Anti-alanyl-trna synthetase single chain antibodies and methods of making the same
The preparation of anti-alanyl-tRNA synthetase single-chain antibodies using phage display technology solves the antibody acquisition problem, enables the preparation of high-titer antibodies, and is suitable for in vitro diagnostic kits, showing broad application potential.
Patent Information
- Application Number
- CN202410434828.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-11
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-04-11
AI Technical Summary
There are currently no reports on single-chain antibodies against alanyl-tRNA synthetase, making it difficult to obtain high-titer antibodies for the diagnosis and treatment of antisyntheticase syndrome.
Single-chain antibodies against alanyl-tRNA synthetase were prepared using phage display technology. The DNA sequences, including the variable regions of the heavy and light chains, were used to amplify ScFv using RT-PCR, PCR, and overlap extension PCR. Combined with phage display screening, a high-titer antibody library was obtained.
This technology enables the production of antibodies with large antibody library capacity, simple operation, low cost, and high titer, laying the foundation for in vitro diagnostic kits and showing broad application prospects.
Smart Images

Figure CN118184791B_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of biomedical technology, and more specifically, relates to an anti-alanyl-tRNA synthetase single-chain antibody and its preparation method. Background Technology
[0002] Phage display is a recombinant expression technology based on the principles of genetic engineering. This technology is used to insert the nucleotide sequence encoding a foreign protein into the genome of the coat protein on the surface of the phage. The phage replicates and proliferates to express the protein in large quantities, thereby displaying a library of antigens, antibodies, etc. on the surface of the phage. After multiple rounds of screening, the target product that meets the requirements is finally obtained.
[0003] Anti-synthesizer syndrome is a type of autoimmune disease belonging to idiopathic myositis. Its serological characteristic is the presence of autoantibodies against cytoplasmic aminoacyl-tRNA synthetase (aaRSs). Clinical features include interstitial lung disease, myositis, Raynaud's phenomenon, arthritis, mechanic's hand, and fever. The autoantibody against alanyl-tRNA synthetase, also known as anti-PL-12 antibody, was the third myositis-specific autoantibody discovered by Bunn et al. in 1986. Anti-PL-12 IgG can independently recognize two antigens: alanyl-tRNA synthetase and its homologous tRNA; this recognition occurs through a separate autoantibody.
[0004] There are currently no reports on single-chain antibodies against alanyl-tRNA synthetase. Summary of the Invention
[0005] The technical problem to be solved by this invention is: how to obtain a single-chain antibody against alanyl-tRNA synthetase.
[0006] In a first aspect, the present invention provides a single-chain antibody against alanyl-tRNA synthetase, comprising a heavy chain variable region and a light chain variable region, wherein the DNA sequence of the heavy chain variable region is shown in SEQ ID NO: 1 and the DNA sequence of the light chain variable region is shown in SEQ ID NO: 2.
[0007] As one possible design, the amino acid sequence of the heavy chain CDR region is VHCDR1 as shown in SEQ ID NO: 3, VHCDR2 as shown in SEQ ID NO: 4, and VHCDR3 as shown in SEQ ID NO: 5; the amino acid sequence of the light chain CDR region is VLCDR1 as shown in SEQ ID NO: 6, VLCDR2 as shown in SEQ ID NO: 7, and VLCDR3 as shown in SEQ ID NO: 8.
[0008] In a second aspect, the present invention provides a method for preparing a single-chain antibody against alanyl-tRNA synthetase, comprising:
[0009] S1. Total RNA was extracted from the spleen of immunized mice, and the heavy chain variable region and light chain variable region sequences were amplified by RT-PCR and PCR, and then ScFv was obtained by overlap extension PCR.
[0010] S2.ScFv was ligated after double digestion with pCANTAB5e phage plasmid;
[0011] The S3.pCANTAB5e-ScFv ligation product was electroporated into competent cells, rescued by helper phages, and a ScFv antibody library was obtained.
[0012] S4. Coat the enzyme-labeled plate with the target antigen and perform 3-5 rounds of antibody library screening to obtain the ScFv with the highest titer.
[0013] As one possible design, the immunized mouse refers to a mouse capable of synthesizing full-length alanyl-tRNA synthetase protein; the RT-PCR primer is Oligo(dT)18; the heavy chain variable region PCR primers are: VHF1 as shown in SEQ ID NO: 9, VHF2 as shown in SEQ ID NO: 10, VHF3 as shown in SEQ ID NO: 11, VHF4 as shown in SEQ ID NO: 12, VHR1 as shown in SEQ ID NO: 13, VHR2 as shown in SEQ ID NO: 14, VHR3 as shown in SEQ ID NO: 15; the light chain variable region PCR primers are: VLF1 as shown in SEQ ID NO: 16, VLF2 as shown in SEQ ID NO: 17, VLF3 as shown in SEQ ID NO: 18, VLF4 as shown in SEQ ID NO: 19, VLR1 as shown in SEQ ID NO: 20, VLR2 as shown in SEQ ID NO: 21, VLR3 as shown in SEQ ID NO: 22; the overlap extension PCR primer is: ScFv F Sfi I as shown in SEQ ID As shown in NO:23, ScFv R Not I is as shown in SEQID NO:24.
[0014] As one possible design, in step S2, the ScFv and pCANTAB5e phage plasmids are ligated after double digestion with Sfi I and Not I, respectively.
[0015] As one possible design, the competent cells described in step S3 are Escherichia coli TG1.
[0016] As one possible design, the phage described in step S3 is M13K07.
[0017] As one possible design, the target antigen in step S4 is human cytoplasmic alanyl-tRNA synthetase, and the antigen amino acid sequence is the full-length amino acid sequence of alanyl-tRNA synthetase (NCBI Seq.: NP_001596.2). The His-tagged fusion protein is constructed and expressed in HEK293 cells and obtained by nickel column affinity chromatography.
[0018] As one possible design, in step S2, the upstream primer of the heavy chain introduces an Sfi I restriction site and a protective base, and the downstream primer of the light chain introduces a Not I restriction site and a protective base.
[0019] As one possible design, a 15-amino acid (Gly4Ser)3 sequence is introduced into the heavy chain downstream primer and the light chain upstream primer as a linker sequence.
[0020] The beneficial effects of this invention are as follows:
[0021] Healthy mice were immunized with alanyl-tRNA synthetase antigen prepared in our laboratory. After the antibody titer was qualified, RNA was extracted from the spleen. ScFv was obtained by RT-PCR, PCR, and overlap extension PCR. After ligation with the pCANTAB5e vector, a phage antibody library was obtained by electroporation. After multiple rounds of screening, high-titer antibody sequences were obtained. This invention has the advantages of large antibody library capacity, relatively simple operation, and low cost, laying the foundation for further application in in vitro diagnostic kits and has broad application prospects. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of this application, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 This is an agarose gel electrophoresis image of VH and VL.
[0024] Figure 2 This is a PCR agarose gel electrophoresis image of ScFv.
[0025] Figure 3 The pCANTAB 5e vector spectrum.
[0026] Figure 4 This is a graph showing the results of an ELISA test between ScFv and the antigen. Detailed Implementation
[0027] To make the technical problems, technical solutions, and beneficial effects to be solved by this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and are not intended to limit the scope of this application.
[0028] It should be noted that when a component is referred to as being "fixed to" or "set on" another component, it can be directly on or indirectly on that other component. When a component is referred to as being "connected to" another component, it can be directly connected to or indirectly connected to that other component.
[0029] It should be understood that the terms "length", "width", "upper", "lower", "front", "rear", "left", "right", "vertical", "horizontal", "top", "bottom", "inner", "outer", etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are only for the convenience of describing this application and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on this application.
[0030] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of this application, "multiple" means two or more, unless otherwise explicitly specified.
[0031] Anti-synthesizer syndrome is a type of autoimmune disease belonging to idiopathic myositis. Its serological characteristic is the presence of autoantibodies against cytoplasmic aminoacyl-tRNA synthetase (aaRSs). Clinical features include interstitial lung disease, myositis, Raynaud's phenomenon, arthritis, mechanic's hand, and fever. The autoantibody against alanyl-tRNA synthetase, also known as anti-PL-12 antibody, was the third myositis-specific autoantibody discovered by Bunn et al. in 1986. Anti-PL-12 IgG can independently recognize two antigens: alanyl-tRNA synthetase and its homologous tRNA; this recognition occurs through a separate autoantibody.
[0032] There are currently no reports on single-chain antibodies against alanyl-tRNA synthetase.
[0033] This invention discloses a single-chain antibody against alanyl-tRNA synthetase, comprising a heavy chain variable region and a light chain variable region, wherein the DNA sequence of the heavy chain variable region is shown in SEQ ID NO: 1, and the DNA sequence of the light chain variable region is shown in SEQ ID NO: 2.
[0034] SEQ ID NO: 1 is atggagtctgggggaggcttagtgaagccttctgggtccctgttcctctcctgtaccaagtctggattcactttctggcagga ctctagtactcaacaggttaccactccggagaagtctctggagtgggtcaggaccgcaactagtcaagtgggtaagtggtggcagttcgcaccattaattcgaactttc accatcctcgttggtactgccaagaacaccctgtacctgcaaatgagcaacttcttggctgaggacacatacaagcgaccaattaatccaagttggtatactggtattgg atctattaagcaaggcaccactctcacagtctcctcagccaaa。
[0035] SEQ ID NO: 2 is ctgtctgtgactccaggagatagcgtcagtctttcctgcagggccagccaatccagtatttatgtcaacctac atgaggattccattaatcttcgagacgattactctccaaggcttgacctcatcaagtatggttgcttatccatctcttcacatgaaatacatgagtatgt cattttcaatagtagaggatcagggacagatttcactctcagtatcttaactgtggagactgaagattttgacagtggaatgtatttctgttcccagcc aagtcataacactttcgcattcggatcggggaccaagctggaaataaaacgg。
[0036] Amino acid sequence of the heavy chain CDR region:
[0037] VHCDR1 (SEQ ID NO: 3): WQDSSTQ
[0038] VHCDR2 (SEQ ID NO: 4): TSQVGKWWQFAPL
[0039] VHCDR3 (SEQ ID NO: 5): NPSWYTGIGSIK
[0040] Amino acid sequence of the light chain CDR region:
[0041] VLCDR1 (SEQ ID NO: 6):DSINLRDDY
[0042] VLCDR2 (SEQ ID NO: 7): HEYVI
[0043] VLCDR3 (SEQ ID NO: 8): SQPSHNTFA
[0044] This invention discloses a method for preparing a single-chain antibody against alanyl-tRNA synthetase, comprising the following steps:
[0045] S1. Total RNA was extracted from the spleen of immunized mice. The heavy chain variable region and light chain variable region sequences were amplified by RT-PCR and PCR, and then ScFv was obtained by overlap extension PCR amplification.
[0046] S2, ScFv and pCANTAB5e phage plasmids were ligated after double digestion with Sfi I and Not I, respectively.
[0047] S3, pCANTAB5e-ScFv ligation product was electroporated into E. coli TG1 competent cells, and rescued with helper phage to obtain ScFv antibody library.
[0048] S4. Using target antigen-coated ELISA plates, perform 3-5 rounds of antibody library screening to obtain the highest titer ScFv.
[0049] 1. The alanyl-tRNA synthetase single-chain antibody obtained by phage display screening has advantages over hybridoma technology, such as large antibody library capacity, relatively simple operation, and low cost. It has broad prospects for the application of this antibody in the preparation of in vitro diagnostic kits and lays the foundation for its further application in in vitro diagnostic kits.
[0050] 2. The alanyl-tRNA synthetase single-chain antibody obtained by phage display screening has a high titer.
[0051] To provide a clearer and more complete description of the technical solution of the present invention, the following will further elaborate on it in conjunction with specific embodiments.
[0052] Example 1
[0053] Acquisition of immune antibody libraries
[0054] 1.1 Mouse Immunization
[0055] Mice were immunized with alanyl-tRNA synthetase antigen, and the immunization was repeated until the antibody titer reached the required level (i.e., a titer greater than or equal to 1 × 10⁻⁶). 6 ).
[0056] 1.2 Total RNA extraction from mouse spleen
[0057] The spleens of mice were removed after sacrifice, ground into powder with liquid nitrogen, and total RNA was extracted from the spleens using the TRIzol method.
[0058] Example 2
[0059] Amplification of ScFv
[0060] 2.1 RT-PCR amplification
[0061] Specifically, total RNA, Oligo(dT)18 primers and purified water were added first, and the mixture was treated at 65°C for 5 min. Then, RT enzyme, Reaction Mix and gDNA remover were added, and the mixture was treated at 42°C for 30 min to amplify cDNA by reverse transcription.
[0062] 2.2 PCR amplification
[0063] Primers for amplifying the heavy chain variable region were any combination of SEQ ID NO: 9-SEQ ID NO: 12 and SEQ ID NO: 13-SEQ ID NO: 15 (a total of 12 combinations), and primers for amplifying the light chain variable region were any combination of SEQ ID NO: 16-SEQ ID NO: 19 and SEQ ID NO: 20-SEQ ID NO: 22 (a total of 12 combinations). The upstream primer of the heavy chain introduced a Sfi I restriction site and a protective base, and the downstream primer of the light chain introduced a Not I restriction site and a protective base. A 15-amino acid (Gly4Ser)3 sequence was introduced as a linker in both the downstream primer of the heavy chain and the upstream primer of the light chain. Specifically, using cDNA as a template, the amplification reaction was performed for 30 cycles: denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, and extension at 72℃ for 40 s. Agarose gel electrophoresis was performed to recover the amplified heavy chain and light chain variable region DNA fragments.
[0064] The primer sequences are as follows:
[0065] VHF1 (SEQ ID NO: 9): cggagtcaggccaccggcctacctcagaccccctccgaatcacttcgga
[0066] VHF2 (SEQ ID NO: 10): cggagtcaggccaccggcctacctcagaccctatccgaatcacttacct
[0067] VHF3(SEQ ID NO:11):cggagtcaggccaccggcctacctcagaccccctcttgatcacgatgga
[0068] VHF4(SEQ ID NO:12):cggagtcaggccaccggcctacctcagagtacctccgaatcaacctgta
[0069] VHR1(SEQ ID NO:13):acttggtggtggtggacttggtggtggtggacttggtggtggtggaaaccgactcctctgacactc tcaccacgg
[0070] VHR2(SEQ ID NO:14):acttggtggtggtggacttggtggtggtggacttggtggtggtggaaaccgactaacctgacactc tcagaccgg
[0071] VHR3(SEQ ID NO:15):acttggtggtggtggacttggtggtggtggacttggtggtggtggaaaccgactcctctgctactct catcgaat
[0072] VLF1(SEQ ID NO:16):ccaccaccaccaagtccaccaccaccaagtccaccaccaccaagtgacagacactgaggtcctc tatcgcagtca
[0073] VLF2(SEQ ID NO:17):ccaccaccaccaagtccaccaccaccaagtccaccaccaccaagtgacagacactgaggtttgct atcgctgaat
[0074] VLF3(SEQ ID NO:18):ccaccaccaccaagtccaccaccaccaagtccaccaccaccaagtgacagacacacacttcctct atcgcagtca
[0075] VLF4 (SEQ ID NO: 19):ccaccaccaccaagtccaccaccaccaagtccaccaccaccaagtgacagacactgaggtcctc taagatccgat
[0076] VLR1 (SEQ ID NO: 20): ataagaatgcggccgcggcaaaataaaggtcgaaccaggggctagg
[0077] VLR2 (SEQ ID NO: 21): ataagaatgcggccgcggcaaaatattacgagaaccattagctagg
[0078] VLR3 (SEQ ID NO: 22): ataagaatgcggccgcggcaaaataaaggtcgaacgtactggattc
[0079] 2.3 Overlap Extension PCR Amplification
[0080] The upstream primer introduces an Sfi I restriction site and a protective base, and the downstream primer introduces a Not I restriction site and a protective base. ScFv F Sfi I is shown in SEQ ID NO: 23, and ScFv R Not I is shown in SEQ ID NO: 24. Specifically, the VH and VL products obtained from PCR amplification were used as a mixed template, denatured at 94℃ for 30s, annealed at 62℃ for 30s, and extended at 72℃ for 40s, for 30 cycles of amplification. ScFv was then randomly spliced using overlap extension PCR technology. The VH and VL products were subjected to agarose gel electrophoresis, and the results are shown below. Figure 1 As shown, the amplified ScFv DNA fragments were recovered.
[0081] The primer sequences are as follows:
[0082] ScFv F Sfi I (SEQ ID NO: 23): cggagtcaggccaccggcctacctcagaccc
[0083] ScFv R Not I (SEQ ID NO: 24): ataagaatgcggccgcggcaaaataaag
[0084] Example 3
[0085] Construction of phage antibody library
[0086] 3.1 Double digestion of ScFv and pCANTAB5e
[0087] The ScFv fragment and pCANTAB5e vector were simultaneously double-digested. Specifically, Not I was added first, and the digestion was carried out at 37°C for 10 hours. After Not I digestion, ScFv I was added, and the digestion was carried out at 50°C for 6 hours. Agarose gel electrophoresis was performed, and the results are as follows. Figure 2 As shown, the target fragment is retrieved.
[0088] 3.2 Preparation of pCANTAB5e-ScFv recombinant
[0089] Specifically, the ligation reaction system was prepared at a ScFv:pCANTAB5e ratio of 1:3 and reacted at 16°C for 18 hours. Agarose gel electrophoresis was performed to recover the target fragment. The pCANTAB5e vector spectrum is shown below. Figure 3 As shown.
[0090] 3.3pCANTAB5e-ScFv EDM TG1
[0091] Specifically, the ligation product was added to TG1 competent cells, mixed well, and quickly transferred to a dry, pre-chilled electroporation cuvette. Electroporation was performed at 2.5 kV for 10 ms. Immediately after electroporation, preheated SOC medium (antibiotic-free) at 37°C was added, and the cells were cultured at 37°C and 200 rpm for 1 h with shaking. The cells were centrifuged at 4000 rpm for 10 min, and 1 / 5 of the supernatant was retained. The cells were gently resuspended, and a small amount was spread onto 2xYT-A plates (containing Amp resistance). The cells were incubated in an inverted incubator at 37°C overnight. The remaining bacterial culture was diluted with 50% glycerol to a final concentration and then frozen for storage as a primary antibody library.
[0092] Example 4
[0093] ScFv selection
[0094] 4.1 Identification of positive clones
[0095] Specifically, on the second day, single colonies were picked from the plate and inoculated into 2xYT-A liquid medium (containing Amp resistance), and incubated at 37°C and 200 rpm for 4 hours on a shaker. The bacterial culture was then used for PCR identification, and the PCR procedure was the same as 2.3 in Example 2. Positive clones were expanded and cultured, and plasmids were extracted and double-digested for identification. Clones with bands that met the expectations were sequenced for identification and the bacterial strain was retained.
[0096] 4.2 Phage rescue and proliferation
[0097] Specifically, positive bacterial strains were placed in 2xYT-A liquid medium (containing Amp resistance) and incubated at 37°C and 200 rpm for 4 hours. Helper phage M13K07 was added at a moi ratio of 20:1, and the culture was incubated at 37°C for 1 hour. Then, the culture was incubated at 37°C and 200 rpm for 1 hour. The bacteria were precipitated by centrifugation at 400 rpm for 10 minutes, and the supernatant was discarded. The bacteria were resuspended in 2xYT-A liquid medium (containing Amp and Kan resistance) and incubated overnight at 37°C and 200 rpm. The bacterial culture was collected and centrifuged at 10,000 rpm for 20 minutes. The supernatant was retained, and 1 / 5 volume of PEG-8000 / NaCl was added and the culture was incubated on ice for 1 hour to precipitate the phage. The culture was centrifuged at 4,000 rpm for 20 minutes to ensure that all supernatant was removed. The precipitate was resuspended in 1 / 50 volume of PBS and centrifuged at 8,000 rpm for 10 minutes. The supernatant was retained and became the ScFv library.
[0098] 4.3 ScFv Selection
[0099] Specifically, alanine-tRNA synthetase target antigen was diluted in sodium carbonate coating solution and coated onto an ELISA plate at an antigen concentration of 100 μg / mL and a coating volume of 100 μL, and incubated overnight at 4°C. The coating solution was discarded, and the plate was washed 5 times with PBST. Blocking solution (5% skim milk powder-PBST) was added, and the plate was blocked at 37°C for 2 hours. The blocking solution was discarded, and the plate was washed 5 times with PBST. A phage library diluted in PBS was added, and the plate was bound at 37°C for 2 hours. The plate was washed 10 times with PBST. 2M Gly-HCl (pH 2.2) was added, and the plate was incubated at 37°C for 10 minutes. The liquid in the wells was agitated to elute the phages, which were then transferred to centrifuge tubes. Tris-HCl (pH 8.0) was quickly added for neutralization, followed by the addition of TG1 bacterial culture. The plate was incubated at 37°C for 30 minutes and then incubated on a shaker at 200 rpm for 1 hour, thus completing the first round of panning. After the first round of panning, the phages were rescued and proliferated according to step 4.2, and then subjected to subsequent panning. Starting from the second panning, the antigen coating concentration was reduced to 50 μg / mL, and the number of washes after phage incubation increased with each panning round (an increase of 5 times per round). The remaining panning methods were the same as in the first round. After a total of 3 rounds of panning, the final antibody library with the highest titer was obtained.
[0100] Example 5
[0101] ELISA of ScFv with target antigen
[0102] Specifically, BSA, immunogen, and control antigen (Alanyl-tRNA Synthetase (PL-12), purchased from DIARECT) were diluted in sodium carbonate coating buffer and coated onto ELISA plates. The antigen concentration was 5 μg / mL, and the coating volume was 100 μL. The plates were incubated overnight at 4°C. The coating buffer was discarded the next day, and the plates were washed three times with PBST. Blocking buffer (5% skim milk powder-PBST) was added, and the plates were blocked at 37°C for 2 hours. The blocking buffer was discarded, and the plates were washed three times with PBST. The panned final phage ScFv antibody library diluted in PBS was added, and the plates were bound at 37°C for 1 hour. The plates were washed five times with PBST. Mouse anti-M13 antibody (HRP-labeled) was added, and the plates were incubated at 37°C for 1 hour. The plates were washed five times with PBST. TMB chromogenic solution was added, and the plates were incubated at 37°C for 15 minutes. The reaction stop solution (blue to yellow, color development within 20 minutes) was added, and the absorbance was measured at 450 nm using an ELISA reader to determine the binding ability of the antibody to the target antigen. The results are as follows: Figure 4 As shown.
[0103] Depend on Figure 4 It can be seen that the absorbance of the coated antigen obtained by the binding of the antibody to the target antigen is higher than that of the control antigen, indicating that the antibody has a strong binding ability to the target antigen.
[0104] Healthy mice were immunized with antigens prepared in our laboratory. After the antibody titers were qualified, RNA was extracted from the spleen. ScFv was obtained through RT-PCR, PCR, and overlap extension PCR. After ligation with the pCANTAB5e vector, a phage antibody library was obtained by electroporation. After multiple rounds of screening, high-titer antibody sequences were obtained. This invention has the advantages of large antibody library capacity, relatively simple operation, and low cost, laying the foundation for further application in in vitro diagnostic kits and has broad application prospects.
[0105] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A single-chain antibody against alanyl-tRNA synthetase, characterized in that, The anti-alanyl-tRNA synthetase single-chain antibody includes a heavy chain variable region and a light chain variable region. The DNA sequence of the heavy chain variable region is shown in SEQ ID NO: 1, and the DNA sequence of the light chain variable region is shown in SEQ ID NO:
2.
2. The anti-alanyl-tRNA synthetase single-chain antibody according to claim 1, characterized in that, The amino acid sequences of the heavy chain CDR region are VHCDR1 as shown in SEQ ID NO: 3, VHCDR2 as shown in SEQ ID NO: 4, and VHCDR3 as shown in SEQ ID NO: 5; the amino acid sequences of the light chain CDR region are VLCDR1 as shown in SEQ ID NO: 6, VLCDR2 as shown in SEQ ID NO: 7, and VLCDR3 as shown in SEQ ID NO: 8.
Citation Information
Patent Citations
Innovative discovery of therapeutic, diagnostic, and antibody compositions related to protein fragments of alanyl-trna synthetases
US20130287755A1
Human asparaginyl-tRNA synthetase DNA
US6245539B1