normal growth, development and reproduction. Too high a protein level in feed can easily lead to nutritional imbalance in the feed, reduce the digestion and utilization efficiency of nutrients by fish, increase the emission of aquaculture pollutants, and not only increase feed costs, but also easily cause water pollution. On the contrary, too low a protein content in feed leads to insufficient supply of essential amino acids. Protein is not used for body growth, but is first used as energy to meet the basic metabolic needs of fish. Summary of the invention

[0004] Based on this, the present application provides snakehead feed, preparation method and application.

[0005] In a first aspect, an embodiment discloses a snakehead feed, comprising, by weight: 250 to 350 parts of fish meal, 150 to 250 parts of soybean meal, 50 to 150 parts of corn gluten meal, 80 to 120 parts of high-gluten flour, 100 to 150 parts of cassava starch, 15 to 35 parts of fish oil, 20 to 40 parts of soybean oil, 40 to 60 parts of multi-mineral premix, 3 to 5 parts of multi-dimensional premix, 0.8 to 1.5 parts of choline chloride, 5 to 10 parts of L-isoleucine A crystals, 4 to 8 parts of methionine, 10 to 20 parts of arginine and 5 to 10 parts of threonine.

[0006] In an embodiment of the first aspect, the snakehead feed comprises, by weight: 300-350 parts of fish meal, 180-220 parts of soybean meal, 80-120 parts of corn gluten meal, 100-120 parts of high-gluten flour, 110-130 parts of cassava starch, 20-35 parts of fish oil, 25-35 parts of soybean oil, 45-55 parts of multi-mineral premix, 3.5-4.5 parts of multi-dimensional premix, 1-1.2 parts of choline chloride, 6-10 parts of L-isoleucine A crystals, 5-7 parts of methionine, 12-18 parts of arginine and 6-9 parts of threonine.

[0007] In an embodiment of the first aspect, the snakehead feed may optionally include, by weight: 300 parts of fish meal, 220 parts of soybean meal, 120 parts of corn gluten meal, 100 parts of high-gluten flour, 110 parts of cassava starch, 35 parts of fish oil, 25 parts of soybean oil, 55 parts of multi-mineral premix, 3.5 parts of multi-dimensional premix, 1 part of choline chloride, 10 parts of L-isoleucine A crystals, 7 parts of methionine, 12 parts of arginine and 9 parts of threonine.

[0008] In an embodiment of the first aspect, the snakehead feed may optionally include, by weight: 350 parts of fish meal, 180 parts of soybean meal, 80 parts of corn gluten meal, 120 parts of high-gluten flour, 130 parts of cassava starch, 20 parts of fish oil, 35 parts of soybean oil, 45 parts of multi-mineral premix, 4.5 parts of multi-dimensional premix, 1.2 parts of choline chloride, 6 parts of L-isoleucine A crystals, 5 parts of methionine, 18 parts of arginine and 6 parts of threonine.

[0009] In an embodiment of the first aspect, the snakehead feed may optionally include, by weight: 310 parts of fish meal, 200 parts of soybean meal, 100 parts of corn protein meal, 113 parts of high-gluten flour, 120 parts of cassava starch, 30 parts of fish oil, 30 parts of soybean oil, 50 parts of multi-mineral premix, 3.9 parts of multi-dimensional premix, 1.1 parts of choline chloride, 8 parts of L-isoleucine A crystals, 6 parts of methionine, 15 parts of arginine and 8 parts of threonine.

[0010] In an embodiment of the first aspect, the multidimensional premix comprises, by weight, 10 to 30 parts of vitamin B1, 10 to 30 parts of vitamin B2, 10 to 30 parts of vitamin B6, 0.01 to 0.03 parts of vitamin B12, 4 to 6 parts of folic acid, 40 to 60 parts of calcium pantothenate, 80 to 120 parts of inositol, 80 to 120 parts of niacin, 0.05 to 0.15 parts of biotin, 3000 to 4000 parts of cellulose, 80 to 120 parts of vitamin C, 8 to 12 parts of vitamin A, 1 to 3 parts of vitamin D, 80 to 120 parts of vitamin E and 8 to 12 parts of vitamin K.

[0011] In an embodiment of the first aspect, the multivitamin premix comprises, by weight, 20 parts of vitamin B1, 20 parts of vitamin B2, 20 parts of vitamin B6, 0.02 parts of vitamin B12, 5 parts of folic acid, 50 parts of calcium pantothenate, 100 parts of inositol, 100 parts of niacin, 0.1 parts of biotin, 3522 parts of cellulose, 100 parts of vitamin C, 11 parts of vitamin A, 2 parts of vitamin D, 100 parts of vitamin E and 10 parts of vitamin K.

[0012] In an embodiment of the first aspect, the multi-mineral premix comprises, by weight, 400-600 parts of sodium chloride, 7000-9000 parts of magnesium sulfate, 10000-15000 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7000-8000 parts of calcium hydrogen phosphate, 2000-3000 parts of ferrous sulfate, 1000-2000 parts of calcium lactate, 100-200 parts of zinc sulfate, 50-70 parts of manganese sulfate, 10-20 parts of copper sulfate, 0.8-1 part of cobalt sulfate, 1.0-1.5 parts of potassium iodide, 0.4-0.8 part of sodium selenite and 800-1000 parts of starch.

[0013] In an embodiment of the first aspect, the multi-mineral premix comprises, by weight, 500 parts of sodium chloride, 8155.6 parts of magnesium sulfate, 12500 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7650.6 parts of calcium hydrogen phosphate, 2286.2 parts of ferrous sulfate, 1750 parts of calcium lactate, 178 parts of zinc sulfate, 61.4 parts of manganese sulfate, 15.5 parts of copper sulfate, 0.91 parts of cobalt sulfate, 1.5 parts of potassium iodide, 0.6 parts of sodium selenite and 899.7 parts of starch.

[0014] In the second aspect, the embodiment discloses a method for preparing a snakehead feed. The preparation method comprises: obtaining a formula of snakehead feed; preparing according to the formula. The formula comprises, by weight: 250 to 350 parts of fish meal, 150 to 250 parts of soybean meal, 50 to 150 parts of corn protein meal, 80 to 120 parts of high-gluten flour, 100 to 150 parts of cassava starch, 15 to 35 parts of fish oil, 20 to 40 parts of soybean oil, 40 to 60 parts of multi-mineral premix, 3 to 5 parts of multi-dimensional premix, 0.8 to 1.5 parts of choline chloride, 5 to 10 parts of L-isoleucine A crystals, 4 to 8 parts of methionine, 10 to 20 parts of arginine and 5 to 10 parts of threonine.

[0015] In an embodiment of the second aspect, the formula comprises, by weight: 300-350 parts of fish meal, 180-220 parts of soybean meal, 80-120 parts of corn gluten meal, 100-120 parts of high-gluten flour, 110-130 parts of cassava starch, 20-35 parts of fish oil, 25-35 parts of soybean oil, 45-55 parts of multi-mineral premix, 3.5-4.5 parts of multi-dimensional premix, 1-1.2 parts of choline chloride, 6-10 parts of L-isoleucine A crystals, 5-7 parts of methionine, 12-18 parts of arginine and 6-9 parts of threonine.

[0016] In an embodiment of the second aspect, the formula comprises, by weight: 300 parts of fish meal, 220 parts of soybean meal, 120 parts of corn gluten meal, 100 parts of high-gluten flour, 110 parts of cassava starch, 35 parts of fish oil, 25 parts of soybean oil, 55 parts of multi-mineral premix, 3.5 parts of multi-dimensional premix, 1 part of choline chloride, 10 parts of L-isoleucine A crystals, 7 parts of methionine, 12 parts of arginine and 9 parts of threonine.

[0017] In an embodiment of the second aspect, the formula optionally includes, by weight: 350 parts of fish meal, 180 parts of soybean meal, 80 parts of corn gluten meal, 120 parts of high-gluten flour, 130 parts of cassava starch, 20 parts of fish oil, 35 parts of soybean oil, 45 parts of multi-mineral premix, 4.5 parts of multi-dimensional premix, 1.2 parts of choline chloride, 6 parts of L-isoleucine A crystals, 5 parts of methionine, 18 parts of arginine and 6 parts of threonine.

[0018] In an embodiment of the second aspect, the formula optionally includes, by weight: 310 parts of fish meal, 200 parts of soybean meal, 100 parts of corn gluten meal, 113 parts of high-gluten flour, 120 parts of cassava starch, 30 parts of fish oil, 30 parts of soybean oil, 50 parts of multi-mineral premix, 3.9 parts of multi-dimensional premix, 1.1 parts of choline chloride, 8 parts of L-isoleucine A crystals, 6 parts of methionine, 15 parts of arginine and 8 parts of threonine.

[0019] In an embodiment of the second aspect, the multidimensional premix comprises, by weight, 10 to 30 parts of vitamin B1, 10 to 30 parts of vitamin B2, 10 to 30 parts of vitamin B6, 0.01 to 0.03 parts of vitamin B12, 4 to 6 parts of folic acid, 40 to 60 parts of calcium pantothenate, 80 to 120 parts of inositol, 80 to 120 parts of niacin, 0.05 to 0.15 parts of biotin, 3000 to 4000 parts of cellulose, 80 to 120 parts of vitamin C, 8 to 12 parts of vitamin A, 1 to 3 parts of vitamin D, 80 to 120 parts of vitamin E and 8 to 12 parts of vitamin K.

[0020] In an embodiment of the second aspect, the multivitamin premix comprises, by weight, 20 parts of vitamin B1, 20 parts of vitamin B2, 20 parts of vitamin B6, 0.02 parts of vitamin B12, 5 parts of folic acid, 50 parts of calcium pantothenate, 100 parts of inositol, 100 parts of niacin, 0.1 parts of biotin, 3522 parts of cellulose, 100 parts of vitamin C, 11 parts of vitamin A, 2 parts of vitamin D, 100 parts of vitamin E and 10 parts of vitamin K.

[0021] In an embodiment of the second aspect, the multi-mineral premix comprises, by weight, 400-600 parts of sodium chloride, 7000-9000 parts of magnesium sulfate, 10000-15000 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7000-8000 parts of calcium hydrogen phosphate, 2000-3000 parts of ferrous sulfate, 1000-2000 parts of calcium lactate, 100-200 parts of zinc sulfate, 50-70 parts of manganese sulfate, 10-20 parts of copper sulfate, 0.8-1 part of cobalt sulfate, 1.0-1.5 parts of potassium iodide, 0.4-0.8 part of sodium selenite and 800-1000 parts of starch.

[0022] In an embodiment of the second aspect, the multi-mineral premix comprises, by weight, 500 parts of sodium chloride, 8155.6 parts of magnesium sulfate, 12500 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7650.6 parts of calcium hydrogen phosphate, 2286.2 parts of ferrous sulfate, 1750 parts of calcium lactate, 178 parts of zinc sulfate, 61.4 parts of manganese sulfate, 15.5 parts of copper sulfate, 0.91 parts of cobalt sulfate, 1.5 parts of potassium iodide, 0.6 parts of sodium selenite and 899.7 parts of starch.

[0023] In a third aspect, an embodiment discloses a feeding method for snakehead, which comprises: obtaining the snakehead feed as described in the first aspect; and feeding the snakehead feed to snakehead.

[0024] In a fourth aspect, the embodiment discloses the application of the snakehead feed described in the first aspect. The application is selected from at least one of: increasing the weight of snakehead; increasing the specific growth rate of snakehead; increasing the fatness of snakehead; increasing the protein efficiency of snakehead; increasing the intestinal trypsin activity of snakehead; increasing the intestinal amylase activity of snakehead; increasing the intestinal lipase activity of snakehead; promoting the expression of TOR gene in the liver of snakehead; inhibiting the expression of 4EBP1 gene in the liver of snakehead; inhibiting the expression of 4EBP2 gene in the liver of snakehead;

[0025] In order to better understand the present application but not to limit the scope of the present application, all the numbers used in the present application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0026] The term "part" refers to parts by weight only. Specifically, any weight can be used as 1 part, such as 0.001g, 0.01g, 0.05g, 0.1g, 0.5g, 1g, 10g, 100g, 1000g, 5000g, 10000g, etc. There is no specific limitation on the absolute weight of 1 part.

[0027] The snakehead provided in the present application is based on conventional basic feed, and a small amount of four amino acids are added to obtain a special snakehead feed. The snakehead feed can increase the weight of snakehead; increase the specific growth rate of snakehead; increase the fatness of snakehead; increase the protein efficiency of snakehead; increase the intestinal trypsin activity of snakehead; increase the intestinal amylase activity of snakehead; increase the intestinal lipase activity of snakehead; promote the expression of TOR gene in the liver of snakehead; inhibit the expression of 4EBP1 gene in the liver of snakehead; inhibit the expression of 4EBP2 gene in the liver of snakehead. The snakehead feed, feeding method and application can obtain a higher feed utilization rate without affecting the growth of fish, and can reduce feed costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The weight gain rates of the Channa in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "*" indicates p<0.05, and "**" indicates p<0.01.

[0029] Figure 2 The specific growth rates of Channa in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "*" indicates p<0.05, and "**" indicates p<0.01.

[0030] Figure 3 The fatness of the Channa in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "ns" means no significant difference.

[0031] Figure 4The protein efficiency of the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Among them, "*" indicates p < 0.05, and "**" indicates p < 0.01.

[0032] Figure 5 The intestinal trypsin activity of Channa natans in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "*" indicates p<0.05, and "**" indicates p<0.01.

[0033] Figure 6 The intestinal lipase activity of Channa natans in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "**" indicates p<0.01.

[0034] Figure 7 The intestinal amylase activity of Channa natans in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Wherein, "*" indicates p<0.05.

[0035] Figure 8 The mRNA expression levels of TOR, 4EBP1, and 4EBP2 genes in the liver of Channa natans in the experimental group (exp), control group 1 (control1), control group 2 (control2), and control group 3 (control3) provided in the examples. Among them, "*" indicates p < 0.05, and "**" indicates p < 0.01. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0037] Preparation of L-isoleucine B crystals

[0038] The preparation process of L-isoleucine B crystals includes (see, Liu Xing, Study on the influence of additives on the crystallization process of L-isoleucine polycrystalline solution [D], Hebei University of Technology, Master, 2021):

[0039] (1) Add 500 g of water into a 500 mL jacketed crystallizer and heat the crystallizer to 363.15 K using a constant speed programmable thermostat with a stirring rate of 400 rpm.

[0040] (2) After the temperature is constant, add 30 g of L-isoleucine raw material and stir at constant temperature for 60 minutes to ensure that all the solids are dissolved.

[0041] (3) Use a constant-speed programmable thermostatic bath to cool the system at a rate of 2 K / min. When crystals appear and the solution becomes turbid, stop cooling and keep the solution warm for 30 min.

[0042] (4) The slurry is filtered using a Buchner funnel, and the obtained solid is placed in an oven at 313.15K and dried for 24 hours to obtain L-isoleucine B crystals.

[0043] Preparation of L-isoleucine A crystals

[0044] The preparation process of L-isoleucine A crystals includes:

[0045] (1) 500 g of water and 4.537 g of acetic acid were added to a 500 mL jacketed crystallizer. The crystallizer was heated to 363.15 K using a constant speed programmable thermostat and the stirring rate was set to 400 rpm.

[0046] (2) After the temperature is constant, add 30 g of L-isoleucine raw material and stir at constant temperature for 60 minutes to ensure that all the solids are dissolved.

[0047] (3) Use a constant-speed programmable thermostatic bath to cool the system at a rate of 2 K / min. When crystals appear and the solution becomes turbid, stop cooling and keep the solution warm for 30 min.

[0048] (4) The slurry is filtered using a Buchner funnel, and the obtained solid is placed in an oven at 313.15K and dried for 24 hours to obtain L-isoleucine A crystals.

[0049] Feeding experiment

[0050] 1. Materials and Methods

[0051] 1. Preparation of Channa Feed

[0052] The basic feed contained 310 g fish meal, 200 g soybean meal, 100 g corn gluten meal, 113 g high-gluten flour, 120 g tapioca starch, 30 g fish oil, 30 g soybean oil, 50 g multi-mineral premix, 3.9 g multi-vitamin premix and 1.1 g choline chloride.

[0053] The multivitamin premix (mg / kg feed) contained 20 mg / kg vitamin B1, 20 mg / kg vitamin B2, 20 mg / kg vitamin B6, 0.02 mg / kg vitamin B12, 5 mg / kg folic acid, 50 mg / kg calcium pantothenate, 100 mg / kg inositol, 100 mg / kg niacin, 0.1 mg / kg biotin, 3522 mg / kg cellulose, 100 mg / kg vitamin C, 11 mg / kg vitamin A, 2 mg / kg vitamin D, 100 mg / kg vitamin E and 10 mg / kg vitamin K.

[0054] The multi-mineral premix (feed) contained 0.5 g / kg sodium chloride, 8.1556 g / kg magnesium sulfate, 12.5 g / kg sodium dihydrogen phosphate, 16 g / kg potassium dihydrogen phosphate, 7.6506 g / kg calcium hydrogen phosphate, 2.2862 g / kg ferrous sulfate, 1.75 g / kg calcium lactate, 178 mg / kg zinc sulfate, 61.4 mg / kg manganese sulfate, 15.5 mg / kg copper sulfate, 0.91 mg / kg cobalt sulfate, 1.5 mg / kg potassium iodide, 0.6 mg / kg sodium selenite and 899.7 mg / kg starch.

[0055] The experimental group was provided with a diet containing 310 g fish meal, 200 g soybean meal, 100 g corn gluten meal, 113 g high-gluten flour, 120 g cassava starch, 30 g fish oil, 30 g soybean oil, 50 g multi-mineral premix, 3.9 g multi-vitamin premix, 1.1 g choline chloride, 8 g L-isoleucine A crystals, 6 g methionine, 15 g arginine, and 8 g threonine.

[0056] The control group 1 provided a diet for snakehead fish comprising: 310 g fish meal, 200 g soybean meal, 100 g corn gluten meal, 113 g high-gluten flour, 120 g cassava starch, 30 g fish oil, 30 g soybean oil, 50 g multi-mineral premix, 3.9 g multi-vitamin premix and 1.1 g choline chloride.

[0057] The control group 2 provided a diet for snakehead fish containing: 310 g fish meal, 200 g soybean meal, 100 g corn gluten meal, 113 g high-gluten flour, 120 g cassava starch, 30 g fish oil, 30 g soybean oil, 50 g multi-mineral premix, 3.9 g multi-vitamin premix, 1.1 g choline chloride, 8 g lysine, 6 g methionine, 15 g arginine, and 8 g threonine.

[0058] The control group 3 provided a diet for snakehead fish containing: 310 g fish meal, 200 g soybean meal, 100 g corn gluten meal, 113 g high-gluten flour, 120 g cassava starch, 30 g fish oil, 30 g soybean oil, 50 g multi-mineral premix, 3.9 g multi-vitamin premix, 1.1 g choline chloride, 8 g L-isoleucine B crystals, 6 g methionine, 15 g arginine, and 8 g threonine.

[0059] 2. Experimental fish and feeding management

[0060] The experimental Channa scorpion fingerlings were purchased from Nanhai Bairong Aquatic Breeding Farm, with an average body weight of (16.5±0.17) g, no injuries on the surface, and a strong physique. The breeding experiment was carried out at the Hui breeding farm of the Pearl River Fisheries Research Institute. Nine nylon breeding cages of 1.2m×1.2m×1.5m were prepared, and 60 strong, healthy Channa scorpion cages were placed in each cage. The cages were aerated, sewage was sucked out daily, and about 1 / 5 of the water volume was replaced for 8 weeks of breeding and feeding.

[0061] After the experimental fish were domesticated for one week, the experiment officially began. The daily feeding rate was 3% to 5%, and was adjusted accordingly according to the weather and feeding conditions. The feeding cycle was 4 weeks, and the water temperature was 26 to 29°C. The feeding frequency was 2 times / d, and the feeding time was 08:00 and 17:00.

[0062] After the breeding experiment, all fish were fasted for 24 h, and the fish in each cage were fished out, counted and weighed after anesthesia. Six Channa maculata were randomly selected from each cage, and their body length and weight were measured.

[0063] 3. Growth index determination

[0064] Weight gain rate = (W t -W0) / W0×100%;

[0065] Specific growth rate = (ln W t -ln W0) / t×100%;

[0066] Fullness = W / L 3 ×100%;

[0067] Protein efficiency = (W t -W0) / (W f ×Cp);

[0068] Where: W0 is the fish weight at the beginning of the experiment (g); W t W is the fish weight at the end of the experiment (g); f is the food intake (g); Cp is the protein quality fraction of the feed (%); W and L are the fish body weight (g) and body length (cm) respectively; N t N0 and N1 are the numbers of surviving fish at the beginning and end of the experiment respectively; t is the breeding time (d).

[0069] 4. Analysis of intestinal digestive enzyme activity

[0070] Take about 0.5g of intestinal tissue, add the corresponding amount of physiological saline (pre-cooled in advance) at a ratio of 1:5 (w / v), homogenize on ice, centrifuge at 4℃ (3000g) for 20min, and take the supernatant for enzyme activity analysis. The protein concentration of intestinal tissue homogenate was determined using Nanjing Jiancheng Biological Kit. The intestinal trypsin, amylase, and lipase activities were determined respectively, and the specific operations were strictly carried out in accordance with the instructions of each kit.

[0071] 5. Detection of TOR and related gene expression in Channa liver

[0072] Total RNA was extracted from the liver of Channa chub using the Trizol method and the kit One-Step gDNAremoval and cDNA Synthesis SuperMix (Quanshijin, Beijing) was used to synthesize cDNA, and primers for TOR, 4EBP1, and 4EBP2 genes were synthesized. RPSD (DQ848899.1) was used as the internal reference gene. Fluorescence quantitative PCR was used for detection.

[0073] The cDNA template was diluted 4 times, and the reaction system was as follows: 1 μL cDNA, 1 μL each of 10 μM upstream and downstream primers, 12.5 μL HiFi PCR SuperMixⅡ was filled with water to 25 μL. PCR amplification program: 94℃ pre-denaturation for 2 min (1 cycle); 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min (35 cycles); 72℃ extension for 5 min (1 cycle); 4℃ storage. Based on the Ct values ​​of TOR, 4EBP1, and 4EBP2 genes, 2 -ΔΔCt The mRNA expression level was calculated by the method, and the relative expression level was calculated with the positive control group as the base value. The primers are as follows:

[0074] RPSD-F: CTGCTGTTCCCTAAAGAGTTCG, SEQ ID NO.1

[0075] RPSD-R:GAGCCGTGTAGTTCAGGGTCT, SEQ ID NO.2

[0076] TOR-F:GCAGGAAGTACATGCGGTCT, SEQ ID NO.3

[0077] TOR-R: GCTGGTTGGGGTCATAAGTG, SEQ ID NO.4

[0078] 4EBP1-F: CCGCAAGTTCCTACTGGAC, SEQ ID NO.5

[0079] 4EBP1-R: AGGCTTGCCATCGTGGTTGT, SEQ ID NO.6

[0080] 4EBP2-F: GACTCCACCAGCTCGTCTGC, SEQ ID NO.7

[0081] 4EBP2-R: CTGAGCATCACCGGTTG, SEQ ID NO.8

[0082] 5. Calculation methods and statistical analysis

[0083] The obtained data were analyzed by variance analysis and multiple comparisons using SPSS software.

[0084] 2. Results

[0085] 1. Growth performance test

[0086] like Figures 1 to 4 It can be seen that the weight gain rate, specific growth rate and protein efficiency of the experimental group were significantly increased compared with those of the control group 1, control group 2 and control group 3, indicating that the addition of L-isoleucine A crystals in the snakehead feed is beneficial to its growth.

[0087] 2. Digestive enzyme activity detection

[0088] like Figures 5 to 7 It can be seen that the activities of intestinal digestive enzymes, trypsin, lipase and amylase in the experimental group were significantly increased compared with those in the control group 1, control group 2 and control group 3, indicating that adding L-isoleucine A crystals to the snakehead feed is beneficial to improving the digestive ability of snakehead.

[0089] 3. Detection of liver TOR gene expression

[0090] like Figure 8 As shown, the relative expression of TOR mRNA in the experimental group was significantly increased compared with that in the control group 1, control group 2 and control group 3, while the relative expression of 4EBP1 and 4EBP2 gene mRNA was significantly decreased, indicating that the addition of L-isoleucine A crystals in the snakehead feed is beneficial to increasing the TOR gene expression and reducing the 4EBP1 and 4EBP2 gene expression in snakehead.

[0091] TOR is a highly conserved serine / threonine kinase. The TOR signaling pathway is the key to the effective response of organisms to changes in the nutritional environment and is also an important pathway for regulating growth. Rapamycin target protein complex 1 (TORC1) is a key protein that regulates the downstream eukaryotic initiation factor 4E binding protein (4EBPs) of the TOR signaling pathway. When the TOR signaling pathway is activated, TORC1 can phosphorylate some amino acid sites of 4EBPs and downregulate the expression level of 4EBPs genes, thereby further affecting downstream pathways and promoting protein synthesis.

[0092] In the test case, it was found that the expression levels of TOR, 4EBP1, and 4EBP2 mRNA in the liver of turbot fry were related to whether L-isoleucine A crystals were added, which indicates that L-isoleucine A crystals in the feed have a significant effect on the TOR signaling pathway in the liver of fry.

[0093] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A snakehead feed comprising, by weight: 250~350 parts of fish meal, 150~250 parts of soybean meal, 50~150 parts of corn gluten meal, 80~120 parts of high-gluten flour, 100~150 parts of cassava starch, 15~35 parts of fish oil, 20~40 parts of soybean oil, 40~60 parts of multi-mineral premix, 3~5 parts of multi-dimensional premix, 0.8~1.5 parts of choline chloride, 5~10 parts of L-isoleucine A crystals, 4~8 parts of methionine, 10~20 parts of arginine and 5~10 parts of threonine; The preparation process of the L-isoleucine A crystal comprises: (1) Add 500 g of water and 4.537 g of acetic acid into a 500 mL jacketed crystallizer, heat the crystallizer to 363.15 K using a constant speed programmable thermostat, and set the stirring rate to 400 rpm; (2) After the temperature is constant, add 30 g of L-isoleucine raw material and stir at constant temperature for 60 min to ensure that all the solid is dissolved; (3) Cooling the system at a rate of 2 K / min using a constant-speed programmable thermostatic bath; when crystals appear and the solution becomes turbid, stop cooling and keep the solution warm for 30 min; (4) The slurry is filtered using a Buchner funnel, and the obtained solid is placed in an oven at 313.15K and dried for 24 hours to obtain L-isoleucine A crystals.

2. The snakehead feed according to claim 1, comprising, by weight: 300 parts of fish meal, 220 parts of soybean meal, 120 parts of corn gluten meal, 100 parts of high-gluten flour, 110 parts of tapioca starch, 35 parts of fish oil, 25 parts of soybean oil, 55 parts of multi-mineral premix, 3.5 parts of multi-vitamin premix, 1 part of choline chloride, 10 parts of L-isoleucine A crystals, 7 parts of methionine, 12 parts of arginine and 9 parts of threonine.

3. The snakehead feed according to claim 1, comprising, by weight: 350 parts of fish meal, 180 parts of soybean meal, 80 parts of corn gluten meal, 120 parts of high-gluten flour, 130 parts of tapioca starch, 20 parts of fish oil, 35 parts of soybean oil, 45 parts of multi-mineral premix, 4.5 parts of multi-vitamin premix, 1.2 parts of choline chloride, 6 parts of L-isoleucine A crystals, 5 parts of methionine, 18 parts of arginine and 6 parts of threonine.

4. The snakehead feed according to claim 1, comprising, by weight: 310 parts of fish meal, 200 parts of soybean meal, 100 parts of corn gluten meal, 113 parts of high-gluten flour, 120 parts of tapioca starch, 30 parts of fish oil, 30 parts of soybean oil, 50 parts of multi-mineral premix, 3.9 parts of multi-vitamin premix, 1.1 parts of choline chloride, 8 parts of L-isoleucine A crystals, 6 parts of methionine, 15 parts of arginine and 8 parts of threonine.

5. The snakehead feed according to any one of claims 1 to 4, wherein the multidimensional premix comprises, by weight, 10 to 30 parts of vitamin B1, 10 to 30 parts of vitamin B2, 10 to 30 parts of vitamin B6, 0.01 to 0.03 parts of vitamin B12, 4 to 6 parts of folic acid, 40 to 60 parts of calcium pantothenate, 80 to 120 parts of inositol, 80 to 120 parts of niacin, 0.05 to 0.15 parts of biotin, 3000 to 4000 parts of cellulose, 80 to 120 parts of vitamin C, 8 to 12 parts of vitamin A, 1 to 3 parts of vitamin D, 80 to 120 parts of vitamin E and 8 to 12 parts of vitamin K.

6. The snakehead feed according to any one of claims 1 to 4, wherein the multi-dimensional premix comprises, by weight, 20 parts of vitamin B1, 20 parts of vitamin B2, 20 parts of vitamin B6, 0.02 parts of vitamin B12, 5 parts of folic acid, 50 parts of calcium pantothenate, 100 parts of inositol, 100 parts of niacin, 0.1 parts of biotin, 3522 parts of cellulose, 100 parts of vitamin C, 11 parts of vitamin A, 2 parts of vitamin D, 100 parts of vitamin E and 10 parts of vitamin K.

7. The snakehead feed according to any one of claims 1 to 4, wherein the multi-mineral premix comprises, by weight, 400 to 600 parts of sodium chloride, 7,000 to 9,000 parts of magnesium sulfate, 10,000 to 15,000 parts of sodium dihydrogen phosphate, 16,000 parts of potassium dihydrogen phosphate, 7,000 to 8,000 parts of calcium hydrogen phosphate, 2,000 to 3,000 parts of ferrous sulfate, 1,000 to 2,000 parts of calcium lactate, 100 to 200 parts of zinc sulfate, 50 to 70 parts of manganese sulfate, 10 to 20 parts of copper sulfate, 0.8 to 1 part of cobalt sulfate, 1.0 to 1.5 parts of potassium iodide, 0.4 to 0.8 parts of sodium selenite and 800 to 1,000 parts of starch.

8. The snakehead feed according to any one of claims 1 to 4, wherein the multi-mineral premix comprises, by weight, 500 parts of sodium chloride, 8155.6 parts of magnesium sulfate, 12500 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7650.6 parts of calcium hydrogen phosphate, 2286.2 parts of ferrous sulfate, 1750 parts of calcium lactate, 178 parts of zinc sulfate, 61.4 parts of manganese sulfate, 15.5 parts of copper sulfate, 0.91 parts of cobalt sulfate, 1.5 parts of potassium iodide, 0.6 parts of sodium selenite and 899.7 parts of starch.

9. A method for preparing a snakehead feed, comprising: Obtain the composition of the Channa feed; Prepare according to the composition; The composition comprises, by weight: 250-350 parts of fish meal, 150-250 parts of soybean meal, 50-150 parts of corn gluten meal, 80-120 parts of high-gluten flour, 100-150 parts of cassava starch, 15-35 parts of fish oil, 20-40 parts of soybean oil, 40-60 parts of multi-mineral premix, 3-5 parts of multi-dimensional premix, 0.8-1.5 parts of choline chloride, 5-10 parts of L-isoleucine A crystals, 4-8 parts of methionine, 10-20 parts of arginine and 5-10 parts of threonine; The preparation process of the L-isoleucine A crystal comprises: (1) Add 500 g of water and 4.537 g of acetic acid into a 500 mL jacketed crystallizer, heat the crystallizer to 363.15 K using a constant speed programmable thermostat, and set the stirring rate to 400 rpm; (2) After the temperature is constant, add 30 g of L-isoleucine raw material and stir at constant temperature for 60 min to ensure that all the solid is dissolved; (3) Cooling the system at a rate of 2 K / min using a constant-speed programmable thermostatic bath; when crystals appear and the solution becomes turbid, stop cooling and keep the solution warm for 30 min; (4) The slurry is filtered using a Buchner funnel, and the obtained solid is placed in an oven at 313.15K and dried for 24 hours to obtain L-isoleucine A crystals.

10. The preparation method according to claim 9, wherein the composition comprises, by weight: 300 parts of fish meal, 220 parts of soybean meal, 120 parts of corn gluten meal, 100 parts of high-gluten flour, 110 parts of tapioca starch, 35 parts of fish oil, 25 parts of soybean oil, 55 parts of multi-mineral premix, 3.5 parts of multi-vitamin premix, 1 part of choline chloride, 10 parts of L-isoleucine A crystals, 7 parts of methionine, 12 parts of arginine and 9 parts of threonine.

11. The preparation method according to claim 9, wherein the composition comprises, by weight: 350 parts of fish meal, 180 parts of soybean meal, 80 parts of corn gluten meal, 120 parts of high-gluten flour, 130 parts of tapioca starch, 20 parts of fish oil, 35 parts of soybean oil, 45 parts of multi-mineral premix, 4.5 parts of multi-vitamin premix, 1.2 parts of choline chloride, 6 parts of L-isoleucine A crystals, 5 parts of methionine, 18 parts of arginine and 6 parts of threonine.

12. The preparation method according to claim 9, wherein the composition comprises, by weight: 310 parts of fish meal, 200 parts of soybean meal, 100 parts of corn gluten meal, 113 parts of high-gluten flour, 120 parts of tapioca starch, 30 parts of fish oil, 30 parts of soybean oil, 50 parts of multi-mineral premix, 3.9 parts of multi-vitamin premix, 1.1 parts of choline chloride, 8 parts of L-isoleucine A crystals, 6 parts of methionine, 15 parts of arginine and 8 parts of threonine.

13. The preparation method according to claim 9, wherein the multidimensional premix comprises 10 to 30 parts of vitamin B1, 10 to 30 parts of vitamin B2, 10 to 30 parts of vitamin B6, 0.01 to 0.03 parts of vitamin B12, 4 to 6 parts of folic acid, 40 to 60 parts of calcium pantothenate, 80 to 120 parts of inositol, 80 to 120 parts of niacin, 0.05 to 0.15 parts of biotin, 3000 to 4000 parts of cellulose, 80 to 120 parts of vitamin C, 8 to 12 parts of vitamin A, 1 to 3 parts of vitamin D, 80 to 120 parts of vitamin E and 8 to 12 parts of vitamin K by weight.

14. The preparation method according to claim 9, wherein the multi-dimensional premix comprises, by weight, 20 parts of vitamin B1, 20 parts of vitamin B2, 20 parts of vitamin B6, 0.02 parts of vitamin B12, 5 parts of folic acid, 50 parts of calcium pantothenate, 100 parts of inositol, 100 parts of niacin, 0.1 parts of biotin, 3522 parts of cellulose, 100 parts of vitamin C, 11 parts of vitamin A, 2 parts of vitamin D, 100 parts of vitamin E and 10 parts of vitamin K.

15. The preparation method according to claim 9, wherein the multi-mineral premix comprises, by weight, 400-600 parts of sodium chloride, 7,000-9,000 parts of magnesium sulfate, 10,000-15,000 parts of sodium dihydrogen phosphate, 16,000 parts of potassium dihydrogen phosphate, 7,000-8,000 parts of calcium hydrogen phosphate, 2,000-3,000 parts of ferrous sulfate, 1,000-2,000 parts of calcium lactate, 100-200 parts of zinc sulfate, 50-70 parts of manganese sulfate, 10-20 parts of copper sulfate, 0.8-1 part of cobalt sulfate, 1.0-1.5 parts of potassium iodide, 0.4-0.8 part of sodium selenite and 800-1,000 parts of starch.

16. The preparation method according to claim 9, wherein the multi-mineral premix comprises, by weight, 500 parts of sodium chloride, 8155.6 parts of magnesium sulfate, 12500 parts of sodium dihydrogen phosphate, 16000 parts of potassium dihydrogen phosphate, 7650.6 parts of calcium hydrogen phosphate, 2286.2 parts of ferrous sulfate, 1750 parts of calcium lactate, 178 parts of zinc sulfate, 61.4 parts of manganese sulfate, 15.5 parts of copper sulfate, 0.91 parts of cobalt sulfate, 1.5 parts of potassium iodide, 0.6 parts of sodium selenite and 899.7 parts of starch.

17. A method for feeding a snakehead, comprising: Obtaining the snakehead feed as claimed in any one of claims 1 to 8; The snakehead feed is fed to the snakehead.

18. The use of the snakehead feed according to any one of claims 1 to 8, wherein the use is selected from: Increase the weight of Channa; Improve the specific growth rate of Channa; Improve the protein efficiency of Channa; Improve the intestinal trypsin activity of Channa; Improve the intestinal amylase activity of Channa; Improve the intestinal lipase activity of Channa; Promote TOR gene expression in the liver of Channa; Inhibiting the expression of 4EBP1 gene in the liver of Channa nautilus; or Inhibit at least one of the 4EBP2 gene expressions in the liver of Channa nautilus.

Images