Rice nitrate transporter gene NRT6, protein encoded by the gene and application thereof

Abstract

The present application relates to the field of plant genetic engineering, in particular to a rice nitrate transporter gene NRT6, the protein encoded by the gene and application thereof. The present application discloses a rice nitrate transporter gene NRT6, and the nucleotide sequence of the gene NRT6 is shown in Seq ID No:1. The present application also simultaneously provides the use of the gene NRT6: regulating the transportation of nitrate in rice, that is, regulating the transportation of nitrate from the root to the above-ground part by using the above-mentioned rice nitrate transporter gene NRT6.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to the rice nitrate transporter gene NRT6 and its encoded protein and applications. Background Technology

[0002] Rice is one of my country's most important food crops and a model plant for monocotyledonous plant research. To promote rice yield, the application of nitrogen fertilizer in agriculture has been continuously increasing. This not only leads to a decrease in nitrogen use efficiency (NUE) but also causes environmental pollution and increases production costs. Therefore, improving rice nitrogen use efficiency while reducing nitrogen fertilizer use is of great significance.

[0003] Nitrate nitrogen is one of the important forms of nitrogen source absorption by plants. It can be stored in vacuoles in organs such as roots and stems, and plays a role when nitrogen is deficient. Moreover, rice roots have well-developed aerenchyma tissues, and the oxygen secretion capacity of the roots can release NH4+. + Oxidized to NO3 - And it is utilized by rice. Although rice is an ammonium-loving crop, studies have shown that under flooded conditions, the proportion of nitrate nitrogen absorbed and utilized by rice is as high as 40% (Kirk GJ, Kronzucker HJ. The potential for nitrification and nitrate uptake in the rhizosphere of wetland plants: a modelling study. Annals of Botany, 2005, 96(4): 639-646). Further studies have shown that compared with ammonium nitrogen alone, nitrification conditions can improve the nitrogen use efficiency and yield of rice (Tan Jiankang, Zhang Yali, Shen Qirong, Xu Guohua. Effects of different forms of nitrogen ratio on water use efficiency and biological effects of rice seedlings. Journal of Nanjing Agricultural University, 2002, 25(3): 49-52).

[0004] The utilization of nitrate nitrogen by rice mainly depends on the nitrate nitrogen absorption efficiency and utilization efficiency. Nitrate is absorbed from the external environment into the roots by nitrate transporters. There are two different nitrate nitrogen absorption systems in plants: high affinity uptake systems (HATS) and low affinity uptake systems (LATS). Both systems are regulated by nitrate nitrogen supply, enabling plants to respond to low or high concentrations of nitrate nitrogen. When the nitrate nitrogen concentration in the growth medium is below 1 mM, the root system mainly relies on HATS to absorb nitrate nitrogen; when the nitrate nitrogen concentration in the growth medium is above 1 mM, it mainly relies on LATS (Crawford NM, Glass A. Molecular and physiological aspects of nitrate uptake in plants. Trends in Plant Science, 1998, 3(10): 389-395; Tong Yiping, Cai Chao, Liu Quanyou, Li Jiyun, Li Zhensheng. Progress in molecular biology of nitrate nitrogen uptake in plants. Journal of Plant Nutrition and Fertilizer, 2004, 10(4): 433-440). In higher plants, nitrate absorption is mainly carried out by members of the nitrate transporter family, including NRT1 / PTR (NPF), a component of the low-affinity nitrate transporter system, and NRT2, a component of the high-affinity nitrate transporter system.

[0005] Reported genes encoding low-affinity nitrate transporters include OsNRT1 (Lin C, Koh S, Stacey G, Yu S, Lin T, Tsay Y. Cloning and functional characterization of a constitutively expressed nitrate transporter gene, OsNRT1, from rice. Plant physiology, 2000, 122(2):379-388) and OsNPF4.5 (Wang S, Chen A, Xie K, Yang X, Luo Z, Chen J, Zeng D, Ren Y, Yang C, Wang L, Feng H, López-Arredondo DL, Herrera-Estrella LR, Xu G. Functional analysis of the OsNPF4.5 nitratetransporter reveals a conserved mycorrhizal pathway of nitrogen acquisition in plants. Proc Natl Acad Sci US). A.2020,117(28):16649-16659), OsNRT1.6 (Xia X,Fan X,Wei J,Feng H,Qu H,Xie D,Miller A,Xu G. Rice nitrate transporter OsNPF2.4 functions in low-affinity acquisition and long-distance transport.Journal of Experimental Botany,2015,66(1):317-331), etc.; high-affinity nitrate transporter genes include OsNRT2.1, OsNRT2.2, OsNRT2.3 and OsNRT2.4 (Feng H,Yan M,Fan X,Li B,Shen Q,Miller A,Xu G.Spatial expression and regulation of rice high-affinity nitrate transporters by nitrogen and carbon status).Journal of Experimental Botany, 2011, 62(7):2319-2332), and NAR2.1, an important member of the high-affinity nitrate transport system (Yan M, Fan X, Feng H, Miller A, Shen Q, Xu G. Rice OsNAR2.1 interacts with OsNRT2.1, OsNRT2.2 and OsNRT2.3a nitrate transporters to provide uptake over high and low concentration ranges. Plant, Cell & Environment, 2011, 34(8):1360-1372).

[0006] The isolation of the gene encoding the nitrate transporter NRT6 in rice has not yet been reported.

[0007] Chlorate is an analogue of nitrate and can be reduced to toxic chlorite by nitrate reductase. When Aberg (1947) first studied the mechanism of chlorate resistance in wheat, he proposed that the toxicity of chlorate lies in the catalytic reduction of it by nitrate reductase to the toxic compound chlorite, which is poisonous to plants and inhibits their growth (Aberg B. On the mechanism of the toxic action of chlorates and some related substances upon young wheat plants. Annu Rev Agri Coll Sweden, 1947, 15:37-107). Therefore, potassium chlorate sensitivity reflects, to some extent, the capacity for nitrate nitrogen absorption, translocation, and assimilation. Potassium chlorate resistance has been widely used in the screening of mutants with nitrate nitrogen uptake, transport and assimilation defects in plants (Crawford NM. Study of chlorate-resistant mutants of Arabidopsis: Insights into nitrate assimilation and ion metabolism of plants. In: Genetic Engineering Principles and Methods, Vol. 14. Setlow JK, ed. Plenum Press, ISBN 0-306-44234-5, New York. 1992, pp. 89-99). Summary of the Invention

[0008] The technical problem to be solved by this invention is to provide the rice nitrate transporter gene NRT6 and its encoded protein and its applications.

[0009] To solve the above-mentioned technical problems, the present invention provides a rice nitrate transporter gene NRT6, the nucleotide sequence of which is shown in Seq ID No: 1.

[0010] As an improvement to the rice nitrate transporter gene NRT6 of the present invention: the cDNA nucleotide sequence of gene NRT6 is shown in Seq ID No: 2 and Seq ID No: 3.

[0011] The present invention also provides the protein encoded by the above-mentioned gene NRT6, the amino acid sequence of which is shown in Seq ID No: 4.

[0012] The present invention also provides a knockout vector containing the above-mentioned gene NRT6: the vector is based on CRISPR / Cas9-MH, and the editing target site sequence located in the exon of gene NRT6 is inserted between the BsaI-BsaI restriction sites of the base vector.

[0013] The present invention also provides an overexpression vector containing the above-mentioned gene NRT6, which is obtained by inserting the CDS sequence (Seq ID No: 3) of the Nipponbare gene NRT6 between the SacI restriction sites of the base vector, using pCAMBIA1300-UBi as the base vector.

[0014] The present invention also provides a host cell containing the above-mentioned genes, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.

[0015] The present invention also provides the use of gene NRT6: regulating the transport of nitrate in rice, that is, using the above-mentioned rice nitrate transporter gene NRT6 to regulate the transport of nitrate from the roots to the aboveground parts.

[0016] As an improvement to the use of the gene NRT6 of the present invention: a knockout vector or an overexpression vector is transformed into monocotyledonous plant (e.g., rice) cells, and the transformed monocotyledonous plant cells are then cultured into plants.

[0017] This invention also provides a method for regulating nitrate transport in rice:

[0018] The knockout vector CRISPR / Cas9-MH-NRT6 was transformed into rice cells to obtain knockout mutants, and the amount of nitrate transported from the roots to the shoots of the rice was significantly reduced.

[0019] Transforming rice cells with the overexpression vector pCAMBIA1300-UBi-NRT6 significantly increased the amount of nitrate transported from the roots to the aboveground parts of the rice.

[0020] The technical solution provided by this invention is as follows:

[0021] The rice nitrate transporter gene NRT6 of this invention has the sequences shown in (a) and (b):

[0022] (a) Genomic nucleotide sequence shown in Seq ID No: 1;

[0023] (b) cDNA nucleotide sequences of 9311 and Nipponbare shown in Seq ID No: 2 and Seq ID No: 3;

[0024] The genomic nucleotide sequence of 9311 shown in Seq ID No: 1 contains 8418 nucleotides (including the terminator TGA), the cDNA sequence of 9311 shown in Seq ID No: 2 contains 1773 nucleotides (including the terminator TGA), and the cDNA sequence of Nipponbare shown in Seq ID No: 3 contains 1773 nucleotides (including the terminator TGA). There are 19 SNPs in Seq ID No: 2 and Seq ID No: 3.

[0025] Another object of the present invention is to provide a protein encoded by the above-mentioned gene having the sequence shown in (A):

[0026] (A) The amino acid sequence shown in Seq ID No: 4;

[0027] The protein represented by Seq ID No:4 is a nitrate transporter with 590 amino acids.

[0028] The present invention also aims to provide a knockout and overexpression vector containing the rice nitrate transporter gene NRT6, wherein the knockout vector is... Figure 4 The CRISPR / Cas9-MH-NRT6 gene, as shown in Figure A, underwent gene editing, resulting in a deletion mutation that prematurely terminates protein translation (116 amino acids), as indicated by Seq ID No: 5, leading to the deletion of the NRT6 protein. The overexpression vector is... Figure 4 As shown in B, the pCAMBIA1300-UBi-NRT6 vector can enhance NRT6 expression. The invention also aims to provide host cells containing the aforementioned rice gene NRT6, wherein the host cells are Escherichia coli cells, Agrobacterium cells, or plant cells.

[0029] The present invention also aims to regulate the transport of nitrate from the roots to the above-ground parts using the rice nitrate transporter gene NRT6, including transforming rice cells with a knockout and overexpression vector constructed from a gene having the nucleotide sequence shown in the rice nitrate transporter gene NRT6, and then cultivating the transformed rice cells into plants. The rice nitrate transporter gene NRT6 can be used to regulate the transport of nitrate nitrogen in rice roots, thereby promoting an increase in nitrate nitrogen in the above-ground parts, improving nitrogen use efficiency and yield in rice.

[0030] The specific technical steps for implementing this invention are as follows:

[0031] I. Screening and Identification of Candidate Genes

[0032] Since potassium chlorate sensitivity reflects, to some extent, the ability to absorb, transport, and assimilate nitrate nitrogen, this invention treated the two parents of rice RIL populations 9311 and PA64S with a 0.1% potassium chlorate solution and found significant differences between them. The differences between 9311 and Nipponbare were also significant. Figure 1 A and B). The continuous normal distribution in the RIL population indicates that the sensitivity of rice to potassium chlorate is a quantitatively inherited trait, allowing for QTL analysis. QTL mapping analysis was performed using a high-density SNP map of this RIL population. The results showed a major-effect QTL on rice chromosome 6 with a LOD value of 3.27, located between markers SNP6-111 and SNP6-114.

[0033] To precisely locate this major QTL, this invention constructed a BC4F2 population with 9311 and PA64S as parents, and analyzed the sequence between the two molecular markers SNP6-111 and SNP6-114, developing new molecular markers. Ultimately, the major QTL was precisely located within a physical distance of approximately 22.7 kb between markers SNP6.1 and INDEL6.2. Figure 2 By analyzing the open reading frame (ORF) of this region, the candidate gene NRT6 was inferred. Figure 3 ).

[0034] II. Identification and Functional Analysis of the NRT6 Gene

[0035] Using transgenic technology, this invention obtained gene knockout and overexpression plants of the NRT6 gene. Figure 4 ). 15 NO3 - Content determination results confirmed that this invention yielded rice plants with increased nitrate translocation. Compared with wild-type Nipponbare, the nitrate nitrogen translocation from roots to aboveground parts of each transgenic line showed significant differences, with knockout plants exhibiting significantly reduced nitrate translocation and overexpression plants showing significantly increased nitrate translocation. Figure 5), thus increasing the effective tiller number of rice, significantly improving the yield per plant and nitrogen use efficiency. Figure 6 ) This result proves that the present invention has cloned the nitrate transporter gene NRT6.

[0036] The present invention uses map-based cloning technology, further locates the BC4F2 population of PA64S and 9311 in combination with gene annotation and gene sequencing, determines the nitrate transporter gene NRT6, and identifies the gene function through transgenic knockout and overexpression experiments. The cloning and application of the NRT6 gene contribute to the elucidation of the molecular mechanism of nitrate nitrogen utilization in rice and lay a solid theoretical foundation for nitrogen-efficient breeding.

[0037] Efficient absorption and transport of nitrate nitrogen are the basis for efficient nitrogen utilization in plants, and an important participant in this process is the nitrate transporter. Therefore, the research on the rice nitrate transporter NRT6 can provide an important basis for elucidating the mechanism of nitrogen absorption and utilization and breeding new rice varieties with high nitrogen efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The following further elaborates on the specific embodiments of the present invention in conjunction with the drawings.

[0039] Figure 1 (A) shows the phenotypes of rice varieties 9311, PA64S, and Nipponbare after treatment with 0.1% potassium chlorate solution; (B) shows the comparison of potassium chlorate resistance of 9311, PA64S, and Nipponbare; the scale bar is 0.5 cm.

[0040] Figure 2 is the fine mapping diagram of the NRT6 gene.

[0041] Figure 3 is the difference in the CDS of the NRT6 gene between 9311 and PA64S.

[0042] Figure 4 are the vector schematic diagrams and transgenic molecular identifications. (A) CRISPR / Cas9-MH-NRT6 knockout vector; (B) pCAMBIA1300-UBi-NRT6 overexpression vector; (C) sequencing sequences near the editing site of wild-type Nipponbare and NRT6 gene knockout plants; (D) PCR identification of the NRT6 gene in Nipponbare and overexpression lines (NRT6-OE1, NRT6-OE2). (E) Relative expression levels of the NRT6 gene in Nipponbare and overexpression lines (NRT6-OE1, NRT6-OE2). The values represent the mean and standard deviation of three biological replicates; ** indicates a highly significant level in the t-test at the 0.001 < P < 0.01 level.

[0043] Figure 5It is found in Nipponbare, NRT6 gene knockout mutants, and overexpression plants from roots to aboveground parts. 15 NO3 - Transport volume comparison; numerical values ​​represent the mean and standard deviation of three biological replicates; a, b, and c indicate that the t-test shows a significant difference at the P<0.05 level.

[0044] Figure 6 This study compares the effective tiller number (A), yield per plant (B), and agronomic nitrogen use efficiency (C) of Nipponbare, NRT6 gene knockout mutant (NRT6-KO), and overexpression plants (NRT6-OE1, NRT6-OE2). Values ​​represent the mean and standard deviation of three biological replicates; a, b, and c indicate that the t-test showed a significant difference at the P < 0.05 level. Detailed Implementation

[0045] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0046] Example 1: QTL mapping and candidate gene identification

[0047] 1. Rice materials

[0048] The indica rice varieties were “9311” and “PA64S” (Oryza sativa L. indica). A recombinant inbred line (RIL) population was constructed using 9311 and PA64S as parents. The BC4F2 segregating population was obtained by backcrossing PA64S with 9311.

[0049] 2. Localization of potassium chlorate resistance QTL qCR6

[0050] A rapid method for extracting trace amounts of rice DNA was used to extract genomic DNA for gene mapping from rice leaves. 0.2 g of rice leaves were frozen in liquid nitrogen, ground into powder in a 5 cm diameter mortar, and transferred to a 1.5 ml centrifuge tube for DNA extraction. The extracted DNA was dissolved in 150 μl of ultrapure water. 2 μl of DNA sample was used for each PCR reaction.

[0051] Preliminary localization of qCR6: Since potassium chlorate sensitivity reflects, to some extent, the ability to absorb, transport, and assimilate nitrate nitrogen, this invention treated the two parents of rice RIL populations 9311 and PA64S with 0.1% potassium chlorate solution and found significant differences between them. 9311 also showed significant differences compared to Nipponbare. Figure 1A, B). A RIL population consisting of 132 lines of 9311 and PA64S was used as the QTL mapping population. Based on the published high-resolution genetic map of indica rice 9311 and PA64S, QTL mapping analysis revealed a major QTL for potassium monochloride resistance, qCR6, between markers SNP6-111 and SNP6-114 on rice chromosome 6. Figure 2 A), with a LOD value of 3.27.

[0052] Fine mapping of qCR6: Using the BC4F2 population, which was a backcross self-cross of PA64S and 9311, as the fine mapping population, the sequence between the two markers SNP6-111 and SNP6-114 was analyzed. Based on the sequences of indica rice 9311 and PA64S, three InDel markers and one SNP marker were developed (as shown in Table 1). Finally, the major QTL was precisely located within a physical distance of approximately 22.7 kb between markers SNP6.1 and INDEL6.2. Figure 2 B).

[0053] Table 1. Molecular markers developed for fine-targeting

[0054]

[0055] *F: forward primer; R: reverse primer.

[0056] 3. Gene prediction and comparative analysis:

[0057] A precisely located 22.7 kb region contains an annotation gene predicted to encode nitrate / peptide transport. Because it is located on chromosome 6, it has been named NRT6 (Nitrate transporter 6). Figure 2 C). Comparison of genomic DNA and cDNA showed that the gene contains 3 introns and 4 exons, with sequences as shown in Seq ID No: 1 and Seq ID No: 2. Comparison with the whole genome sequence of 9311 revealed that the gene is a single copy.

[0058] This invention designed sequencing primers for this gene and used PCR to amplify the candidate gene NRT6 from the genomes of 9311 and PA64S for sequencing analysis. Sequence alignment revealed that the coding regions of 9311 and PA64S contain a total of 17 SNPs (…). Figure 3 Of these, six sites cause changes in amino acids, with glycine being the most affected in 9311. 299 alanine 304 threonine 305 Serine 307 Valine 308 alanine 311 alanine 313Valine 347 In PA64S, it is serine. 299 Valine 304 alanine 305 glycine 307 alanine 308 Valine 311 threonine 313 Isoleucine 347 These differential sites may lead to differences in the function of the NRT6 protein in 9311 and PA64S.

[0059] Example 2: Plant Transformation and Functional Analysis

[0060] I. Obtaining NRT6 gene knockout mutants

[0061] 1. NRT6 was knocked out using the pYLCRISPR / Cas9-MH gene editing vector (provided by Professor Liu Yaoguang's research group at South China Agricultural University). The sequence TTCCTCCTCGCCCTCCTTGG in the CDS region of the NRT6 gene was selected as the editing target site (i.e., the editing target sequence located in exon 3 of the NRT6 gene). Figure 4 A). The primer sequences for vector construction are as follows:

[0062] NRT6-sgRNA-F1:TGCATTCCTCCTCGCCCTCCTTGG

[0063] NRT6-sgRNA-R1: AAACCCAAGGAGGGCGAGGAGGAA

[0064] FR-F: CTCCGTTTTACCTGTGGAATCG

[0065] FR-R: CGGAGGAAAATTCCATCCAC

[0066] B1-F:TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG

[0067] B1-R: GCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC

[0068] SP1: CCCGACATAGATGCAATAACTTC

[0069] SP2: GGCCGGTGTCATCTATGTTACT

[0070] The concentration of all the above primers was 10 μM.

[0071] 2. NRT6 gene knockout vector construction steps:

[0072] Preparation of target adapters: Take 10 μl of each of NRT6-sgRNA-F and NRT6-sgRNA-R primers and put them into 80 μl of water. Incubate at 94°C for 1 minute and cool to room temperature to form primer dimers.

[0073] sgRNA expression cassette preparation reaction system: 1 μl U3 plasmid (provided by Liu Yaoguang's research group at South China Agricultural University); 1 μl target adapter; 0.5 μl restriction endonuclease BsaI (NEB); 0.5 μl T4 ligase (NEB); 1 μl T4 buffer; 6 μl lddH2O.

[0074] sgRNA expression cassette preparation reaction procedure: (1) 37℃, 5 minutes; (2) 20℃, 5 minutes; repeat steps (1)-(2) for 7 cycles.

[0075] The first round of sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl sgRNA expression cassette; 1 μl each of primers FR-F and FR-R; and 21 μl ddH2O.

[0076] The first round of amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.

[0077] The second-round amplification sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl of the first-round amplification product; 1 μl each of primers B1-F and B1-R; and 21 μl ddH2O.

[0078] The second round of amplification procedure is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.

[0079] The sgRNA and CRISPR / Cas9-MH gene editing vector were digested with restriction endonuclease BsaI at 37°C for 15 minutes. The digestion reaction system consisted of: 1 μl of the second-round amplified sgRNA expression cassette; 1 μl of CRISPR / Cas9-MH plasmid; 0.5 μl of restriction endonuclease BsaI (NEB); and 12.5 μl of ddH2O.

[0080] Add 0.5 μl of T4 ligase and 1.7 μl of T4 buffer to the product and perform a ligation-cleavage reaction. The reaction program is as follows: (1) 37℃, 5 minutes; (2) 10℃, 5 minutes; (3) 20℃, 5 minutes; (4) 12℃, hold. Repeat steps (1)-(3) for 20 cycles.

[0081] The above reaction products were transformed into E. coli cells, and the transformed single colonies were identified by PCR. The reaction system was as follows: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); single colonies picked; 0.2 μl each of primers SP1 and SP2; 4.6 μl lddH2O.

[0082] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 60℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0083] Single colonies containing the NRT6 gene-specific target sequence were screened using primer SP2 sequencing, and the plasmid extracted was the desired recombinant knockout vector CRISPR / Cas9-MH-NRT6.

[0084] 3. The rice variety Nipponbare was transformed with CRISPR / Cas9-MH-NRT6 containing the NRT6 specific target site. The sequences at both ends of the target site were amplified using knockout identification primers and then sequenced for identification.

[0085] The knockout identification primer sequences are as follows:

[0086] NRT6-CRISPR-F1:ATTGTTTGCCGTCATAAGCC

[0087] NRT6-CRISPR-R1:ACTGCACACACAAACAAGC

[0088] PCR reaction system for identifying mutant transgenic plants: 5 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers NRT6-CRISPR-F1 and NRT6-CRISPR-R1, NRT6-CRISPR-F2 and NRT6-CRISPR-R2; 2.6 μl ddH2O.

[0089] The amplification program is as follows: (1) 94℃, 4 minutes; (2) 98℃, 30 seconds; (3) 60℃, 30 seconds; (4) 68℃, 60 seconds; (5) 68℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0090] The NRT6 gene knockout mutant was obtained by comparison with Seq ID No:1. The obtained gene knockout mutant carries the deletion mutation. Figure 4 C) The amino acid sequence of the gene knockout mutant is shown in Seq ID No: 5.

[0091] II. Obtaining NRT6 gene overexpression lines

[0092] The CDS sequence (Seq ID No: 3) of the Nipponbare NRT6 gene was amplified and ligated between the SacI molecules of the vector pCAMBIA1300-UBi (provided by Apiv Biotechnology Co., Ltd.) to obtain the pCAMBIA1300-UBi-NRT6 fusion expression vector. Figure 4 B). The correctly sequenced plasmid was transformed into the rice variety Nipponbare, and two overexpressing transgenic plants were obtained by PCR identification and quantitative expression detection. Figure 4 (D, E). The primer sequences involved are as follows:

[0093] NRT6-OVER-F: TGTTACTTCTGCAGGAGCTCATGGAGGACGGTGCGGCG

[0094] NRT6-OVER-R: CTCACCATGGATCCGGTACCTCCCTTGATGACCCCGGC

[0095] NRT6-F: GCTCGAGTTCTTCTTCAGCG

[0096] GFP-R: CTTCATGTGGTCGGGGTAGC

[0097] PCR reaction system for CDS sequence amplification of NRT6 gene: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl cDNA obtained by reverse transcription of total RNA from 9311 aerial parts; 1 μl each of primers NRT6-OVER-F and NRT6-OVER-R; 21 μl ddH2O.

[0098] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 58℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0099] PCR reaction system for identifying overexpressing transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers NRT6-F and GFP-R; 2.6 μl ddH2O.

[0100] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 58℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.

[0101] III. Determination of NRT6 gene knockout mutants and overexpression lines, and analysis of expression levels from roots to aerial parts. 15 NO3 - Transport volume measurement

[0102] Sequencing revealed that the knockout mutant, after gene editing, contained a deletion mutation. Figure 4 C). The transcriptional expression level of the NRT6 gene in overexpressing plants was measured, and significant differences were confirmed between the overexpressing plants and the wild type. Figure 4 E). The roots of approximately 4-week-old transgenic plants were treated with 0.1 mM CaSO4 solution for 1 min, followed by treatment with a solution containing 1.25 mM... 15 NO3 - The rice seedlings were treated with IRRI solution for 24 h, then the roots were treated with 0.1 mM CaSO4 solution for 1 min. The aboveground parts and roots of the rice seedlings were separated and placed in an oven at 105℃ for 30 min, then dried in an oven at 75℃ and weighed. Isotope mass spectrometry was used to determine the composition of the samples. 15 NO3 - concentration.

[0103] The results are as follows:

[0104] Compared to wild-type Nipponbare, the knockout mutant showed differences in growth from roots to above-ground parts. 15 NO3 - The translocation rate was significantly reduced, and the overexpression lines showed a decrease from roots to aerial parts. 15 NO3 - The transshipment volume increased significantly. Figure 5 This indicates that NRT6 is a control... 15 NO3 - Candidate genes for transport.

[0105] IV. Field survey of effective tillers, yield per plant, and agronomic nitrogen use efficiency of NRT6 gene knockout mutants and overexpression lines.

[0106] The number of effective tillers, agronomic nitrogen use efficiency, and yield per plant at maturity were determined in the NRT6 gene knockout mutant and overexpression lines in the Hangzhou Fuyang transgenic nursery. Agronomic nitrogen use efficiency refers to the ratio of plant yield per unit area to nitrogen application rate (Chen J, Zhang Y, Tan Y, et al. Agronomic nitrogen-use efficiency of rice can be increased by driving OsNRT2.1 expression with the OsNAR2.1 promoter. Plant Biotechnol J, 2016, 14(8): 1705-1715). The results showed that the number of effective tillers in the knockout mutant was significantly reduced ( Figure 6 A), the yield per plant decreased significantly ( Figure 6 B), NUE decreased significantly ( Figure 6 C); the number of effective tillers in overexpression lines was significantly increased ( Figure 6 A) The yield per plant increased significantly ( Figure 6 B), agronomic nitrogen use efficiency increased significantly ( Figure 6 C). This indicates that NRT6 can promote tillering, improve nitrogen use efficiency, and increase yield.

[0107] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Rice nitrate transporter gene NRT6 Its uses are characterized by: Gene NRT6 The cDNA nucleotide sequence is shown in Seq ID No: 3; Gene NRT6 Its purpose is to regulate the transport of nitrates in rice.

2. A method for regulating nitrate transport in rice, characterized in that: Knockout vector CRISPR / Cas9-MH- NRT6 Transforming rice cells to obtain knockout mutants resulted in a significant reduction in nitrate transport from the roots to the aboveground parts of the rice. The overexpression vector pCAMBIA1300-UBi- NRT6 Transforming rice cells resulted in a significant increase in nitrate translocation from the roots to the aboveground parts of the rice. Gene NRT6 The cDNA nucleotide sequence is shown in Seq ID No: 3.

Images